CN106434734B - The method of recombinant vector and its Large-scale Screening interaction albumen for high-throughput yeast-two hybrid technique - Google Patents
The method of recombinant vector and its Large-scale Screening interaction albumen for high-throughput yeast-two hybrid technique Download PDFInfo
- Publication number
- CN106434734B CN106434734B CN201610436290.3A CN201610436290A CN106434734B CN 106434734 B CN106434734 B CN 106434734B CN 201610436290 A CN201610436290 A CN 201610436290A CN 106434734 B CN106434734 B CN 106434734B
- Authority
- CN
- China
- Prior art keywords
- phic31
- poliii
- cyc1
- pcr amplification
- primer pair
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/102—Plasmid DNA for yeast
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
A kind of method of yeast two-hybrid the invention discloses related recombinant vector for yeast two-hybrid and its using high throughput sequencing technologies Large-scale Screening interaction albumen, this method depends on a kind of peculiar integration function of integrase Integrase phiC31 (En), pass through the transformation to traditional yeast double cross carrier, it organically combines it with high throughput sequencing technologies, realizes hundreds of Bait albumen simultaneously to the screening operation of Prey protein library.It will be in integrase and its carrier of the nucleotide sequence of specific recognition insertion Matchmaker GAL4 system, recombinant vector is set to enter the same yeast cells by the method for yeast two-hybrid, integrase is had an effect, the nucleotide sequence of its specific recognition and its adjacent nucleotide sequence are subjected to specific directional realignment, so that two recombinant vectors are fused into a fusion vector, prey and bait protein sequence are directed the one section of new sequence connected on fusion vector at this time, pass through amplification, high-flux sequence, it screens interacting protein to economical and efficient and constructs comprehensive interactions between protein network map.
Description
Technical field
The present invention relates to a kind of yeast two-hybrid screening methods, in particular to a kind of relevant carriers for yeast two-hybrid
And its method of the yeast two-hybrid using high throughput sequencing technologies Large-scale Screening interaction albumen.
Background technique
Main method and means of the yeast-two hybrid technique as current research large-scale protein matter interaction, have obtained
To developing on a large scale very much and be more and more widely used.
Most common technological means of the yeast two-hybrid system as research Protein-protein interaction, is by Fields earliest
The A established in research eukaryotic transcription regulation with Song, principle is: bait protein (bait) and BD (DNA Binding
Domain), prey protein (pery) and AD (DNA Activation Domain) are respectively formed fusion protein, then pass through ferment
Mother's hybridization, which makes two kinds of fusion proteins enter same yeast cells, can make BD if there are interactions for bait albumen and pery albumen
It is spatially close to each other with AD, make transcription factor and meanwhile have identification reporter gene on distinguished sequence and act on transcription
The function of the other compositions of complex activates the expression of downstream reporter gene, that is, shows to form active transcription factor
The yeast cells of heterozygosis can grow and develop the color on auxotrophic culture medium out, be existed in turn by heterozygosis yeast cells
The plated growth situation and chromogenic reaction of auxotrophy judge bait albumen and the pery albumen with the presence or absence of interaction.
Yeast-two hybrid technique is because having many advantages, such as research that is efficient, sensitive, therefore being widely used in protein science, but its
Also have the shortcomings that false positive is high, complicated for operation, especially seem in terms of extensive interaction network research small scale, and flux is low.Though
Right existing yeast-two hybrid technique also develops to extensive, automation, high-throughput direction, establish Automation workstation and
A series of hybridization instruments, and in order to improve whole flow process the degree of automation, some protein phases from high-throughput experiment
Interaction database has also emerged in large numbers.However, coming into being with high throughput sequencing technologies in recent years, a variety of species gene groups
It is sequenced successfully, extensive, high-throughput research method also seems increasingly important in genome and proteome research, at this time ferment
Female two-hybrid method just seems small scale that flux is low in terms of large-scale protein interaction network research.Because technology can only answer thus
Interaction Prey albumen (Y) is screened for single Bait albumen (X), the positive colony screened needs to carry out sequencing mirror one by one
It is fixed, it will to there is hundreds of clone to select, PCR and purifying and examining order.It is complicated for operation, heavy workload and time-consuming.When
When carrying out the interaction protein screening of a Bait albumen multiple or even up to a hundred, bait Bait albumen one by one respectively and can only be hunted
Object Prey protein library is individually screened, and cannot all bait Bait albumen and prey Prey protein library be carried out while be sieved
Choosing, the waste of caused human resources etc., general laboratory is unbearable, so that informative egg can not be established quickly
White interaction network.
Summary of the invention
It is measured the object of the present invention is to provide a kind of related recombinant vector for yeast two-hybrid and its using high pass
The method of the yeast two-hybrid of sequence technology Large-scale Screening interaction albumen.This method depends on a kind of integrase Integrase
PhiC31 (En) distinctive integration function.The integrase can recognize specific nucleotide sequence ATTP and ATTB, and by special core
Nucleotide sequence and its adjacent nucleotide sequence carry out specific directional realignment and connect into one section of new sequence.By integrase and
The nucleotide sequence ATTP and ATTB of specific recognition are inserted into the carrier pGADT7 and pGBKT7 of Matchmaker GAL4 system respectively
(Clontech) it in, and merges, is imported by the method for yeast two-hybrid same with prey protein and bait protein sequence respectively
A yeast cells, while screening interaction albumen, integrase is had an effect, by ATTP and ATTB and its prey being connected and bait
Protein nucleotide sequence, which is directed, connects into one section of new sequence, carries so that two recombinant vectors are fused into a fusion
Body, prey and bait protein sequence are directed the one section of new sequence (Fig. 1) connected on fusion vector at this time, then realize
Hundreds of Bait albumen is simultaneously to the screening operation of Prey protein library.And we are importing Prey albumen and Bait egg
While white gene order, introducing a Mme I restriction enzyme site at prey and bait gene C end, (MmeI is a kind of
More special restriction enzyme, its main feature is that digestion its upstream 19-21 nucleotide sequence), connection is produced by MmeI
After the restricted digestion of object, the interaction albumen pair that size is identical but sequence is entirely different is obtained, then digestion products connect high pass
Measure sequence primer, all interaction albumen is disposably obtained using high-flux sequence, thus complete yeast-two hybrid technique with
The combination of high throughput sequencing technologies, economical and efficient construct comprehensive interactions between protein network map, grind for each ambit
The functional mechanism for studying carefully albumen provides strong technical guarantee.The method overcome existing yeast two-hybrid method small scale,
Flux is low, can not carry out the shortcomings that screening in library and extensive interaction network are studied in library.
To achieve the above object, a kind of recombinant vector pGADT7-ATTP- for yeast two-hybrid provided by the invention
PhiC31, the recombinant vector pGADT7-ATTP-phiC31 are the insertion solexa PE1-MCS-ATTP on carrier pGADT7
Nucleotide sequence and PolIII::phic31-Cyc1 expression cassette, the solexa PE1-MCS-ATTP nucleotide sequence replacement
I restriction enzyme site of sequence and its Xho between Nde I and Xho I, the PolIII::phiC31-Cyc1 expression cassette are inserted in Nhe I
On, wherein solexa PE1-MCS-ATTP nucleotide sequence is as shown in SEQ ID NO:1, PolIII::phiC31-Cyc1 table
Up to box as shown in SEQ ID NO:2.
The present invention provides the construction method of the above-mentioned recombinant vector pGADT7-ATTP-phiC31 for yeast two-hybrid,
The following steps are included:
1) solexa PE1-MCS-ATTP nucleotide sequence is synthesized, is with solexa PE1-MCS-ATTP nucleotides sequence column
Stencil design has the overall length primer pair of homology arm, and primer pair is as follows:
Sol-Fo:gacgtaccagattacgctcatatgagaatgatacggcgaccaccg,
ATTP-Re:ctacgattcatctgcagctcgacagtgccccaactggggtaac；
PCR amplification, recovery purifying obtain the solexa PE1-MCS-ATTP nucleotide sequence such as SEQ ID containing homology arm
Shown in NO:1；
2) carrier PGADT7 is subjected to digestion processing with Nde I and Xho I, digestion system is as follows:
37 DEG C of 6~8h of digestion, the carrier PGADT7 that purification and recovery is linearized；
3) by the carrier PGADT7 of linearisation and the above-mentioned solexa PE1-MCS-ATTP nucleotide sequence containing homology arm
Homologous recombination, screening positive clone are carried out, and is named as PGADT7-ATTP；
4) with saccharomyces cerevisiae YSR127gDNA template design primer pair, primer pair is as follows:
NheI-PolIII-Fo:gggctagctgccaattgaacataacatg,
PolIII-phiC31-Re:ctgggagctgcgattggcaatgacacaaggggttgtgac；
PCR amplification, recovery purifying obtain PolIII promoter；
5) using phiC31ORF as stencil design overall length primer pair, primer pair is as follows:
PhiC31-PolIII-Fo:ctgggagctgcgattggcaatgacacaaggggttgtgac,
PhiC31-cyc1-Re:attggaagttggatatggggttatacgtcttccgtgccgtc；
PCR amplification, recovery purifying obtain phiC31ORF；
6) with saccharomyces cerevisiae YSR127gDNA template design primer pair, primer pair is as follows:
Cyc1-phiC31-Fo:gacggcacggaagacgtataaccccatatccaacttccaat,
NheI-cyc1-Re:gggctagcgactgtgtcaatgacttcac；
PCR amplification, recovery purifying obtain PolIII terminator；
7) using above-mentioned steps 4), 5) and 6) obtain PolIII promoter, phiC31ORF and Cyc1 terminator as template,
Using NheI-PolIII-Fo and NheI-cyc1-Re as primer overlap PCR amplification expression cassette PolIII::phiC31-Cyc1
Expression cassette is as shown in SEQ ID NO:2.
PCR amplification, recovery purifying obtain PolIII::phiC31-Cyc1 expression cassette as shown in SEQ ID NO:2；
8) carrier PGADT7-ATTP after transformation and above-mentioned PCR product PolIII::phiC31-Cyc1 expression cassette are used respectively
NheI digestion processing, is attached, screening positive clone, obtains last recombinant vector PGADT7-ATTP-phiC31, referred to as
pmGADT7。
In above-mentioned preferred embodiment, in the step 1), PCR amplification system:
PCR instrument program: [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 30s] × 30 → 72 DEG C of 5m → 16 DEG C 1s.
In the step 4), PCR amplification system:
PCR instrument program: 95 DEG C of 3m → [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 30s] × 30 → 72 DEG C of 5m → 16 DEG C 1s.
In the step 5), PCR amplification system:
PCR instrument program: 95 DEG C of 3m → [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 2m] × 30 → 72 DEG C of 5m → 16 DEG C 1s.
In above-mentioned preferred embodiment, in the step 6), PCR amplification system:
PCR instrument program: 95 DEG C of 3m → [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 30s] × 30 → 72 DEG C of 5m → 16 DEG C 1s.
In the step 7), PCR amplification system:
PCR instrument program: 95 DEG C of 3m → [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 2m30s] × 30 → 72 DEG C of 5m → 16 DEG C 1s.
The present invention also provides a kind of recombinant vector pGBKT7-ATTB-phiC31 for yeast two-hybrid, the recombinations
Carrier pGBKT7-ATTB-phiC31 be on carrier pGBKT7 be inserted into solexa PE2-MCS-ATTB nucleotide sequence and
PolIII::phiC31-Cyc1 expression cassette, the solexa PE2-MCS-ATTB nucleotide sequence are replaced between Nde I and Xho I
I restriction enzyme site of sequence and its Xho, the PolIII::phiC31-Cyc1 expression cassette is inserted on Avr II, wherein described
Solexa PE2-MCS-ATTB nucleotide sequence is as shown in SEQ ID NO:3, the PolIII::phiC31-Cyc1 expression cassette
As shown in SEQ ID NO:2.
The present invention provides the construction method of the above-mentioned recombinant vector pGBKT7-ATTB-phiC31 for yeast two-hybrid,
The following steps are included:
1) solexa PE2-MCS-ATTB nucleotide sequence is synthesized, is with solexa PE2-MCS-ATTB nucleotides sequence column
Stencil design has the overall length primer pair of homology arm, and primer pair is as follows:
BD-Sol-Fo:gatctcagaggaggacctgcatatgacaagcagaagacggcatacg,
BD-ATTB-Re:ctagttatgcggccgctgcagggagtacgcgcccggggagc；
PCR amplification, recovery purifying obtain the solexa PE2-MCS-ATTB nucleotide sequence containing homology arm；
2) carrier PGBKT7 is subjected to digestion processing with Nde I and Xho I, digestion system is as follows:
37 DEG C of 6~8h of digestion, the carrier PGBKT7 that purification and recovery is linearized；
3) by the carrier PGBKT7 of linearisation and the above-mentioned solexa PE2-MCS-ATTB nucleotide sequence containing homology arm
Homologous recombination, screening positive clone are carried out, and is named as PGBKT7-ATTB；
4) with saccharomyces cerevisiae YSR127gDNA template design primer pair, primer pair is as follows:
II-PolIII-Fo:ggcctagg tgccaattgaacataacatg of Avr,
PolIII-phiC31-Re:ctgggagctgcgattggcaatgacacaaggggttgtgac；
PCR amplification, recovery purifying obtain PolIII promoter；
5) using phiC31ORF as stencil design overall length primer pair, primer pair is as follows:
PhiC31-PolIII-Fo:ctgggagctgcgattggcaatgacacaaggggttgtgac,
PhiC31-cyc1-Re:attggaagttggatatggggttatacgtcttccgtgccgtc；
PCR amplification, recovery purifying obtain phiC31ORF；
6) with saccharomyces cerevisiae YSR127gDNA template design primer pair, primer pair is as follows:
Cyc1-phiC31-Fo:gacggcacggaagacgtataaccccatatccaacttccaat,
II-cyc1-Re:ggcctagggactgtgtcaatgacttcac of Avr；
PCR amplification, recovery purifying obtain PolIII terminator；
7) using above-mentioned steps 4)~6) obtained in PolIII promoter, phiC31ORF and PolIII terminator as template,
Using II-cyc1-Re of Avr II-PolIII-Fo and Avr as primer overlap PCR amplification, recovery purifying obtains PolIII::
PhiC31-Cyc1 expression cassette；
8) carrier PGBKT7-ATTB after transformation and above-mentioned PCR product PolIII:phiC31-Cyc1 expression cassette are used respectively
II digestion of Avr processing, is attached, screening positive clone, obtains last recombinant vector PGBKT7-ATTB-phiC31, referred to as
pmGBKT7。
In the above-mentioned technical solutions, in the step 1), PCR amplification system:
PCR instrument program: [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 30s] × 30 → 72 DEG C of 5m → 16 DEG C 1s.
In the step 4), PCR amplification system:
PCR instrument program: 95 DEG C of 3m → [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 30s] × 30 → 72 DEG C of 5m → 16 DEG C 1s.
In the step 5), PCR amplification system:
PCR instrument program: 95 DEG C of 3m → [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 2m] × 30 → 72 DEG C of 5m → 16 DEG C 1s.
In the step 6), PCR amplification system:
PCR instrument program: 95 DEG C of 3m → [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 30s] × 30 → 72 DEG C of 5m → 16 DEG C 1s.
In the step 7), PCR amplification system:
PCR instrument program: 95 DEG C of 3m → [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 2m30s] × 30 → 72 DEG C of 5m → 16 DEG C 1s.
The present invention also provides a kind of yeast two-hybrids using high throughput sequencing technologies Large-scale Screening interaction albumen
Method, comprising the following steps:
1) building for the recombinant vector pGADT7-ATTP-phiC31 of yeast two-hybrid,
2) building for the recombinant vector pGBKT7-ATTB-phiC31 of yeast two-hybrid,
3) library " bait " Bait of building research GAP-associated protein GAP；
A. the primer containing I restriction enzyme site of homology arm and Mme is designed, amplification obtains the Bait albumen nucleosides containing homology arm
Acid sequence；Wherein, primer homology arm sequence is as follows:
Upstream homology arm sequence: gaagctgatctcagaggaggacctg,
Downstream homology arm sequence: ggcacgccctggcacccgcacgctatccaac；
MmeⅠ
B. BamH I and Nde I linearization for enzyme restriction recombinant vector pmGBKT7 are used, by the recombinant vector pmGBKT7 of linearisation
Enter in yeast cells Y2H gold with the Bait protein nucleotide sequence corotation containing homology arm；
4) " prey " pery protein library with the studies above GAP-associated protein GAP interaction is constructed
A. the primer containing I restriction enzyme site of homology arm and Mme is designed, the nucleotide sequence containing pery albumen is expanded,
In, primer homology arm sequence is as follows:
Upstream homology arm sequence: cccatacgacgtaccagattacgct；
Downstream homology arm sequence: gagttctctcagttgggggcgttgactccaac；
MmeⅠ
B. and then respectively enter yeast cells with recombinant vector pmGADT7 corotation after linearisation (BamH I and Nde I) transformation
Y187gold；
5) Library hybridization
Step 3) and the library of " bait " protein library and " prey " albumen that 4) obtain are hybridized, interaction egg is obtained
White clone；
6) building of high-throughput sequencing library:
A. yeast plasmid extracts and obtains the sequence integrated and orient connection after enzyme effect
Interaction albumen clone after hybridizing is collected, yeast plasmid is extracted, is melted with new after connection in yeast plasmid
Conjugative plasmid is template design primer pair, and low circulation expands, and the interaction protein nucleotide sequence that recovery purifying is connected contains
The nucleotide sequence of I-ATTL-Mme of pery-Mme, I-bait segment, wherein in I-ATTL-Mme of pery-Mme, I-bait segment,
I-ATTL-Mme of Mme, I nucleotide sequence, as shown in SEQ ID NO:4；
B. the interaction protein nucleotide sequence connected carries out I digestion of Mme processing, then selects 3% high concentration eutectic dispensing
Recycling；Obtain recovery product after Mme I digestion；
C. digestion products and high-flux sequence primer are attached sequencing；
7) high-flux sequence and data analysis
To high-throughput sequencing library through row high-flux sequence, result is subjected to Data Analysis Services, constructs interactions between protein net
Network map.
The principle of the present invention
The present invention is based on phiC31/att to integrate enzyme system and high throughput sequencing technologies, which can recognize special core
Nucleotide sequence ATTP and ATTB, and specific nucleotide sequence and its adjacent nucleotide sequence are subjected to specific directional realignment simultaneously
Connect into one section of new sequence.The nucleotide sequence ATTP and ATTB of integrase and specific recognition are inserted into Matchmaker respectively
In the carrier pGADT7 and pGBKT7 (Clontech) of GAL4 system, and merged respectively with prey protein and bait protein sequence,
The same yeast cells is imported by the method for yeast two-hybrid, while screening interaction albumen, integrase is had an effect, will
ATTP is directed with ATTB and its prey being connected and bait protein sequence and connects into one section of new sequence, so that two weights
Group carrier is fused into a fusion vector, and prey and bait protein sequence are directed the Duan Xin connected on fusion vector at this time
Sequence, then realize hundreds of Bait albumen simultaneously to the screening operation of Prey protein library.And we are leading
While entering the gene order of Prey albumen and Bait albumen, a Mme I restriction enzyme is introduced at prey and bait gene C end
Enzyme site (MmeI is a kind of more special restriction enzyme, its main feature is that digestion its upstream 19-21 nucleotide sequence),
After MmeI is to the restricted digestion of connection product, the interaction albumen pair that size is identical but sequence is entirely different is obtained, then
Digestion products connect the primer of high-flux sequence, and all interaction albumen, economical and efficient are disposably obtained by high-flux sequence
Construct comprehensive interactions between protein network.
The beneficial effects of the present invention are:
Manpower is greatly saved relative to yeast two-hybrid automatic work station in high-throughput yeast-two hybrid technique of the invention
Resource and production cost, the present invention will break through that the double acrobatics art small scale of yeast, flux be low, cost using the advantage of high-flux sequence
It is high and cannot achieve hundreds of Bait albumen while screening the weakness of cDNA library, play yeast-two hybrid technique
Unprecedented advantage is effectively combined with high throughput sequencing technologies, provides strong technological means for the researchers in each field, warp
It helps and rapidly draws specific period and specified conditions
Under large-scale protein interaction network map, open the new chapter of life science.Detailed description of the invention
Fig. 1 is high-throughput yeast-two hybrid technique schematic illustration of the invention；
Fig. 2 is recombinant vector pmGADT7 map schematic diagram；
Fig. 3 is recombinant vector pmGBKT7 map schematic diagram；
Fig. 4, which is that the positive is mutual, to oppose with the positive mutual work of the present invention to results of hybridization figure；
Fig. 5 is that PCR detects integrase joint efficiency figure；
Fig. 6 is fusion vector sequencer map after integrase connection；
Fig. 7 is that positive mutually oppose verifies the feasibility result figure of saccharomyces neoformans two-hybrid system；
In figure, Fig. 7 A is PCR amplification junction fragment, and Fig. 7 B is that I digestion of Mme connects post-fragment figure；
Fig. 8 is all secreted proteins, outer membrane protein and lipoprotein title figure；
Fig. 9 is the Bait Yeast libraries self-excitation of mycobacterium tuberculosis (H37Rv) secreted protein, outer membrane protein and lipoprotein
Biopsy mapping；
Figure 10 is innate immunity related pathways prey protein title figure；
Figure 11 is the relevant prey Yeast libraries self-activation detection figure of innate immunity access；
Figure 12 is library to Library hybridization result figure (SD/-AHLT)；
Figure 13 is that high-throughput sequencing library of the present invention constructs schematic illustration；
Figure 14 is high-throughput sequencing library structure figures of the present invention；
In figure, Figure 14 A is that PCR amplification interaction albumen connects I-ATTL-Mme of post-fragment pery-Mme, I-bait；Figure 14 B is
MmeI digestion handles the segment after the connection of interaction albumen；Figure 14 C is amplification high-throughput sequencing library figure；
Figure 15 is high-throughput data analysis flowcharts；
Figure 16 is mycobacterium tuberculosis and host's innate immunity GAP-associated protein GAP interaction network map；
Figure 17 is mycobacterium tuberculosis and host's innate immunity GAP-associated protein GAP interaction result verification figure.
Specific embodiment
In order to better explain the present invention, below in conjunction with the specific embodiment main contents that the present invention is furture elucidated, but
The contents of the present invention are not limited solely to following embodiment.
One, the building for the recombinant vector pGADT7-ATTP-phiC31 of yeast two-hybrid
1) solexa PE1-MCS-ATTP nucleotide sequence is synthesized, SEQ ID NO:1 is seen, with solexa PE1-MCS-
ATTP nucleotides sequence is classified as the overall length primer pair that stencil design has homology arm, and primer pair is as follows:
Sol-Fo:gacgtaccagattacgctcatatgagaatgatacggcgaccaccg,
ATTP-Re:ctacgattcatctgcagctcgacagtgccccaactggggtaac
PCR amplification system:
PCR instrument program: [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 30s] × 30 → 72 DEG C of 5m → 16 DEG C 1s；
PCR amplification, OMEGA company E.Z.N.A.TMCycle-Pure Kit carries out recovery purifying and obtains containing homology arm
Solexa PE1-MCS-ATTP nucleotide sequence is as shown in SEQ ID NO:1；
2) carrier PGADT7 is subjected to digestion processing with the Nde I of takara company and Xho I, digestion system is as follows:
37 DEG C of digestion 6~8h, BioFlu kits carry out the carrier PGADT7 that glue recovery purifying is linearized；
3) by the carrier PGADT7 of linearisation and the above-mentioned solexa PE1-MCS-ATTP nucleotide sequence containing homology arm
Homologous recombination is carried out with Wei Nuozan company ClonExpress Entry One Step Cloning Kit (C114-01/02), is sieved
Positive colony is selected, and is named as PGADT7-ATTP；
4) saccharomyces cerevisiae YSR127gDNA template design primer pair is bought with market, primer pair is as follows:
NheI-PolIII-Fo:gggctagctgccaattgaacataacatg,
PolIII-phiC31-Re:ctgggagctgcgattggcaatgacacaaggggttgtgac；
PCR amplification system:
PCR instrument program: 95 DEG C of 3m → [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 30s] × 30 → 72 DEG C of 5m → 16 DEG C 1s；
PCR amplification, BioFlu kit carry out glue recovery purifying and obtain PolIII promoter；Sequence table 3
5) phiC31ORF presented from South China Botanical Garden Qu Yongxiang (David W.Ow) professor laboratory, with phiC31ORF
For stencil design overall length primer pair, primer pair is as follows:
PhiC31-PolIII-Fo:ctgggagctgcgattggcaatgacacaaggggttgtgac,
PhiC31-cyc1-Re:attggaagttggatatggggttatacgtcttccgtgccgtc；
PCR amplification system:
PCR instrument program: 95 DEG C of 3m → [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 2m] × 30 → 72 DEG C of 5m → 16 DEG C 1s；
PCR amplification, BioFlu kit carry out glue recovery purifying and obtain phiC31ORF；
6) with saccharomyces cerevisiae YSR127gDNA template design primer pair, primer pair is as follows:
Cyc1-phiC31-Fo:gacggcacggaagacgtataaccccatatccaacttccaat,
NheI-cyc1-Re:gggctagcgactgtgtcaatgacttcac；
PCR amplification system:
PCR instrument program: 95 DEG C of 3m → [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 30s] × 30 → 72 DEG C of 5m → 16 DEG C 1s；
PCR amplification, BioFlu kit carry out glue recovery purifying and obtain PolIII terminator；
7) using above-mentioned steps 4), 5) and 6) obtain PolIII promoter, phiC31ORF and Cyc1 terminator as template,
Using NheI-PolIII-Fo and NheI-cyc1-Re as primer overlap PCR amplification expression cassette PolIII::phiC31-Cyc1
Expression cassette is as shown in SEQ ID NO:2.
PCR amplification system:
PCR instrument program: 95 DEG C of 3m → [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 2m30s] × 32 → 72 DEG C of 5m → 16 DEG C
1s.PCR amplification, BioFlu kit carry out glue recovery purifying and obtain PolIII::phiC31-Cyc1 expression cassette such as SEQ ID
Shown in NO:2；
8) carrier PGADT7-ATTP after transformation and above-mentioned PCR product PolIII:phiC31-Cyc1 expression cassette are used respectively
Takara company NheI digestion processing,
37 DEG C of digestion 3-4h, BioFlu kits carry out the carrier PGADT7-ATTP that glue recovery purifyings are linearized with
And the expression cassette PolIII:phiC31-Cyc1 with I restriction enzyme site cohesive end of Nhe；
9) segment that step obtains on is attached with takara T4 ligase
Linked system:
16 DEG C of connection 6-10h, are transformed into stable3 competence, screening positive clone obtains last recombinant vector
PGADT7-ATTP-phiC31, abbreviation pmGADT7.
Two, the building for the recombinant vector pGBKT7-ATTB-phiC31 of yeast two-hybrid
1) solexa PE2-MCS-ATTB nucleotide sequence is synthesized, SEQ ID NO:2 is seen, with solexa PE2-MCS-
ATTB nucleotides sequence is classified as the overall length primer pair that stencil design has homology arm, and primer pair is as follows:
BD-Sol-Fo:gatctcagaggaggacctgcatatgacaagcagaagacggcatacg,
BD-ATTB-Re:ctagttatgcggccgctgcagggagtacgcgcccggggagc
PCR amplification system:
PCR instrument program: [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 30s] × 30 → 72 DEG C of 5m → 16 DEG C 1s；
PCR amplification, OMEGA company E.Z.N.A.TMCycle-Pure Kit carries out recovery purifying and obtains containing homology arm
Solexa PE1-MCS-ATTP nucleotide sequence is as shown in SEQ ID NO:1；
2) carrier PGBKT7 is subjected to digestion processing with the Nde I of takara company and Xho I, digestion system is as follows:
37 DEG C of digestion 6~8h, BioFlu kits carry out the carrier PGADT7 that glue recovery purifying is linearized；
3) by the carrier PGBKT7 of linearisation and the above-mentioned solexa PE1-MCS-ATTP nucleotide sequence containing homology arm
Homologous recombination is carried out with Wei Nuozan company ClonExpress Entry One Step Cloning Kit (C114-01/02), is sieved
Positive colony is selected, and is named as PGBKT7-ATTB；
4) saccharomyces cerevisiae YSR127gDNA template design primer pair is bought with market, primer pair is as follows:
AvrⅡ-PolIII-Fo:ggcctagg tgccaattgaacataacatg
PolIII-phiC31-Re:ctgggagctgcgattggcaatgacacaaggggttgtgac；
PCR amplification system:
PCR instrument program: 95 DEG C of 3m → [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 30s] × 30 → 72 DEG C of 5m → 16 DEG C 1s；
PCR amplification, BioFlu kit carry out glue recovery purifying and obtain PolIII promoter；
5) phiC31ORF presented from South China Botanical Garden Qu Yongxiang (David W.Ow) professor laboratory, with phiC31ORF
For stencil design overall length primer pair, primer pair is as follows:
PhiC31-PolIII-Fo:ctgggagctgcgattggcaatgacacaaggggttgtgac,
PhiC31-cyc1-Re:attggaagttggatatggggttatacgtcttccgtgccgtc；
PCR amplification system:
PCR instrument program: 95 DEG C of 3m → [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 2m] × 30 → 72 DEG C of 5m → 16 DEG C 1s；
PCR amplification, BioFlu kit carry out glue recovery purifying and obtain phiC31ORF；
6) with saccharomyces cerevisiae YSR127gDNA template design primer pair, primer pair is as follows:
Cyc1-phiC31-Fo:gacggcacggaagacgtataaccccatatccaacttccaat,
AvrⅡ-cyc1-Re:ggcctagggactgtgtcaatgacttcac；
PCR amplification system:
PCR instrument program: 95 DEG C of 3m → [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 30s] × 30 → 72 DEG C of 5m → 16 DEG C 1s；
PCR amplification, BioFlu kit carry out glue recovery purifying and obtain PolIII terminator；
7) using above-mentioned steps 4), 5) and 6) obtain PolIII promoter, phiC31ORF and Cyc1 terminator as template,
Using II-cyc1-Re of Avr II-PolIII-Fo and Avr as primer overlap PCR amplification expression cassette PolIII::phiC31-
Cyc1 expression cassette is as shown in SEQ ID NO:2.
PCR amplification system:
PCR instrument program: 95 DEG C of 3m → [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 2m30s] × 32 → 72 DEG C of 5m → 16 DEG C
1s.PCR amplification, BioFlu kit carry out glue recovery purifying and obtain PolIII::phiC31-Cyc1 expression cassette such as SEQ ID
Shown in NO:2；
8) carrier PGBKT7-ATTB after transformation and above-mentioned PCR product PolIII:phic31-Cyc1 expression cassette are used respectively
Takara company NheI digestion processing,
37 DEG C of digestion 3-4h, BioFlu kits carry out the carrier PGBKT7-ATTB that glue recovery purifyings are linearized with
And the expression cassette PolIII:phiC31-Cyc1 with II restriction enzyme site cohesive end of Avr；
9) segment that step obtains on is attached with takara T4 ligase
Linked system:
16 DEG C of connection 6-10h, are transformed into stable3 competence, screening positive clone obtains last recombinant vector
PGBKT7-ATTB-phiC31 (abbreviation pmGBKT7).
The building of the three, positive interaction control group PGADT7-ATTP-phiC31-T and PGBKT7-ATTB-phiC31-P53 with
And the feasibility of verifying this system
The building of 1.PmGADT7-T
1) carrier pmGADT7 is subjected to digestion processing with BamH I and the Nde I of takara company, linearizes while cuts away
Solexa PE1 2 sequence above carrier pmGADT7, digestion system are as follows:
37 DEG C of digestion 6~8h, BioFlu kits carry out the carrier PmGADT7 that glue recovery purifying is linearized；
2) protein control SV40large T is mutually from the positive in the Matchmaker GAL4 system of Clontect company
Carrier PGADT7-T is contained the pair of primers of homology arm using PGADT7-T as stencil design, contained in middle and lower reaches homology arm sequence
There is a digestion point Mme I, primer sequence is as follows:
I-T-Fo:cccatacgacgtaccagattacgctggaactgatgaatgggagcag of mAD-Mme,
I-T-Re:agttctctcagttgggggcgttgactccaactgtttcaggttcagggggag of mAD-Mme；
PCR amplification system:
PCR instrument program: 95 DEG C of 3m → [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 1m30s] × 30 → 72 DEG C of 5m → 16 DEG C 1s,
PCR amplification, BioFlu kit carry out glue recovery purifying and obtain the T ORF with I restriction enzyme site of homology arm and Mme
3) the carrier PmGADT7 linearized and the T ORF cotransformation of upper step amplification enter yeast cells Y187gold, make
It carries out homologous recombination in yeast cells.Select pmGADT7-T positive colony.
The building of 2.pmGBKT7-P53
1) carrier pmGBKT7 is subjected to digestion processing with BamH I and the Nde I of takara company, linearizes while cuts away
Solexa PE2 sequence above carrier pmGBKT7, digestion system are as follows:
37 DEG C of digestion 6~8h, BioFlu kits carry out the carrier pmGBKT7 that glue recovery purifying is linearized；
2) protein control P53 carrier is mutually done from the positive in the Matchmaker GAL4 system of Clontect company
PGBKT7-p53 is contained the pair of primers of homology arm using PGBKT7-p53 as stencil design, contained in middle and lower reaches homology arm sequence
There is a digestion point Mme I, primer sequence is as follows:
MBD-Mme1-P53-Fo:gaagctgatctcagaggaggacctgcctgtcaccgagacc cctgg；
MBD-Mme1-P53-Re:gcacgccctggcacccgcacgctatccaacgggatgcaga ggcagtcag；
PCR amplification system:
PCR instrument program: 95 DEG C of 3m → [95 DEG C of 20s → 56 DEG C 25s → 72 DEG C 1m] × 32 → 72 DEG C of 5m → 16 DEG C 1s,
PCR amplification, BioFlu kit carry out glue recovery purifying and obtain with homology arm and Mme I restriction enzyme site
p53ORF
3) the carrier PmGBKT7 linearized and the p53ORF cotransformation of upper step amplification enter yeast cells Y2H gold,
It is set to carry out homologous recombination in yeast cells.Select PmGBKT7-P53 positive colony.
3. verifying the feasibility of saccharomyces neoformans two-hybrid system using positive mutually oppose
1) experimental group PmGADT7-T, PmGBKT7-P53 and positive controls PGADT7-T, PGBKT7-P53 are done miscellaneous together
It hands over (30 DEG C of 50rpm/min are for 24 hours), is coated on SD/-LT, SD/-AHLT, experimental group is identical with control group upgrowth situation, and
Interaction situation is identical (Fig. 4).Insertion element in novel system does not influence protein expression and interaction
2) 8 interaction albumen clones are selected at random on SD/-AHLT, yeast plasmid are extracted, using it as template design primer
Right, PCR amplification T-ORF, P53-ORF and the T ORF-ATTL-P53ORF by phiC31 integration to connect draw
Object is to sequence:
AD/BD-Fo:taatacgactcactatagggc, AD-Re:cctctggcgaagaagtcc,
BD-Re:tcaagacccgtttagaggc；
AD-For1:catacgacgtaccagattacg, BD-For1:catcatggaggagcagaagct；
Joint efficiency can reach absolutely (Fig. 5) as the result is shown, send connection PCR product to sequencing, shows T ORF-
ATTL-P53ORF illustrates that integrase phiC31 in this system energy normal expression, and plays integration normally without mutation (Fig. 6).
3) yeast cells for collecting positive interaction, extracts yeast plasmid, PCR amplification connection product T ORF-ATTL-
P53ORF, then carries out MmeI digestion, and discovery MmeI digestion effect preferably (Fig. 7), can be used for connecting high-flux sequence primer, obtain
Expected result is arrived, it was demonstrated that the system is mutually opposed available in the positive.
The building of four, building mycobacterium tuberculosis (H37Rv) secretory protein, outer membrane protein and lipoprotein " bait " library
1) with the Mycobacterium tuberculosis H37Rv strain of Xiao Shaobo seminar, agromicrobiology National Key Laboratory present
Eukaryon expression plasmid (334 albumen ORF) is the primer pair that stencil design has homology arm, is contained in middle and lower reaches homology arm sequence
One digestion point Mme I, nucleotide sequence are less than 1200bp, expand the nucleotide sequence of above-mentioned albumen ORF, nucleotide sequence is big
In 1200bp, protein truncation is carried out, the nucleotide sequence finally expanded is made to be less than 1000bp.Homology arm sequence is as follows:
Upstream homology arm: gaagctgatctcagaggaggacctg；
Downstream homology arm: ggcacgccctggcacccgcacgctatccaac；
All secreted proteins, outer membrane protein and lipoprotein title are as shown in Figure 8；
2) carrier pmGBKT7 is subjected to digestion processing with BamH I and the Nde I of takara company, linearizes while cuts away
Solexa PE2 sequence above carrier pmGBKT7,37 DEG C of digestion 6~8h, BioFlu kits carry out glue recovery purifyings and obtain
To the carrier pmGBKT7 of linearisation；
3) PCR product in step 1) is then entered into yeast cells Y2H gold with linearized vector pmGBKT7 corotation respectively,
Carry out homologous recombination in yeast.Random selected clone verifying, homologous recombination positive rate can reach 100%.
4) the Bait Yeast libraries of above-mentioned mycobacterium tuberculosis (H37Rv) secreted protein, outer membrane protein and lipoprotein by
One is hybridized with positive control albumen pmGADT7-T, (30 DEG C, 50rpm/min) for 24 hours is hybridized in 2*YPAD culture medium, then
It is applied to SD/-Trp/Leu, SD/-Trp/His/Ade/leu plate respectively, 30 DEG C of inversions cultivate 5d-7d, observe the growth of bacterium colony
Situation is as shown in Figure 9.Growth, which represents, has self-excitation activity, will have from active albumen and reject in following screening process
(tick in Fig. 8 is that self-excitation is activity or viscous protein is active).
The building of relevant " prey " Yeast libraries of five, innate immunity accesses
1) carrier pmGADT7 is subjected to digestion processing with BamH I and the Nde I of takara company, linearizes while cuts away
Solexa PE1 sequence above carrier pmGADT7,37 DEG C of digestion 6~8h, BioFlu kits carry out glue recovery purifyings and obtain
To the carrier pmGADT7 of linearisation；
2) using mouse cDNA as template, primer pair of the design with homology arm and Mme I, 387 innate immunity letters of PCR amplification
The genetic fragment of number pathway protein,
Upstream homology arm: cccatacgacgtaccagattacgct；
Downstream homology arm: gagttctctcagttgggggcgttgactccaac；
These genetic fragments include autophagy related gene, SNARE family gene, tuberculosis sensitive gene, TLR family gene,
NF-kB signal path gene, Jak/Stat signal path gene: IL family gene, B, T cell receptor signal transduction pathway gene
(316 ORF).Such as Figure 10, PCR amplification, product carries out glue recycling with BioFlu kit；
3) PCR product in step 2) is then entered into yeast cells Y187gold with linearized vector pmGADT7 corotation respectively,
Carry out homologous recombination in yeast.Random selected clone verifying, homologous recombination positive rate can reach 100%.It is logical to construct the innate immunity
The relevant prey Yeast libraries in road.
4) to the relevant prey Yeast libraries of above-mentioned innate immunity access one by one with positive control albumen pmGBKT7-P53 into
Row hybridizes, and hybridizes (30 DEG C, 50rpm/min) for 24 hours in 2*YPAD culture medium, is then applied to SD/-Trp/Leu, SD/-Trp/ respectively
His/Ade/leu plate, 30 DEG C of inversions cultivate 5d-7d, observe the growing state of bacterium colony.Growth, which represents, has self-excitation activity,
It is not found to have the active albumen of self-activation (such as Figure 11)；
Six, mycobacterium tuberculosis bait Yeast libraries prey Yeast libraries relevant to innate immunity access carry out library pair
Library hybridization
The library of step 4) and " bait " protein library and " prey " albumen that 5) obtain is mixed and is hybridized, 2*
Hybridize (30 DEG C, 50rpm/min) for 24 hours in YPAD culture medium, is coated on SD/-Ade/His/Leu/Trp plate, grows out
It is positive interaction albumen clone.About 2000 or so clones, hybridization efficiency reach 17% (as shown in figure 12) in total.
The building of seven, high-throughput sequencing libraries
In above-mentioned library construction process, BamH I and I restriction enzyme site of Nde are selected, while downstream homology arm introduces
I restriction enzyme site of Mme, the base of its recognition site upstream of I digestion of Mme 21bp, passes through the specific integration function of phiC31
Can, it collects and hybridizes later interaction clone, the mutual pyrenoids aligned after locus specificity recombination will be obtained by PCR amplification
The new sequence of thuja acid connection, the i.e. nucleotide sequence containing I-ATTL-Mme of pery-Mme, I-bait segment, wherein pery-Mme
In I-ATTL-Mme, I-bait segment, I-ATTL-Mme of Mme, I nucleotide sequence, as shown in SEQ ID NO:4.To PCR product into
Row Mme I digestion, obtains new segment after the interaction protein nucleotides connection that size is identical but sequence is entirely different, and recycling digestion produces
Object simultaneously connects high-flux sequence adapter primer, carries out high-flux sequence, Figure 13.
1. yeast plasmid extracts and obtains the new sequence integrated and orient connection after enzyme effect
To about 2000 clones after hybridization, it is collected together, utilizes OMEGA company E.Z.N.A.TM Yeast
DNA Kit extracts yeast plasmid, and is template design primer to product, that is, pery- after carrying out low circulation amplification connection using it
I-ATTL-Mme of Mme, I-bait (Figure 14 A), primer pair:
AD-For1:catacgacgtaccagattacg,
BD-For1:catcatggaggagcagaagct,
PCR system:
PCR instrument program: 95 DEG C of 3m → [95 DEG C of 15s → 57 DEG C 25s → 72 DEG C 2m] × 20 → 72 DEG C of 5m → 16 DEG C 1s.
PCR amplification, product OMEGA company E.Z.N.A.TMCycle-Pure Kit is recycled
2. couple I-ATTL-Mme of recovery product pery-Mme, I-bait carries out I digestion of Mme processing, 3% height is then selected
(Figure 14 B) is recycled in concentration eutectic dispensing；
3. digestion products are attached with high-flux sequence primer
1) high-flux sequence primer information and acquisition:
Synthesizing two Double-stranded nucleotide sequences is respectively P5-adapter and P7-adapter, designs two pairs of single stranded nucleotides
Acid, sequence are respectively as follows:
P5-F chain: acactctttccctacacgacgctcttccgatctnn
P5-R chain: tgtgagaaagggatgtgctgcgagaaggctaga；
P7-F chain: gatcggaagagcacacgtctgaactccagtcac
P7-R chain: nnctagccttctcgtgtgcagacttgaggtcagtg
PCR system:
PCR instrument program: decline process of 95 DEG C of 5m → 95 DEG C → 16 DEG C from 95 DEG C to 16 DEG C 1.5h in total, fall off rate
1.5%., product is Double-stranded nucleotide sequence P5-adapter and P7-adapter；
2) digestion products are attached with high-flux sequence primer with 4 ligase of NEB company's T
Linked system:
16 DEG C of connection 2h-4h, obtained connection product；
3) connection product Agencourt AMPure XP Bead Clean-up (E2612) carries out purification and recovery
A. the AMPure XP Bead that 1.2 times of volumes are added is uniformly mixed into connection product, is incubated at room temperature 5min
B. magnetic force column adsorbs minimum 5min, and until mixed liquor is clarified, AMPure XP Bead is all adsorbed onto magnetic force column and is
Only.
C. it inhales and abandons supernatant, and whole process centrifuge tube is always on magnetic-adsorption column.
D. continue to add 80% alcohol 500-600 μ L, room temperature acts on 30s, is moved back to immediately on magnetic-adsorption column, mixed liquor is clear
After clear, inhale abandon supernatant immediately, be repeated 2 times,
E. the alcohol in centrifuge tube, drying at room temperature 5min are carefully removed, this process is always held on magnetic-adsorption column；
F. 15 μ L EB are added, sufficiently act on 3min with AMPure XP Bead room temperature, on being put into magnetic-adsorption column sufficiently
Effect carefully takes solution, the as product after connection high-flux sequence primer away until solution clarification.
4. the repair process in the end of the connection product 3 ' gap OH-OH
Then 37 DEG C of 15min are placed on 4 DEG C of refrigerator reparations and stay overnight.
5. using connection product after repairing as template, design primer pair is expanded, primer pair using touch down round pcr
Sequence:
PE PCR Primer1:
aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct
PE PCR Primer2:
caagcagaagacggcatacgagatcgtgatgtgactggagttcagacgtgtgctcttccgatc
System is as follows:
Response procedures: each circulation in 95 DEG C of 1m → 95 DEG C 10s → 74 DEG C 10s → 95 DEG C 10s → 73 DEG C declines 1 DEG C ... ...
95℃10s→63℃10s→[95℃10s→63℃10s]×6→72℃10m→16℃1s.
Obtain PCR product (Figure 14 C), OMEGA company E.Z.N.A.TMCycle-Pure Kit carries out recycling and send high throughput
Sequencing.
7) high-flux sequence in library and data analysis
High-flux sequence data are analyzed and processed with (analysis program is shown in Figure 15), finally obtain 212 mutually oppose it is mutual
Make network map (Figure 16)；
8) verifying of interaction:
By 212 interactions between protein pair obtained to high throughput analysis, by point-to-point yeast two-hybrid method into one
Step does yeast two-hybrid verifying, wherein there is 186 mutually to oppose and can be verified again (such as Figure 17), sufficiently demonstrate method can
Row and reliability.
Other unspecified parts are the prior art.Although above-described embodiment is made that the present invention and retouches in detail
State, but it is only a part of the embodiment of the present invention, rather than whole embodiments, people can also according to the present embodiment without
Other embodiments are obtained under the premise of creativeness, these embodiments belong to the scope of the present invention.
Claims (8)
1. a kind of recombinant vector pGADT7-ATTP-phiC31 for yeast two-hybrid, it is characterised in that: the recombinant vector
PGADT7-ATTP-phiC31 is that solexa PE1-MCS-ATTP nucleotide sequence and PolIII: are inserted on carrier pGADT7:
PhiC31-Cyc1 expression cassette, sequence between solexa PE1-MCS-ATTP nucleotide sequence replacement Nde I and Xho I and
Its I restriction enzyme site of Xho, the PolIII::phiC31-Cyc1 expression cassette are inserted on Nhe I, wherein solexa PE1-MCS-
ATTP nucleotide sequence is as shown in SEQ ID NO:1, and PolIII::phiC31-Cyc1 expression cassette is as shown in SEQ ID NO:2.
2. the construction method described in a kind of claim 1 for the recombinant vector pGADT7-ATTP-phiC31 of yeast two-hybrid,
It is characterized by comprising following steps:
1) solexa PE1-MCS-ATTP nucleotide sequence is synthesized, is arranged with solexa PE1-MCS-ATTP nucleotides sequence as template
Design has the overall length primer pair of homology arm, and primer pair is as follows:
Sol-Fo:gacgtaccagattacgctcatatgagaatgatacggcgaccaccg,
ATTP-Re:ctacgattcatctgcagctcgacagtgccccaactggggtaac；
PCR amplification, recovery purifying obtain the solexa PE1-MCS-ATTP nucleotide sequence such as SEQ ID NO containing homology arm:
Shown in 1；
2) carrier PGADT7 is subjected to digestion processing, the carrier PGADT7 that purification and recovery is linearized with Nde I and Xho I；
3) the carrier PGADT7 of linearisation and the above-mentioned solexa PE1-MCS-ATTP nucleotide sequence containing homology arm are carried out
Homologous recombination, screening positive clone, and it is named as PGADT7-ATTP；
4) with saccharomyces cerevisiae YSR127gDNA template design primer pair, primer pair is as follows:
NheI-PolIII-Fo:gggctagctgccaattgaacataacatg,
PolIII-phiC31-Re:ctgggagctgcgattggcaatgacacaaggggttgtgac；
PCR amplification, recovery purifying obtain PolIII promoter；
5) using phiC31ORF as stencil design overall length primer pair, primer pair is as follows:
PhiC31-PolIII-Fo:ctgggagctgcgattggcaatgacacaaggggttgtgac,
PhiC31-cyc1-Re:attggaagttggatatggggttatacgtcttccgtgccgtc；
PCR amplification, recovery purifying obtain phiC31ORF；
6) with saccharomyces cerevisiae YSR127gDNA template design primer pair, primer pair is as follows:
Cyc1-phiC31-Fo:gacggcacggaagacgtataaccccatatccaacttccaat,
NheI-cyc1-Re:gggctagcgactgtgtcaatgacttcac；
PCR amplification, recovery purifying obtain PolIII terminator；
7) using above-mentioned steps 4), 5) and 6) obtain PolIII promoter, phiC31ORF and PolIII terminator as template, with
NheI-PolIII-Fo and NheI-cyc1-Re is primer overlap PCR amplification, and recovery purifying obtains PolIII::phiC31-
Cyc1 expression cassette is as shown in SEQ ID NO:2；
8) carrier PGADT7-ATTP after transformation and above-mentioned PCR product PolIII::phiC31-Cyc1 expression cassette are used into NheI respectively
Digestion processing, is attached, screening positive clone, obtains last recombinant vector PGADT7-ATTP-phic31, referred to as
pmGADT7。
3. the construction method for the recombinant vector pGADT7-ATTP-phic31 of yeast two-hybrid according to claim 2,
It is characterized by: in the step 1),
PCR amplification system:
PCR instrument program:
,
In the step 4), PCR amplification system:
PCR instrument program:
,
In the step 5), PCR amplification system:
PCR instrument program:
,
In the step 6), PCR amplification system:
PCR instrument program:
,
In the step 7), PCR amplification system:
PCR instrument program:
4. a kind of recombinant vector pGBKT7-ATTB-phiC31 for yeast two-hybrid, it is characterised in that: the recombinant vector
PGBKT7-ATTB-phiC31 is that solexa PE2-MCS-ATTB nucleotide sequence and PolIII: are inserted on carrier pGBKT7:
PhiC31-Cyc1 expression cassette, sequence between solexa PE2-MCS-ATTB nucleotide sequence replacement Nde I and Xho I and
Its I restriction enzyme site of Xho, the PolIII::phiC31-Cyc1 expression cassette are inserted on Avr II, wherein the solexa
PE2-MCS-ATTB nucleotide sequence is as shown in SEQ ID NO:3, the PolIII::phiC31-Cyc1 expression cassette such as SEQ ID
Shown in NO:2.
5. the construction method described in a kind of claim 4 for the recombinant vector pGBKT7-ATTB-phiC31 of yeast two-hybrid,
It is characterized by comprising following steps:
1) solexa PE2-MCS-ATTB nucleotide sequence is synthesized, is arranged with solexa PE2-MCS-ATTB nucleotides sequence as template
Design has the overall length primer pair of homology arm, and primer pair is as follows:
BD-Sol-Fo:gatctcagaggaggacctgcatatgacaagcagaagacggcatacg,
BD-ATTB-Re:ctagttatgcggccgctgcagggagtacgcgcccggggagc；
PCR amplification, recovery purifying obtain the solexa PE2-MCS-ATTB nucleotide sequence containing homology arm；
2) carrier PGBKT7 is subjected to digestion processing, the carrier PGBKT7 that purification and recovery is linearized with Nde I and Xho I；
3) the carrier PGBKT7 of linearisation and the above-mentioned solexa PE2-MCS-ATTB nucleotide sequence containing homology arm are carried out
Homologous recombination, screening positive clone, and it is named as PGBKT7-ATTB；
4) with saccharomyces cerevisiae YSR127gDNA template design primer pair, primer pair is as follows:
II-PolIII-Fo:ggcctagg tgccaattgaacataacatg of Avr,
PolIII-phiC31-Re:ctgggagctgcgattggcaatgacacaaggggttgtgac；
PCR amplification, recovery purifying obtain PolIII promoter；
5) using phiC31ORF as stencil design overall length primer pair, primer pair is as follows:
PhiC31-PolIII-Fo:ctgggagctgcgattggcaatgacacaaggggttgtgac,
PhiC31-cyc1-Re:attggaagttggatatggggttatacgtcttccgtgccgtc；
PCR amplification, recovery purifying obtain phiC31ORF；
6) with saccharomyces cerevisiae YSR127gDNA template design primer pair, primer pair is as follows:
Cyc1-phiC31-Fo:gacggcacggaagacgtataaccccatatccaacttccaat,
II-cyc1-Re:ggcctagggactgtgtcaatgacttcac of Avr；
PCR amplification, recovery purifying obtain PolIII terminator；
7) using above-mentioned steps 4)~6) obtained in PolIII promoter, phiC31ORF and PolIII terminator as template, with
II-cyc1-Re of Avr II-PolIII-Fo and Avr is primer overlap PCR amplification expression cassette PolIII::phiC31-Cyc1
Expression cassette；
PCR amplification, recovery purifying obtain PolIII::phiC31-Cyc1 expression cassette；
8) carrier PGBKT7-ATTB after transformation and above-mentioned PCR product PolIII:phiC31:Cyc1 expression cassette are used into Avr II respectively
Digestion processing, is attached, screening positive clone, obtains last recombinant vector PGBKT7-ATTB-phiC31, referred to as
pmGBKT7。
6. the construction method for the recombinant vector pGBKT7-ATTB-phiC31 of yeast two-hybrid according to claim 5,
It is characterized by: in the step 1), PCR amplification system:
PCR instrument program:
,
In the step 4), PCR amplification system:
PCR instrument program:
,
In the step 5), PCR amplification system:
PCR instrument program:
,
In the step 6), PCR amplification system:
PCR instrument program:
In the step 7), PCR amplification system:
PCR instrument program:
7. the method for the yeast two-hybrid using high throughput sequencing technologies Large-scale Screening interaction albumen, it is characterised in that: including
Following steps:
1) building described in claim 2 for the recombinant vector pGADT7-ATTP-phiC31 of yeast two-hybrid；
2) building described in claim 4 for the recombinant vector pGBKT7-ATTB-phiC31 of yeast two-hybrid；
3) library " bait " Bait of building research GAP-associated protein GAP；
A. the primer containing I restriction enzyme site of homology arm and Mme is designed, amplification obtains the Bait protein nucleotides sequence containing homology arm
Column；Wherein, primer is as follows:
Upstream homology arm sequence: gaagctgatctcagaggaggacctg,
Downstream homology arm sequence: ggcacgccctggcacccgcacgctatccaac；
B recombinant vector pmGBKT7 described in BamH I and Nde I linearization for enzyme restriction claim 5, by the recombinant vector of linearisation
PmGBKT7 and Bait protein nucleotide sequence corotation containing homology arm enter in yeast cells Y2H gold；
4) " prey " pery protein library with the studies above GAP-associated protein GAP interaction is constructed
A. the primer containing I restriction enzyme site of homology arm and Mme is designed, expands the nucleotide sequence containing pery albumen, wherein draw
Object is as follows:
Upstream homology arm sequence: cccatacgacgtaccagattacgct；
Downstream homology arm sequence: gagttctctcagttgggggcgttgactccaac；
B. it then linearizes recombinant vector pmGADT7 corotation described in claim 2 after being transformed respectively with BamH I and Nde I and enters ferment
Mother cell Y187gold；
5) Library hybridization
Step 3) and the library of " bait " protein library and " prey " albumen that 4) obtain are hybridized, interaction albumen gram is obtained
It is grand；
6) building of high-throughput sequencing library:
A. yeast plasmid extracts and obtains the sequence integrated and orient connection after enzyme effect
Interaction albumen clone after hybridizing is collected, yeast plasmid is extracted, with fusion matter new after connection in yeast plasmid
Grain is template design primer pair, and the interaction protein nucleotide sequence that amplification recovery purifying is connected contains pery-Mme I-
The nucleotide sequence of I-bait segment of ATTL-Mme, wherein in I-ATTL-Mme of pery-Mme, I-bait segment, I-ATTL- of Mme
I nucleotide sequence of Mme, as shown in SEQ ID NO:4；
B. the interaction protein nucleotide sequence connected carries out I digestion of Mme processing, then selects 3% eutectic dispensing of high concentration recycling；
Obtain recovery product after Mme I digestion；
C. digestion products and high-flux sequence primer are attached sequencing；
7) high-flux sequence and data analysis
To high-throughput sequencing library through row high-flux sequence, result is subjected to Data Analysis Services, constructs interactions between protein network
Spectrum.
8. utilizing the side of the yeast two-hybrid of high throughput sequencing technologies Large-scale Screening interaction albumen according to claim 7
Method, it is characterised in that: in the step 1), the building side of the recombinant vector pGADT7-ATTP-phiC31 for yeast two-hybrid
Method, comprising the following steps:
1) solexa PE1-MCS-ATTP nucleotide sequence is synthesized, is arranged with solexa PE1-MCS-ATTP nucleotides sequence as template
Design has the overall length primer pair of homology arm, and primer pair is as follows:
Sol-Fo:gacgtaccagattacgctcatatgagaatgatacggcgaccaccg,
ATTP-Re:ctacgattcatctgcagctcgacagtgccccaactggggtaac；
PCR amplification, recovery purifying obtain the solexa PE1-MCS-ATTP nucleotide sequence such as SEQ ID NO containing homology arm:
Shown in 1；
2) carrier PGADT7 is subjected to digestion processing with Nde I and Xho I, digestion system is as follows:
37 DEG C of 6~8h of digestion, the carrier PGADT7 that purification and recovery is linearized；
3) the carrier PGADT7 of linearisation and the above-mentioned solexa PE1-MCS-ATTP nucleotide sequence containing homology arm are carried out
Homologous recombination, screening positive clone, and it is named as PGADT7-ATTP；
4) with saccharomyces cerevisiae YSR127gDNA template design primer pair, primer pair is as follows:
NheI-PolIII-Fo:gggctagctgccaattgaacataacatg,
PolIII-phiC31-Re:ctgggagctgcgattggcaatgacacaaggggttgtgac；
PCR amplification, recovery purifying obtain PolIII promoter；
5) using phiC31ORF as stencil design overall length primer pair, primer pair is as follows:
PhiC31-PolIII-Fo:ctgggagctgcgattggcaatgacacaaggggttgtgac,
PhiC31-cyc1-Re:attggaagttggatatggggttatacgtcttccgtgccgtc；
PCR amplification, recovery purifying obtain phiC31ORF；
6) with saccharomyces cerevisiae YSR127gDNA template design primer pair, primer pair is as follows:
Cyc1-phiC31-Fo:gacggcacggaagacgtataaccccatatccaacttccaat,
NheI-cyc1-Re:gggctagcgactgtgtcaatgacttcac；
PCR amplification, recovery purifying obtain PolIII terminator；
7) using above-mentioned steps 4), 5) and 6) obtain PolIII promoter, phiC31ORF and Cyc1 terminator as template, with
NheI-PolIII-Fo and NheI-cyc1-Re is primer overlap PCR amplification expression cassette PolIII::phiC31-Cyc1 table
Up to box as shown in SEQ ID NO:2；
PCR amplification, recovery purifying obtain PolIII::phiC31-Cyc1 expression cassette as shown in SEQ ID NO:2；
8) carrier PGADT7-ATTP after transformation and above-mentioned PCR product PolIII:phiC31-Cyc1 expression cassette are used into NheI respectively
Digestion processing, is attached, screening positive clone, obtains last recombinant vector PGADT7-ATTP-phiC31, referred to as
pmGADT7；
In the step 2), the construction method of the recombinant vector pGBKT7-ATTB-phiC31 for yeast two-hybrid, including with
Lower step:
1) the solexa PE2-MCS-ATTB nucleotide sequence as shown in SEQ ID NO:1 is synthesized, with solexa PE2-MCS-
ATTB nucleotides sequence is classified as the overall length primer pair that stencil design has homology arm, and primer pair is as follows:
BD-Sol-Fo:gatctcagaggaggacctgcatatgacaagcagaagacggcatacg,
BD-ATTB-Re:ctagttatgcggccgctgcagggagtacgcgcccggggagc；
PCR amplification, recovery purifying obtain the solexa PE2-MCS-ATTB nucleotide sequence containing homology arm；
2) carrier PGBKT7 is subjected to digestion processing with Nde I and Xho I, digestion system is as follows:
37 DEG C of 6~8h of digestion, the carrier PGBKT7 that purification and recovery is linearized；
3) the carrier PGBKT7 of linearisation and the above-mentioned solexa PE2-MCS-ATTB nucleotide sequence containing homology arm are carried out
Homologous recombination, screening positive clone, and it is named as PGBKT7-ATTB；
4) with saccharomyces cerevisiae YSR127gDNA template design primer pair, primer pair is as follows:
II-PolIII-Fo:ggcctagg tgccaattgaacataacatg of Avr,
PolIII-phiC31-Re:ctgggagctgcgattggcaatgacacaaggggttgtgac；
PCR amplification, recovery purifying obtain PolIII promoter；
5) using phiC31ORF as stencil design overall length primer pair, primer pair is as follows:
PhiC31-PolIII-Fo:ctgggagctgcgattggcaatgacacaaggggttgtgac,
PhiC31-cyc1-Re:attggaagttggatatggggttatacgtcttccgtgccgtc；
PCR amplification, recovery purifying obtain phiC31ORF；
6) with saccharomyces cerevisiae YSR127gDNA template design primer pair, primer pair is as follows:
Cyc1-phiC31-Fo:gacggcacggaagacgtataaccccatatccaacttccaat,
II-cyc1-Re:ggcctagggactgtgtcaatgacttcac of Avr；
PCR amplification, recovery purifying obtain PolIII terminator；
7) using above-mentioned steps 4)~6) obtained in PolIII promoter, phiC31ORF and Cyc1 terminator as template, with Avr
II-PolIII-Fo and II-cyc1-Re of Avr is primer overlap PCR amplification expression cassette PolIII::phiC31-Cyc1 expression
Box；
PCR amplification, recovery purifying obtain PolIII::phiC31-Cyc1 expression cassette；
8) carrier PGBKT7-ATTB after transformation and above-mentioned PCR product PolIII:phiC31-Cyc1 expression cassette are used into Avr II respectively
Digestion processing, is attached, screening positive clone, obtains last recombinant vector PGBKT7-ATTB-phiC31, referred to as
pmGBKT7。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610436290.3A CN106434734B (en) | 2016-06-17 | 2016-06-17 | The method of recombinant vector and its Large-scale Screening interaction albumen for high-throughput yeast-two hybrid technique |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610436290.3A CN106434734B (en) | 2016-06-17 | 2016-06-17 | The method of recombinant vector and its Large-scale Screening interaction albumen for high-throughput yeast-two hybrid technique |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106434734A CN106434734A (en) | 2017-02-22 |
| CN106434734B true CN106434734B (en) | 2019-07-05 |
Family
ID=58183162
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610436290.3A Active CN106434734B (en) | 2016-06-17 | 2016-06-17 | The method of recombinant vector and its Large-scale Screening interaction albumen for high-throughput yeast-two hybrid technique |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106434734B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110904141A (en) * | 2018-09-17 | 2020-03-24 | 上海欧易生物医学科技有限公司 | Method for high-throughput research of rice transcription factors |
| CN110004171B (en) * | 2019-03-27 | 2023-08-22 | 佛山科学技术学院 | Yeast double hybridization method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101157934A (en) * | 2007-09-20 | 2008-04-09 | 复旦大学 | Gene clone plasmid based on Phi BT1 integrase and Phi C31 integrase |
| CN102827873A (en) * | 2012-07-31 | 2012-12-19 | 西北农林科技大学 | Cre fusion protein functional test cell and modified Cre fusion protein |
-
2016
- 2016-06-17 CN CN201610436290.3A patent/CN106434734B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101157934A (en) * | 2007-09-20 | 2008-04-09 | 复旦大学 | Gene clone plasmid based on Phi BT1 integrase and Phi C31 integrase |
| CN102827873A (en) * | 2012-07-31 | 2012-12-19 | 西北农林科技大学 | Cre fusion protein functional test cell and modified Cre fusion protein |
Non-Patent Citations (2)
| Title |
|---|
| development and application of a recombination-based library versus library high-throughput yeast two-hybrid(RLL-Y2H) screening system;fangyang et al.;《nucleic acids research》;20171120;第46卷(第3期);a006-9 |
| 高通量酵母双杂交平台的建立及其在蛋白质相互作用组学当中的应用;王玮;《中国博士学位论文全文数据库 基础科学辑》;20080615;e17 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106434734A (en) | 2017-02-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mayer et al. | Unlocking the barley genome by chromosomal and comparative genomics | |
| Hilson et al. | Versatile gene-specific sequence tags for Arabidopsis functional genomics: transcript profiling and reverse genetics applications | |
| WO2017190664A1 (en) | Use of chemosynthetic crrna and modified crrna in crispr/cpf1 gene editing systems | |
| Zhang et al. | High resolution consensus mapping of quantitative trait loci for fiber strength, length and micronaire on chromosome 25 of the upland cotton (Gossypium hirsutum L.) | |
| CN107190003A (en) | A kind of method of efficient quick separating T DNA insertion point flanking sequences and application thereof | |
| Macas et al. | Hypervariable 3′ UTR region of plant LTR-retrotransposons as a source of novel satellite repeats | |
| CN107278231A (en) | Fungal gene group modification system and application method | |
| CN105238859B (en) | A kind of method for obtaining chicken full-length genome high density SNP marker site | |
| CN107090504B (en) | SNP molecular marker combination for corn genotyping and application thereof | |
| Li et al. | FISH-based markers enable identification of chromosomes derived from tetraploid Thinopyrum elongatum in hybrid lines | |
| WO2020182221A1 (en) | Rice bacterial leaf streak-resistant protein, and encoding gene and application thereof | |
| CN104673824B (en) | A kind of carrier of suitable gene stacking and its application | |
| CN114058625B (en) | Site for stably expressing protein in CHO cell gene NW _003613781.1 and application thereof | |
| Zwyrtková et al. | Chromosome genomics uncovers plant genome organization and function | |
| CN106434734B (en) | The method of recombinant vector and its Large-scale Screening interaction albumen for high-throughput yeast-two hybrid technique | |
| Wyrwa et al. | Integration of Lupinus angustifolius L.(narrow-leafed lupin) genome maps and comparative mapping within legumes | |
| WO1999027072A1 (en) | Reagents and methods for diversification of dna | |
| Vrána et al. | Preparation of sub-genomic fractions enriched for particular chromosomes in polyploid wheat | |
| CN112961936B (en) | Mung bean InDel molecular marker detection primer group and application thereof | |
| Delseny | Towards an accurate sequence of the rice genome | |
| CN108004246A (en) | The method that liquid phase target SELEX screenings are quickly carried out using the affine method of metal | |
| Oh et al. | Fine mapping in tomato using microsynteny with the Arabidopsis genome: the Diageotropica (Dgt) locus | |
| EP1034261A2 (en) | Method of parallel screening for insertion mutants and a kit to perform this method | |
| CN104088019A (en) | Construction method of peptide aptamer library based on dimolecular fluorescence complementation technology | |
| CN108624686B (en) | A kind of probe library, detection method and the kit of detection BRCA1/2 mutation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |