CN106434920A - Lilium sargentiae Wilson anti-Lily-Fusarium-Wilt related gene KTI EST-PCR (expressed sequence tag-polymerase chain reaction) molecular marker and application thereof - Google Patents
Lilium sargentiae Wilson anti-Lily-Fusarium-Wilt related gene KTI EST-PCR (expressed sequence tag-polymerase chain reaction) molecular marker and application thereof Download PDFInfo
- Publication number
- CN106434920A CN106434920A CN201610858125.7A CN201610858125A CN106434920A CN 106434920 A CN106434920 A CN 106434920A CN 201610858125 A CN201610858125 A CN 201610858125A CN 106434920 A CN106434920 A CN 106434920A
- Authority
- CN
- China
- Prior art keywords
- lilium
- lily
- fusarium
- molecular marker
- kti
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Botany (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a Lilium sargentiae Wilson anti-Lily-Fusarium-Wilt related gene KTI EST-PCR (expressed sequence tag-polymerase chain reaction) molecular marker and application thereof, belonging to the technical field of gene engineering. The nucleotide sequence of the KTI gene is disclosed as SEQ ID NO.1. The molecular marker primers are selected from the following primer pair: forward primer: 5'-agatgtctgtggtgctg-3'; and reverse primer: 5'-gatttccgttgagtgtc-3'. The molecular marker primers are utilized to perform PCR amplification on different lily resources, and can be used for identifying different lily-fusarium-disease-resistant/infected lily resources on the molecular level according to the PCR amplification product strip. The molecular marker can also be used for identifying and distinguishing different lily strains, such as Lilium Oriental hybrids, Lilium Asiatic hybrids, LA strains and part of species of wild lilies. The molecular marker primers can provide certain help for selecting the parent materials in the disease-resistance breeding and lily crossbreeding processes.
Description
Technical field
The invention belongs to gene engineering technology field, and in particular to the anti-Fusarium bulbigenum droop related gene of population in Lilium sargenttiae Wilson
The EST-PCR molecular marker of KTI and its application.
Background technology
By Bulbus Lilii Fusarium oxysporum specialized form（Fusarium oxysporumf. sp.lilii）The Bulbus Lilii reaping hook for causing
Bacterium droop is to endanger disease the most serious in the production of current Bulbus Lilii.Fusarium bulbigenum droop（LilyFusarium
Wilt ）Also known as Bulbus Lilii root rot, stem rot, the disease not only results in the decline of lily cut flowers yield, and quality reduces, can also infect
Lily bulb base portion, causes basal disc necrosis, and scale rots, is scattered, bulb Quality Down, and Fusarium spp. is one kind in many crops
On cause the soil-borne fungus of serious plant disease, it is difficult to control effectively.Using anti-fusarium wilt lily germ plasm resource, screen
Disease-resistant gene is excavated, it is the most economical effective method of preventing and treating Fusarium bulbigenum droop to cultivate disease-resistant variety.
Different Bulbus Lilii strains（Kind or resource）Different to the Resistant expression of Fusarium bulbigenum droop, Lilium Pollyanna
Cenospecies（System）There are stronger resistance, part Wild lilies native to China and LA system Bulbus Lilii also to show preferable resistance to Fusarium spp., and
The resistance of oriental hybrid lily is worst.There is researcher using some as fusaridiosises of RAPD, AFLP equimolecular labelling to Lilium Pollyanna
Evil resistance is analyzed.
Population in Lilium sargenttiae Wilson（Lilium sargentiaeWilson）, it is that China is peculiar, flower pattern grace, pattern is pure white and has virtue
Perfume (or spice), and adaptability is good, resistance, in terms of especially showing the resistance to Fusarium bulbigenum droop, population in Lilium sargenttiae Wilson not only right and wrong
Important excellent in often good wild fresh-cut floral material, and the important breeding parent of some modern lily cultivar and Lilies breeding
Well-founded is because of donor material.
We screen a Kunitz by building the population in Lilium sargenttiae Wilson SSH library that Fusarium bulbigenum is induced from library
Type serine trypsin inhibitor（KTI）Gene EST, according to the est sequence, develops a pair of EST-PCR molecular marker and draws
Thing, the molecular marker not only can show the Bulbus Lilii resources of different anti-/ perception and carry out Resistance Identification to Fusarium bulbigenum droop.Also
Can carry out to including some the Bulbus Lilii resources in Lilium Germplasm, oriental hybrid lily strain, Lilium Pollyanna strain and LA Bulbus Lilii strain
Ore grade indexes are distinguished, and the selection for parent material in breeding for disease resistance and hybrid lily breeding process is supplied one by the molecular labeling primer
Fixed help.
Content of the invention
The invention aims to the deficiencies in the prior art are solved, provide a pair and come from population in Lilium sargenttiae Wilson（Lilium sargentiaeWilson）Fusarium bulbigenum fusarium wilt disease resistance related gene Kunitz type serine trypsin inhibitor
（KTI）The EST-PCR molecular labeling primer of gene, the molecular marker on a molecular scale not only can be to Fusarium bulbigenum droop
The Bulbus Lilii resource of the different anti-/ perception of performance（Kind）Identified, can also be to including Lilium Germplasm, oriental hybrid lily strain, Asia
Some Bulbus Lilii resources in Bulbus Lilii strain and LA Bulbus Lilii strain carry out ore grade indexes differentiation.The molecular labeling primer will be educated for disease-resistant
In kind and hybrid lily breeding process, the selection of parent material is helped for certain.
For achieving the above object, the technical solution used in the present invention is as follows：
The EST-PCR molecular marker of the anti-Fusarium bulbigenum droop related gene KTI of population in Lilium sargenttiae Wilson, described KTI gene nucleoside
Acid sequence is as shown in SEQ ID NO.1, and the molecular labeling primer is selected from following primer pair：
Forward primer：5’-agatgtctgtggtgctg-3’ （SEQ ID NO.2）,
Reverse primer：5’-gatttccgttgagtgtc-3’ （SEQ ID NO.3）.
The present invention also provides the EST-PCR molecule mark of the anti-Fusarium bulbigenum droop related gene KTI of above-mentioned population in Lilium sargenttiae Wilson
Remember the application in the identification of Fusarium bulbigenum fusarium wilt disease resistance.
Compared with prior art, its advantage is the present invention：
1 the invention discloses a pair comes from population in Lilium sargenttiae Wilson（Lilium sargentiaeWilson）Anti- Fusarium bulbigenum is withered
Disease of withering related gene Kunitz type serine trypsin inhibitor（KTI）The EST-PCR molecular labeling primer of gene, be first
The Bulbus Lilii EST-PCR molecular marker related to anti-Fusarium bulbigenum droop of report.The molecular marker is on a molecular scale not
Only can anti-/ perceptual Bulbus Lilii resources different to the performance of Fusarium bulbigenum droop（Kind）Identified, can also be wild to including
Some Bulbus Lilii resources in Bulbus Lilii, oriental hybrid lily strain, Lilium Pollyanna strain and LA Bulbus Lilii strain carry out ore grade indexes differentiation, root
According to amplified band, Bulbus Lilii resource can be sorted out, be such as oriental hybrid lily, or Lilium Pollyanna, or LA strain or wild hundred
Close.Selection for parent material in breeding for disease resistance and hybrid lily breeding process is helped by the molecular labeling primer for certain.
2nd, compare forefathers exploitation other molecular markers such as RAPD related to anti-Fusarium bulbigenum droop, DArT,
AFLP and NBS profiling equimolecular labelling（These molecular markers are only applicable to part Lilium Pollyanna strain）, the EST-
PCR molecular marker has the advantage that：Can be to including Lilium Germplasm, Lilium Pollyanna, oriental hybrid lily and LA Bulbus Lilii etc. multiple hundred
Close strain to be identified；The Bulbus Lilii resource that different resistances not only can be showed to Fusarium bulbigenum droop carries out Resistance Identification,
To a certain extent identification difference can also be carried out to different Bulbus Lilii strains；Directly hundred can be carried out to different Bulbus Lilii kinds money resource
Close fusarium wilt Resistance Identification, it is not necessary to build Bulbus Lilii anti-/ susceptible filial generation colony, save structure Bulbus Lilii anti-/ susceptible
The tedious work program of filial generation colony；The molecular marker is from EST, and conservative is higher, general between family and kind
Property ratio from non-express sequence labelling（As SSR marker）Comparative study that is higher, being more suitable between distant species；EST-
The exploitation of PCR molecular labeling primer is simple, quick, expense is low；
3rd, the molecular marker except different Bulbus Lilii resources can be carried out disease-resistant or susceptible identification and ore grade indexes classification in addition to, the molecule
Labelling PCR amplification shows population in Lilium sargenttiae Wilson（In figure numbering is ld）Complete with Ming River Bulbus Lilii (in figure numbering is mj) amplified band
Unanimously, Bulbus Lilii（In figure numbering is c）, Lilium Pollyanna（In figure numbering first letter is Y person）With LA strain（In figure numbering
One alpha code is L person）Consistent Deng the amplified band of other Bulbus Liliies, this proves population in Lilium sargenttiae Wilson and Ming River hundred to a certain extent
Close the two sibship more to close, this is consistent with the research conclusion of forefathers.And parent between Bulbus Lilii, LA strain Bulbus Lilii and Lilium Pollyanna
Edge relation is nearer, also consistent with the result of study of forefathers.
Description of the drawings
Fig. 1 is the amplification with KTI gene EST-PCR molecular labeling primer in 23 different lines Bulbus Liliies, and M is DL
2000 Marker, water is that negative control, remaining code name is shown in Table 1.
Specific embodiment
With reference to embodiment, the present invention is described in further detail.
It will be understood to those of skill in the art that the following example is merely to illustrate the present invention, and should not be regarded as limiting this
Bright scope.Unreceipted particular technique or condition person in embodiment, according to the technology described by document in the art or condition
Or carry out according to product description.Agents useful for same or the unreceipted production firm person of instrument, are and can be obtained by buying
Conventional products.
Population in Lilium sargenttiae Wilson（Public material, the sequencing of the population in Lilium sargenttiae Wilson such as Jiang Fuxing, Yang Lijuan transcript profile and specificity analysises west
Northern forestry institute's journal Journal of Northwest Forestry University 2015,30 (5): 143-150）Group
Seedlings cultivating carries out after the induction of row Fusarium spp. building SSH library after Fusarium bulbigenum induction（Poplar the lady in the moon is beautiful, Wang Youguo etc., and Fusarium spp. lures
The population in Lilium sargenttiae Wilson SSH library construction that leads and disease-resistant related gene screening northwest Botany Gazette Acta Bot. Boreal.-
Occident. Sin 2014,34(11):2170-2175）.
From random screening monoclonal SSH library carry out be sequenced comparison carry out function prediction, according to sequencing comparison result from
A Kunitz type serine trypsin inhibitor is obtained through Fusarium bulbigenum in the positive SSH library that population in Lilium sargenttiae Wilson is induced
（KTI）Gene est sequence, the EST nucleotides sequence is classified as（Underscore part is molecular labeling primer position）：
catggtttatgatacctctggcaacacgctcaaacccggaactccctactacatcacatcagctatatggggcgctg
gcggtggcgggctcttcccccttagtcgcccaagaatctgccctagatgtctgtggtgctgccccctaaatgtggct
cagaagtcgagcgacctcgacaaaggtctcccagtgtatttgtctccctccaactcgagcgaagaagtcgtgcatct
cctcaccgacctcaaaatcgagttcaccactcctccccccgatggtgggtcgccaatatggaagctcgatagcgctg
attccaacggccaacgatatgtgacactcaacggaaatccatttaacaccattgatgtgaaaaactggttcaagatt
gacaaagccgatgtatttggatacaaactgctatattgccccagtgtagccggcaaccttgccgatggtgcttgcgg
cagtctgggtatagagtacgaggatgggaaaaggtggttggttctgagcgacaacccgttctgggttgtctttgtca
aggcataacctctcatgggctcatgaaataagggcttttatgtctgagtgtttgctatgtgtaccagtgtgtggagt
cccatggaataagagctttgtgcctttgggttagctgaaaaaaaaaaaaaaaaaaaaaaaaaaaa.
According to the Candidate Disease Resistant Genes est sequence for being obtained, using 5.0 software Design primers of Primer：
Forward primer：5 '-agatgtctgtggtgctg-3 ',
Reverse primer：5’-gatttccgttgagtgtc-3’ .
With 23 Bulbus Lilii resources to the different anti-/ susceptibilities of Fusarium bulbigenum disease performance（Yang Xiumei, Wang Jihua etc., hundred
Close the identification gardening journal Acta Horticulturae Sinica of Variety Disease-resistance DNA homolog sequence analysis and anti-blight
2012, 39(12):2404–2412）2 L of genomic DNA enter the disease-resistant Molecular Identification of performing PCR to which for template.
As the different lines lily cultivar on market is too many, this research only have chosen relatively common on market, popular
, and forefathers did some different Bulbus Lilii strain cultivars and some important Lilium Germplasm Resources of anti-disease enzyme etc.
23 Bulbus Lilii resources as test material, as shown in table 1.
PCR reaction system：DNA 2µL；Each 0.5 L of the reverse primer of the forward primer of 10 M and 10 M；2.5µL 10×
buffer；The dNTP of 2.5 L 2.5mM；The Mg of 1.5 L 25mM2+；0.25µL (5U/µL)Taq polymerase
（TaKaRa）；Cumulative volume is added water to for 25 L.
PCR reaction condition is：94 DEG C of denaturations 3min；94 DEG C of 45 s, 45 DEG C of 45 s, 72 DEG C of 1min, 33 circulations；
72 DEG C of extension 10min.
PCR primer is that the detection of 1% agarose gel electrophoresiies is taken pictures through mass concentration, as shown in table 1, cuts bright amplification
Band, delivers the sequencing identification of Kunming Shuo Qing company after recovery, assay certificate amplified band is exactly KTI gene.
Table 1
23 Bulbus Lilii resources in table 1 resist/feel to Fusarium spp. performance and anti-/ sensing strong or weak classification refers to Yang Xiumei, Wang Jihua etc., and hundred
Close the identification gardening journal Acta Horticulturae Sinica of Variety Disease-resistance DNA homolog sequence analysis and anti-blight
2012, 39(12):2404–2412.
The discriminating of different lines is distinguished：It will be noted from fig. 1 that including Lilium Germplasm, oriental hybrid lily, Lilium Pollyanna and LA
Bulbus Lilii has certain difference in interior 4 different lily series, amplified band.Lilium Pollyanna strain is in 600bp or so（500bp and
Between 700bp）With 900bp or so（Between 700bp and 1000bp）There are 2 obvious amplified bands, and LA Bulbus Lilii strain
In addition to there are this 2 similar amplified bands, also in 400bp or so（Between 250bp and 500bp）There is an apparent expansion
Increase band.The amplified band of oriental hybrid lily strain is totally different from other Bulbus Lilii strains, only upper and lower in 250bp, have 2 more apparent
Amplified band.And Lilium Germplasm is more due to resource, regional difference is larger, so band is also not exclusively the same, but certain
Can also distinguish in degree and other strain Bulbus Liliies, from figure 1 it appears that due to population in Lilium sargenttiae Wilson (ld) and Ming River Bulbus Lilii（mj）
Evolutionary relationship is nearer, so their 2 amplified bands are just the same, respectively has one significantly in 250bp and 500bp or so
Amplified band, and Bulbus Lilii（c）Due to nearer with the genetic affinity of Lilium Pollyanna and LA Bulbus Lilii, so their amplification relatively phase
Seemingly, but also have certain difference, be exactly Bulbus Lilii except 600bp or so and 900bp or so respectively have 2 with Lilium Pollyanna strain and
Outside the duplicate amplified band of LA Bulbus Lilii strain, also one is had to be different from Lilium Pollyanna strain and LA Bulbus Lilii in 250bp or so
The amplified band of strain.And lanzhou lily（lz）Amplified band be different from other Bulbus Liliies completely, only 400bp or so have one
Bar is similar to the obvious band of the 400bp of LA Bulbus Lilii strain.
Anti-disease enzyme：In conjunction with Fig. 1, it can be appreciated that the amplified band of disease-resistant Bulbus Lilii is clearly distinguishable from susceptible Bulbus Lilii.Sense
The amplified band of sick Bulbus Lilii is all significantly smaller, and amplified band is only in 250bp or so, and amplified band is less, weaker.Susceptible Bulbus Lilii
Resource is also all oriental hybrid lily strain, and this is also consistent with document report.
Ultimate principle, principal character and the advantages of the present invention of the present invention has been shown and described above.The technology of the industry
Personnel it should be appreciated that the present invention is not restricted to the described embodiments, simply explanation described in above-described embodiment and description this
The principle of invention, without departing from the spirit and scope of the present invention, the present invention also has various changes and modifications, these changes
Change and improvement is both fallen within scope of the claimed invention.The claimed scope of the invention by appending claims and its
Equivalent thereof.
Sequence table
SEQ ID NO.1
catggtttat gatacctctg gcaacacgct caaacccgga actccctact acatcacatc 60
agctatatgg ggcgctggcg gtggcgggct cttccccctt agtcgcccaa gaatctgccc 120
tagatgtctg tggtgctgcc ccctaaatgt ggctcagaag tcgagcgacc tcgacaaagg 180
tctcccagtg tatttgtctc cctccaactc gagcgaagaa gtcgtgcatc tcctcaccga 240
cctcaaaatc gagttcacca ctcctccccc cgatggtggg tcgccaatat ggaagctcga 300
tagcgctgat tccaacggcc aacgatatgt gacactcaac ggaaatccat ttaacaccat 360
tgatgtgaaa aactggttca agattgacaa agccgatgta tttggataca aactgctata 420
ttgccccagt gtagccggca accttgccga tggtgcttgc ggcagtctgg gtatagagta 480
cgaggatggg aaaaggtggt tggttctgag cgacaacccg ttctgggttg tctttgtcaa 540
ggcataacct ctcatgggct catgaaataa gggcttttat gtctgagtgt ttgctatgtg 600
taccagtgtg tggagtccca tggaataaga gctttgtgcc tttgggttag ctgaaaaaaa 660
aaaaaaaaaa aaaaaaaaaa a 681
SEQ ID NO.2
agatgtctgt ggtgctg 17
SEQ ID NO.3
gatttccgtt gagtgtc 17
Claims (2)
1. the EST-PCR molecular marker of the anti-Fusarium bulbigenum droop related gene KTI of population in Lilium sargenttiae Wilson, described KTI gene core
Nucleotide sequence is as shown in SEQ ID NO.1, it is characterised in that the molecular labeling primer is selected from following primer pair：
Forward primer：5 '-agatgtctgtggtgctg-3 ',
Reverse primer：5’-gatttccgttgagtgtc-3’.
2. the EST-PCR molecular marker of the anti-Fusarium bulbigenum droop related gene KTI of population in Lilium sargenttiae Wilson described in claim 1 exists
Application in the identification of Fusarium bulbigenum fusarium wilt disease resistance.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610858125.7A CN106434920B (en) | 2016-09-28 | 2016-09-28 | The EST-PCR molecular labeling of the anti-Fusarium bulbigenum wilt disease related gene KTI of population in Lilium sargenttiae Wilson and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610858125.7A CN106434920B (en) | 2016-09-28 | 2016-09-28 | The EST-PCR molecular labeling of the anti-Fusarium bulbigenum wilt disease related gene KTI of population in Lilium sargenttiae Wilson and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106434920A true CN106434920A (en) | 2017-02-22 |
| CN106434920B CN106434920B (en) | 2019-06-07 |
Family
ID=58170682
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610858125.7A Active CN106434920B (en) | 2016-09-28 | 2016-09-28 | The EST-PCR molecular labeling of the anti-Fusarium bulbigenum wilt disease related gene KTI of population in Lilium sargenttiae Wilson and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106434920B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113564274A (en) * | 2021-08-03 | 2021-10-29 | 云南省农业科学院花卉研究所 | EST-STS molecular marker primer of Luding lily disease-resistant related gene CAT and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101796925A (en) * | 2010-04-02 | 2010-08-11 | 浙江省农业科学院 | In vitro conservation method of oriental hybrid lily germ plasm resource |
| CN102787115A (en) * | 2012-07-30 | 2012-11-21 | 浙江大学 | Lilium EST (Expressed Sequence Tag) - SSR (Simple Sequence Repeat) markers and application thereof |
| CN103421895A (en) * | 2013-07-30 | 2013-12-04 | 浙江大学 | Primer for detecting lilimu microsatellite markers |
| CN104263835A (en) * | 2014-10-09 | 2015-01-07 | 凯里学院 | Method for identifying varieties of lilium brownii by adopting SSR (simple sequence repeat) molecular marking technology |
-
2016
- 2016-09-28 CN CN201610858125.7A patent/CN106434920B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101796925A (en) * | 2010-04-02 | 2010-08-11 | 浙江省农业科学院 | In vitro conservation method of oriental hybrid lily germ plasm resource |
| CN102787115A (en) * | 2012-07-30 | 2012-11-21 | 浙江大学 | Lilium EST (Expressed Sequence Tag) - SSR (Simple Sequence Repeat) markers and application thereof |
| CN103421895A (en) * | 2013-07-30 | 2013-12-04 | 浙江大学 | Primer for detecting lilimu microsatellite markers |
| CN104263835A (en) * | 2014-10-09 | 2015-01-07 | 凯里学院 | Method for identifying varieties of lilium brownii by adopting SSR (simple sequence repeat) molecular marking technology |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113564274A (en) * | 2021-08-03 | 2021-10-29 | 云南省农业科学院花卉研究所 | EST-STS molecular marker primer of Luding lily disease-resistant related gene CAT and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106434920B (en) | 2019-06-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tanweer et al. | Current advance methods for the identification of blast resistance genes in rice | |
| Sudheesh et al. | SNP-based linkage mapping for validation of QTLs for resistance to ascochyta blight in lentil | |
| CN104073487B (en) | The molecule marker of rice blast resistant gene Pi2 and application thereof | |
| CN104877996B (en) | Haynaldia villosa 6VS chromosome-specific molecule marks 6VS-BH1 and application thereof | |
| CN104313021B (en) | Molecular marker of wheat powdery mildew disease-resistant genes Pm51 and application of molecular marker | |
| CN103146695A (en) | Functional molecular marker for rice anti-blast gene Pi9 and application thereof | |
| Padmarasu et al. | Fine-mapping of the apple scab resistance locus Rvi12 (Vb) derived from ‘Hansen’s baccata# 2’ | |
| Kameli et al. | Assessment of genetic diversity on populations of three satureja species in Iran using ISSR markers | |
| Liu et al. | A sequence-amplified characterized region marker for a single, dominant gene in melon PI 134198 that confers resistance to a unique race of Podosphaera xanthii in China | |
| Raghu et al. | Morphological and simple sequence repeats (SSR) based finger printing of south Indian cassava germplasm | |
| CN104894124A (en) | ISSR-SCAR (inter simple sequence repeat-sequence characterized amplified region) marker capable of identifying Wujiang brassica chinensis and identification method of marker | |
| Chandra et al. | Studies on genetic diversity among Alternaria blight Tolerant Indian mustard genotypes using SSR markers | |
| Berruezo et al. | Characterization of Fusarium species associated with tobacco diseases in Northwestern Argentina | |
| Cao et al. | Inheritance and molecular mapping of an alien stripe-rust resistance gene from a wheat-Psathyrostachys huashanica translocation line | |
| US10246754B1 (en) | Molecular markers linked to disease resistance in soybean | |
| CN106048071B (en) | Fungus Trichoderma Identification of Species primer and its application based on mitochondria NAD5 gene order | |
| CN108220402A (en) | A kind of identification method of Chinese cabbage germplasm and kind genealogical relationship | |
| Beharav et al. | Genetic relationships and structured diversity of Lactuca georgica germplasm from Armenia and the Russian Federation among other members of Lactuca L., subsection Lactuca L., assessed by TRAP markers | |
| CN106978504A (en) | A kind of preparation method and application of spinach SSR marker | |
| Jacoby et al. | Genetic relationships between Southern African Solanum retroflexum Dun. and other related species measured by morphological and DNA markers | |
| CN106434920A (en) | Lilium sargentiae Wilson anti-Lily-Fusarium-Wilt related gene KTI EST-PCR (expressed sequence tag-polymerase chain reaction) molecular marker and application thereof | |
| CN110551843B (en) | Codominant marking primer capable of distinguishing tobacco spot wilt-resistant locus RTSW homozygous heterozygous genotype, distinguishing method and application thereof | |
| Grisi et al. | Genetic variability of passion fruit multispecific hybrids and their respective wild parents determined by microsatellite markers | |
| Declercq et al. | Molecular characterization of Phytophthora porri and closely related species and their pathogenicity on leek (Allium porrum) | |
| Sufaati et al. | Fusarium as endophyte of some terrestrial orchid from Papua, Indonesia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |