CN106434719A - Method of constructing zero-background support based on vaccinia topoisomerase I - Google Patents
Method of constructing zero-background support based on vaccinia topoisomerase I Download PDFInfo
- Publication number
- CN106434719A CN106434719A CN201610855708.4A CN201610855708A CN106434719A CN 106434719 A CN106434719 A CN 106434719A CN 201610855708 A CN201610855708 A CN 201610855708A CN 106434719 A CN106434719 A CN 106434719A
- Authority
- CN
- China
- Prior art keywords
- primer
- carrier
- zero background
- linear
- construction method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
Abstract
The invention discloses a method of constructing a zero-background support based on vaccinia topoisomerase I, comprising the steps of introducing ccdB gene expression unit to a plasmid to obtain a synthetic plasmid; performing massive amplification by using DNA polymerase and PCR (polymerase chain reaction), using primers A as upstream and downstream primers and using the synthetic plasmid as a template to produce a linear pre-support; electrophoretically separating the linear pre-support with agarose gel, and purifying by gel slices; adding T4DNA polymerase and dATP, protruding 5' terminal of the linear pre-support; adding primer B, primer C and NaCl, mixing well, and subjecting to cutting and connecting of vaccinia topoisomerase I to obtain the zero-background support. The primer B and primer C herein are bonded to the 5' end produced linear pre-support through bases pairing, zero background can be achieved under the cutting and connecting capacities of vaccinia topoisomerase I, non-objective ligating in T4DNA ligase ligation is avoided, linear support and double-chain link ligating is more efficient, and the constructing process is simplified.
Description
Technical field
The present invention relates to vector construction field, more particularly to a kind of zero background carrier structure based on cowpox topoisomerase I
Construction method.
Background technology
Vector construction refers to DNA molecular to be transported in recipient cell, it is necessary to finds one kind and can enter cell, fill
The carrier for replicating in the same old way is remained to after having carried external DNA fragmentation.Preferably carrier is plasmid, in genetic engineering, commonly uses
Artificial constructed plasmid is used as carrier.Vector construction is to build the plasmid containing foreign DNA.During traditional vector construction,
Genetic fragment is that it urges under conditions of it there is coenzyme A TP and MgCl2 based on T4DNA ligase with the connection great majority of carrier
Change between cohesive end or the 5 '-P ends and 3 '-OH end of flush end double-stranded DNA or RNA and phosphodiester bond is formed, but this reaction
Process is generally relatively slow, generally needs overnight to connect for reaching optimal connection effect, and enzyme stability is poor, in storage and transportation process
Its activity is susceptible to change.At present, carrier be built with a lot of alternative, the carrier structure based on cowpox topoisomerase I
Construction method has very big application prospect, but the effect of cowpox topoisomerase I needs one section of special DNA sequence 5`ccctt,
And cut/connect the phosphodiester bond after 5`ccctt.Specifically sequence is a key issue how to add this section in the carrier.
Common method is that carrier exposes sticky end, two 5` of resynthesis using specific restriction enzyme cleavage plasmid vector
The single-stranded primer of end phosphorylation, annealing becomes a sticky end for carrying with the pairing of carrier viscosity termini-complementary, then passes through
T4DNA ligase connection carrier and joint.But, the flow process of this scheme carrier production is longer, particularly restricted enzyme
The linear carrier for processing is difficult to ensure that with double-stranded adapters joint efficiency, thus carrier is prepared and wasted time and energy.
Content of the invention
In view of this, the present invention provides a kind of zero background carrier construction method based on cowpox topoisomerase I, the method
Vector construction long flow path is can solve the problem that, carrier prepares the technical problem for wasting time and energy.
The technical scheme is that and be achieved in that：
A kind of zero background carrier construction method based on cowpox topoisomerase I, comprises the following steps：
1) ccdB gene expression units are introduced on plasmid, obtains synthetic plasmid；
2) archaeal dna polymerase is used, and by PCR using primer A as upstream and downstream primer, the synthetic plasmid is template, to carry out
A large amount of amplifications, produce linear front carrier；And the linear front carrier is separated with agarose gel electrophoresiies, and cut glue purification；
3) by step 2) obtain described cut glue purification linear before add T4DNA polymerase and dATP in carrier, prominent
Step 2) obtain described cut glue purification linear before carrier 5` end；
4) in step 3) add primer B, primer C and NaCl to be sufficiently mixed in the product that obtains, and in cowpox topoisomerase
The cutting of enzyme I be connected, that is, obtain zero background carrier；
In the primer A, the nucleotide sequence of 5`-3` is AAGGGCGAGACGCGAA (SEQ ID:1)；5`- in the primer B
The nucleotide sequence of 3` is TTCGCGTGTCGCCCTTATTCCGATAGTG (SEQ ID:2)；The nucleic acid sequence of 5`-3` in the primer C
It is classified as CAACACTATCGGAAT (SEQ ID:3).
Preferably, all there is one section of double-stranded sequence M at the ccdB gene expression units two ends；The double-stranded sequence M from 3 ' -5 '
Front 16bp base do not contain adenine, the 17th with the 18th contain two adenine.
Preferably, the double-stranded sequence M is
Preferably, step 3) described in T4DNA polymerase and dATP 35～40 DEG C process linear before carrier two ends；Described
Concentration of the dATP in reaction system is 0.8～1.2mM.
Preferably, step 3) and step 4) between also include step 3) product that obtains heats 15 at 70～80 DEG C～
25min.
Preferably, step 4) described in 5` distal process go out linear before carrier molecular weight, with the primer B and the primer
The total molecular weight ratio of C is 1：45～55；The concentration of the primer B and the primer C in reaction system is 0.8～1.2mM；
The concentration of the NaCl is 1.5～2.5M, and volume is the 1/12～1/8 of reaction system.
Preferably, the cutting of the cowpox topoisomerase I is to be heated to 85～95 DEG C in water-bath with condition of contact
Natural cooling afterwards.
The present invention provides the zero background carrier construction method based on cowpox topoisomerase I, the nucleic acid of 5`-3` in primer B
Sequence is TTCGCGTGTCGCCCTTATTCCGATAGTG (SEQ ID:2)；In primer C, the nucleotide sequence of 5`-3` is
CAACACTATCGGAAT(SEQ ID:3) the linear front carrier knot that, both primers are gone out by base pair complementarity and 5` distal process
Close, zero background can be realized in the presence of cutting and the concatenation ability of cowpox topoisomerase I, it is to avoid T4DNA ligase is even
The reversed non-purpose connection that middle should occur, improves linear carrier and double-stranded adapters joint efficiency height, simplifies structure flow process, solve
Vector construction long flow path, carrier prepares the problem for wasting time and energy.
Specific embodiment
The invention discloses a kind of zero background carrier construction method based on cowpox topoisomerase I, people in the art
Member can use for reference present disclosure, be suitably modified technological parameter realization.Specifically, the similar replacement and change
Apparent to those skilled in the art, they are considered as including in the present invention.The method of the present invention and quote
It is described by preferred embodiment, related personnel substantially can be without departing from right in present invention, spirit and scope
Method described herein and application are modified or suitably change and combine, and realize and apply the technology of the present invention.
A kind of zero background carrier construction method based on cowpox topoisomerase I, comprises the following steps：
1) introduce ccdB gene expression units on plasmid, obtain synthetic plasmid；
2) archaeal dna polymerase is used, and by PCR using primer A as upstream and downstream primer, synthetic plasmid is template, to carry out in a large number
Amplification, produces linear front carrier；And linear front carrier is separated with agarose gel electrophoresiies, and cut glue purification；
3) by step 2) obtain cut glue purification linear before add T4DNA polymerase and dATP in carrier, prominent step
2) the linear front carrier 5` end for cutting glue purification for obtaining；
4) in step 3) add primer B, primer C and NaCl to be sufficiently mixed in the product that obtains, and in cowpox topoisomerase
The cutting of enzyme I be connected, that is, obtain zero background carrier；
In primer A, the nucleotide sequence of 5`-3` is AAGGGCGAGACGCGAA (SEQ ID:1)；The nucleic acid of 5`-3` in primer B
Sequence is TTCGCGTGTCGCCCTTATTCCGATAGTG (SEQ ID:2)；In primer C, the nucleotide sequence of 5`-3` is
CAACACTATCGGAAT(SEQ ID:3).
In technique scheme, ccdB gene expression is a kind of toxic protein, can interfere with e. coli dna gyrase,
So as to bacteria growing inhibiting and kill antibacterial；Escherichia coli DB3.1 contains gyrA462 gene, to ccdB gene expression product poison
Property has resistant function, can facilitate conversion and the plasmid extraction of plasmid, while improved carrier can be reduced typically big
The background for causing is converted in enterobacteria.
T4DNA polymerase has stronger 3 ' → 5 ' exonuclease activity, while existing in template and primer A
Under the conditions of, catalysis is selectively coupled to the reaction on 3 '-OH ends of primer successively with the Deoxydization nucleotide of template complementation, i.e.,
With 5` → 3` polymerase activity.Using the linear front carrier two ends of T4DNA polymerization ferment treatment, two 5` ends of linear front carrier are made
Prominent.As T4DNA polymerase has circumscribed core of 5` → 3` polymerase activity much stronger than 3 ' → 5 ' in the presence of dNTP
In phytase activity, and reaction system only have dATP presence, therefore by 3 ' → 5 ' digestion when sequence first A base end
Only.Also due to only dATP is present, 5` → 3` polymerase activity is also terminated.
Primer B, primer C are combined by the linear front carrier that base pair complementarity and 5` distal process go out, in cowpox topoisomerase
Zero background can be realized in the presence of the cutting of enzyme I and concatenation ability, i.e., not have connecting certainly for carrier.
In an embodiment of the present invention, synthetic plasmid sequence is as follows：
CCTGTTCTCGTCAGCAAAAGAGCCGTTCATTTCAATAAACCGGGCGACCTCAGCCATCCCTTCCTGATTTTCCGCTT
TCCAGCGTTCGGCACGCAGACGACGGGCTTCATTCTGCATGGTTGTGCTTACCAGACCGGAGATATTGACATCATAT
ATGCCTTGAGCAACTGATAGCTGTCGCTGTCAACTGTCACTGTAATACGCTGCTTCATAGCATACCTCTTTTTGACA
TACTTCGGGTATACATATCAGTATATATTCTTATACCGCAAAAATCAGCGCGCAAATACGCATACTGTTATCTGGCT
TTTAGTAAGCCGGATCCTAACTCAAAATCCACACATTATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCT
AATGGAGTCGAATAAGGGCGACACGCGAATTCCGATAACAAGCATCAGGACTGCAGCGAGCCTCAGACACTGGCCGT
CGTTTTACACAATCAAGTCGTGACTGGGAAAACCCTGGCGCTCACTGGCTCACCTTCACGGGTGGGCCTTTCTTCGG
TAGAAAATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCT
ACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAGGTAACTGGCTTCAGCAGAGCGCAGAT
ACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCG
CTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAG
TTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACAC
CGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGG
TAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTC
GGGTTTCGCCACCTCTGACTTGAGCATCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAG
CAACGCAGAAAGGCCCACCCGAAGGTGAGCCAGGTGATTACATTTGGGCCCTCATTACCAATGCTTAATCAGTGAGG
CACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGG
GAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAAT
AAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTT
GCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTG
TCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTT
GTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGG
TTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACC
AAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACA
TAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGA
GATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGA
GCAAAAACAGGAAGGCAAAATGCCGCAAAAAACGGAATAAGTGCGACACGGAAATGTTGAATACTCATTTTAGCTTC
CTTAGCTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAAC
CTCTTACGTGCCGATCAAGTCAAAAGCCTCCGGTCGGAGGCTTTTGACTTTCTGCTATGGAAGCGGATAACAATTTC
ACACAGGAAACAGCTATGACCATCGTCAGTATTGACTGCAGGCAGACGCGACATCGAATTCGCGTGTCGCCCTTATT
CGACTCGCCTGACATTTATATTCCCCAGAACATCAGGTTAATGGCGTTTTTGATGTCATTTTCGCGGTGGCTGAGAT
CAGCCACTTCTTCCCCGATAACGGAGACCGGCACACTGGCCATATCGGTGGTCATCATGCGCCAGCTTTCATCCCCG
ATATGCACCACCGGGTAAAGTTCACGGGAGACTTTATCTGACAGCAGACGTGCACTGGCCAGGGGGATCACCATCCG
TCGCCCGGGCGTGTCAATAATATCACTCTGTACATCCACAAACAGACGATAACGGCTCTCTCTTTTATAGGTGTAAA
CCCTAAACTGCATTTCACCAGCC(SEQ ID:4).
In an embodiment of the present invention, ccdB gene expression units two ends all have one section of double-stranded sequence M, double-stranded sequence M from
3 ' → 5 ' front 16bp base does not contain adenine, and the 17th contains two adenine with the 18th；Other enforcements in the present invention
In example, double-stranded sequence M isIn an embodiment of the present invention, T4DNA polymerase and
DATP carrier two ends before 35～40 DEG C are processed linearly；In other embodiments of the invention, T4DNA polymerase and dATP are 37
DEG C process linear before carrier two ends.
In an embodiment of the present invention, step 3) and step 4) between also include step 3) product that obtains is 70～80
15～25min is heated at DEG C；In other embodiments of the invention, step 3) and step 4) between also include step 3) obtain
Product heat 20min at 75 DEG C.
In an embodiment of the present invention, the molecular weight of the linear front carrier that 5` distal process goes out, with primer B and the total score of primer C
Son amount is than being 1：The concentration of 45～55, dATP in reaction system is 0.8～1.2mM；In other embodiments of the invention, 5`
The molecular weight of the linear front carrier that distal process goes out, the total molecular weight ratio with primer B and primer C is 1：50, dATP in reaction system
Concentration be 1mM.
In an embodiment of the present invention, the cutting of cowpox topoisomerase I is to be heated in water-bath with condition of contact
Natural cooling after 85～95 DEG C；In other embodiments of the invention, the cutting of cowpox topoisomerase I and condition of contact be
Natural cooling after being heated to 90 DEG C in water-bath.
In an embodiment of the present invention, the concentration of NaCl is 1.5～2.5M of reaction system, and volume is the 1/ of reaction system
12～1/8；In other embodiments of the invention, the concentration of NaCl is the 2M of reaction system, and volume is the 1/10 of reaction system.
In order to the present invention is further illustrated, with reference to embodiments cowpox topoisomerase is based on to one kind that the present invention is provided
The zero background carrier construction method of enzyme I is described in detail.
In following examples, raw material used is commercially available.
Embodiment
1) introduce ccdB gene expression units on plasmid, obtain synthetic plasmid；Wherein, ccdB gene expression units two
End all has one sectionDouble-stranded sequence M；Front 16bp base of the double-stranded sequence M from 3 ' → 5 '
Without adenine, the 17th contains two adenine with the 18th；The sequence of synthetic plasmid is：
CCTGTTCTCGTCAGCAAAAGAGCCGTTCATTTCAATAAACCGGGCGACCTCAGCCATCCCTTCCTGATTTTCCGCTT
TCCAGCGTTCGGCACGCAGACGACGGGCTTCATTCTGCATGGTTGTGCTTACCAGACCGGAGATATTGACATCATAT
ATGCCTTGAGCAACTGATAGCTGTCGCTGTCAACTGTCACTGTAATACGCTGCTTCATAGCATACCTCTTTTTGACA
TACTTCGGGTATACATATCAGTATATATTCTTATACCGCAAAAATCAGCGCGCAAATACGCATACTGTTATCTGGCT
TTTAGTAAGCCGGATCCTAACTCAAAATCCACACATTATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCT
AATGGAGTCGAATAAGGGCGACACGCGAATTCCGATAACAAGCATCAGGACTGCAGCGAGCCTCAGACACTGGCCGT
CGTTTTACACAATCAAGTCGTGACTGGGAAAACCCTGGCGCTCACTGGCTCACCTTCACGGGTGGGCCTTTCTTCGG
TAGAAAATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCT
ACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAGGTAACTGGCTTCAGCAGAGCGCAGAT
ACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCG
CTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAG
TTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACAC
CGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGG
TAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTC
GGGTTTCGCCACCTCTGACTTGAGCATCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAG
CAACGCAGAAAGGCCCACCCGAAGGTGAGCCAGGTGATTACATTTGGGCCCTCATTACCAATGCTTAATCAGTGAGG
CACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGG
GAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAAT
AAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTT
GCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTG
TCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTT
GTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGG
TTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACC
AAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACA
TAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGA
GATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGA
GCAAAAACAGGAAGGCAAAATGCCGCAAAAAACGGAATAAGTGCGACACGGAAATGTTGAATACTCATTTTAGCTTC
CTTAGCTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAAC
CTCTTACGTGCCGATCAAGTCAAAAGCCTCCGGTCGGAGGCTTTTGACTTTCTGCTATGGAAGCGGATAACAATTTC
ACACAGGAAACAGCTATGACCATCGTCAGTATTGACTGCAGGCAGACGCGACATCGAATTCGCGTGTCGCCCTTATT
CGACTCGCCTGACATTTATATTCCCCAGAACATCAGGTTAATGGCGTTTTTGATGTCATTTTCGCGGTGGCTGAGAT
CAGCCACTTCTTCCCCGATAACGGAGACCGGCACACTGGCCATATCGGTGGTCATCATGCGCCAGCTTTCATCCCCG
ATATGCACCACCGGGTAAAGTTCACGGGAGACTTTATCTGACAGCAGACGTGCACTGGCCAGGGGGATCACCATCCG
TCGCCCGGGCGTGTCAATAATATCACTCTGTACATCCACAAACAGACGATAACGGCTCTCTCTTTTATAGGTGTAAA
CCCTAAACTGCATTTCACCAGCC(SEQ ID:4).
2) archaeal dna polymerase is used, by PCR with AAGGGCGAGACGCGAA (SEQ ID:1) as upstream and downstream primer, close
Become plasmid for template, amplify in a large number, produce linear front carrier；And linear front carrier is separated with agarose gel electrophoresiies, and
Cut glue purification；
3) by cut glue purification linear before add in carrier T4DNA polymerase 37 DEG C process linear before carrier two ends, make
Before linear, two 5` distal process of carrier go out, and dATP, the 5` end of the linear front carrier for cutting glue purification for projecting；While in reactant
DATP is added in system (concentration of the dATP in reaction system is 1mM) so that end at first A base of carrier sequence before linear
Only, and at 75 DEG C, heating 20min inactivates T4DNA polymerase, the linear front carrier that purification 5` distal process goes out.
4) nucleotide sequence (5`-3`) TTCGCGTGTCGCCCTTATTCCGATAGTG (SEQ ID is added:2) primer B
With nucleotide sequence (5`-3`) CAACACTATCGGAAT (SEQ ID:3) (the molecular weight sum of primer B and primer C is 5 to primer C
50 times of the linear front carrier molecular weight that ` distal process goes out, the concentration of primer B and primer C in reaction system is 10 μM), then plus
Enter 2M NaCl (volume of NaCl is the 1/10 of reaction system), fully mix；Cowpox topoisomerase I is eventually adding, and will be anti-
Natural cooling after answering system to be heated to 90 DEG C in water-bath, that is, obtain zero background carrier.
The carrier connection exogenous sequences of structure can reach zero background, it is to avoid occur in T4DNA ligase coupled reaction
Non- purpose connection, improves linear carrier and double-stranded adapters joint efficiency height, simplifies structure flow process so that carrier prepares letter
Single, vector construction long flow path is solved, carrier prepares the problem for wasting time and energy.
Presently preferred embodiments of the present invention is the foregoing is only, not in order to limit the present invention, all essences in the present invention
Within god and principle, any modification, equivalent substitution and improvement that is made etc., should be included within the scope of the present invention.
Claims (7)
1. a kind of zero background carrier construction method based on cowpox topoisomerase I, it is characterised in that comprise the following steps：
1) ccdB gene expression units are introduced on plasmid, obtains synthetic plasmid；
2) archaeal dna polymerase is used, and by PCR using primer A as upstream and downstream primer, the synthetic plasmid is template, to carry out in a large number
Amplification, produces linear front carrier；And the linear front carrier is separated with agarose gel electrophoresiies, and cut glue purification；
3) by step 2) obtain described cut glue purification linear before add T4DNA polymerase and dATP in carrier, prominent step
2) the linear front carrier 5` end for cutting glue purification for obtaining；
4) in step 3) add primer B, primer C and NaCl to be sufficiently mixed in the product that obtains, and in cowpox topoisomerase I
Cut and be connected, that is, obtain zero background carrier；
In the primer A, the nucleotide sequence of 5`-3` is AAGGGCGAGACGCGAA (SEQ ID:1)；5`-3` in the primer B
Nucleotide sequence is TTCGCGTGTCGCCCTTATTCCGATAGTG (SEQ ID:2)；In the primer C, the nucleotide sequence of 5`-3` is
CAACACTATCGGAAT(SEQ ID:3).
2. zero background carrier construction method as claimed in claim 1, it is characterised in that the ccdB gene expression units two ends
All there is one section of double-stranded sequence M；The double-stranded sequence M from 3 ' -5 ' front 16bp base do not contain adenine, the 17th is contained with the 18th
There are two adenine.
3. zero background carrier construction method as claimed in claim 2, it is characterised in that the double-stranded sequence M is
4. zero background carrier construction method as claimed in claim 1, it is characterised in that step 3) described in T4DNA polymerase
With dATP 35～40 DEG C process linear before carrier two ends；Concentration of the dATP in reaction system is 0.8～1.2mM.
5. zero background carrier construction method as claimed in claim 1, it is characterised in that step 3) and step 4) between also include
By step 3) product that obtains heats 15～25min at 70～80 DEG C.
6. zero background carrier construction method as claimed in claim 1, it is characterised in that step 4) described in the line that goes out of 5` distal process
Property before carrier molecular weight, with the total molecular weight ratio of the primer B and the primer C be：45～55；The primer B and described
Concentration of the primer C in reaction system is 0.8～1.2mM；The concentration of the NaCl is 1.5～2.5M, and volume is reactant
The 1/12～1/8 of system.
7. zero background carrier construction method as claimed in claim 1, it is characterised in that the cutting of the cowpox topoisomerase I
It is to be heated to natural cooling after 85～95 DEG C in water-bath to cut with condition of contact.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610855708.4A CN106434719A (en) | 2016-09-27 | 2016-09-27 | Method of constructing zero-background support based on vaccinia topoisomerase I |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610855708.4A CN106434719A (en) | 2016-09-27 | 2016-09-27 | Method of constructing zero-background support based on vaccinia topoisomerase I |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106434719A true CN106434719A (en) | 2017-02-22 |
Family
ID=58169690
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610855708.4A Pending CN106434719A (en) | 2016-09-27 | 2016-09-27 | Method of constructing zero-background support based on vaccinia topoisomerase I |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106434719A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998056943A1 (en) * | 1997-06-12 | 1998-12-17 | Sloan-Kettering Institute For Cancer Research | Covalent joining of dna strands to rna strands catalyzed by vaccinia topoisomerase |
| CN101659974A (en) * | 2009-08-07 | 2010-03-03 | 北京全式金生物技术有限公司 | Method for connecting DNA fragments by utilizing vaccinia virus DNA topoisomerase I |
-
2016
- 2016-09-27 CN CN201610855708.4A patent/CN106434719A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998056943A1 (en) * | 1997-06-12 | 1998-12-17 | Sloan-Kettering Institute For Cancer Research | Covalent joining of dna strands to rna strands catalyzed by vaccinia topoisomerase |
| CN101659974A (en) * | 2009-08-07 | 2010-03-03 | 北京全式金生物技术有限公司 | Method for connecting DNA fragments by utilizing vaccinia virus DNA topoisomerase I |
Non-Patent Citations (2)
| Title |
|---|
| ELIANE TROVATTI等: "Peptides based on CcdB protein as novel inhibitors of bacterial topoisomerases", 《BIOORGANIC & MEDICINAL CHEMISTRY LETTERS》 * |
| JOHN A. HEYMAN等: "Genome-scale cloning and expression of individual open reading frames using topoisomerase I-mediated ligation", 《GENOME RESEARCH》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6165789B2 (en) | Methods for in vitro linking and combinatorial assembly of nucleic acid molecules | |
| US20220195415A1 (en) | Nucleic Acid Constructs and Methods for Their Manufacture | |
| CN109136248B (en) | Multi-target editing vector and construction method and application thereof | |
| CN110358767B (en) | Zymomonas mobilis genome editing method based on CRISPR-Cas12a system and application thereof | |
| CN102321612A (en) | Industrialized gene synthesis method | |
| CN105400809A (en) | Cloning vector and preparation and application thereof | |
| CN101935670B (en) | Method for constructing RNA (Ribonucleic Acid) interference vector by directly annealing multi-primers | |
| EP1141239A1 (en) | Improved methods for insertion of nucleic acids into circular vectors | |
| US20230357790A1 (en) | Self-targeting expression vector | |
| CN103589743A (en) | Gibson assembly carrier, preparation method therefor and applications thereof | |
| Merritt et al. | Autonomous assembly of synthetic oligonucleotides built from an expanded DNA alphabet. Total synthesis of a gene encoding kanamycin resistance | |
| CN105602972A (en) | CRICPR-Cas9-based method for in-vitro modifying adenovirus vectors | |
| CN106434719A (en) | Method of constructing zero-background support based on vaccinia topoisomerase I | |
| CN101177697B (en) | Method for preparing nucleic acid molecular weight label | |
| CN102181430A (en) | Method for preparing target deoxyribonucleic acid (DNA) fragment with cohesive terminuses of restriction enzyme at both ends | |
| JP7010489B2 (en) | Method for processing double-stranded DNA ends | |
| CN103205449B (en) | Method for quickly cloning genes by using universal buffer liquid | |
| US9476079B2 (en) | Methods to mutate circular deoxyribonucleotides | |
| CN101805747B (en) | Repeated module gene-splicing method | |
| Stevenson et al. | Universal CG cloning of polymerase chain reaction products | |
| US9944966B2 (en) | Method for production of single-stranded macronucleotides | |
| CN104805072A (en) | Method for preparing DNA assembly products with viscous terminals based on PCR | |
| CN102899317A (en) | Method for quickly and efficiently increasing gene fragments on plasmid | |
| WO2022170705A1 (en) | Method for preparing long-chain rna modified at specific site | |
| Saito-Tarashima et al. | Cas9-mediated DNA cleavage guided by enzymatically prepared 4′-thio-modified RNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Cao Wengang Inventor before: Jiang Chao |
|
| CB03 | Change of inventor or designer information | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20190618 Address after: 100176 Beijing Daxing District Beijing Economic and Technological Development Zone No. 156 Courtyard Building 401 Jinghai Fourth Road Applicant after: Beijing Qingke Biotechnology Co., Ltd. Address before: No. 64 Litang Road, Beiqijiazhen, Changping District, Beijing, 100000 Applicant before: Beijing Xinye Qing Department of Biological Technology Co. Ltd. |
|
| TA01 | Transfer of patent application right | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170222 |
|
| RJ01 | Rejection of invention patent application after publication |