CN106434671B - Non-coding small RNA c263 of lactococcus lactis subspecies lactococcus lactis YF11 - Google Patents

Abstract

The invention discloses a non-coding small RNA c263 of lactococcus lactis subspecies lactococcus lactis YF11, a non-coding small RNA c263 of lactococcus lactis YF11, and a nucleotide sequence of the non-coding small RNA c263 is shown as SEQ ID NO.1 in a sequence table; the experimental results show that: after the non-coding small RNA c263 of the lactococcus lactis subspecies YF11 is overexpressed, the survival capacity of the lactococcus lactis containing c263 overexpression is obviously enhanced in an acidic environment, the survival rate of acidic fermentation liquor is improved, the stability of nisin is increased, and therefore the nisin yield is improved.

Description

Non-coding small RNA c263 of lactococcus lactis subspecies lactococcus lactis YF11

Technical Field

The invention relates to a small non-coding RNA (sRNA) of bacteria, in particular to a small non-coding RNA c263 of lactococcus lactis subspecies YF11, a vector containing the small non-coding RNAc263 of lactococcus lactis subspecies YF11, recombinant lactococcus lactis containing the vector and application.

Background

Small non-coding RNA (sRNA) of bacteria is a type of RNA regulator found in prokaryotes such as bacteria in recent years, does not encode protein, is usually located in an intergenic region, has a length of 50-500nt, and is widely involved in regulation of various in vivo vital activities. The bacterial sRNA is an important regulating factor for bacterial metabolism, virulence and environmental stress adaptation, plays an important role in gene expression regulation and control for environmental changes, has a function from structural regulation to catalytic action, influences various processing processes in organisms, and can regulate a large number of genes and have a profound influence on cell physiology by a single sRNA. sRNA exerts bioregulatory effects primarily through base pairing to target mRNA binding leading to changes in mRNA translation and stability. Most studies on bacterial sRNA have been focused on model organisms such as escherichia coli, and more than 150 sRNA species are found in all kinds of bacteria, and about 80 sRNA species are found in escherichia coli. However, as the research continues, more and more research has been directed to other bacteria.

Nisin (Nisin) is a natural small molecule polypeptide produced by Lactococcus lactis (Lactococcus lactis) and having bacteriostatic action on most gram-positive bacteria, and can also inhibit the growth of some gram-negative bacteria by combining with other bacteriostatic agents. Nisin is a biological preservative for food, is widely applied to preservation and fresh-keeping of dairy products, meat products, alcoholic beverages and the like, and has great potential to be applied to medicines, veterinary medicines and health-care products. However, the current nisin has high production cost, which hinders the development of nisin in the production application field.

Lactococcus lactis can produce lactic acid in the fermentation process, and the accumulation of lactic acid causes the pH of the fermentation liquid to drop, so that the growth of lactococcus lactis is stopped, and even the lactococcus lactis dies.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a small non-coding RNA c263 of lactococcus lactis subspecies lactococcus lactis YF 11.

The second purpose of the invention is to provide a carrier containing non-coding small RNA c263 of lactococcus lactis subsp.

The third object of the present invention is to provide a recombinant lactococcus lactis strain containing the above-mentioned vector.

The fourth purpose of the invention is to provide the application of the recombinant lactococcus lactis containing the vector in the fermentation production of nisin.

The technical scheme of the invention is summarized as follows:

the non-coding small RNAc263 of lactococcus lactis subspecies lactococcus lactis YF11, wherein the nucleotide sequence is shown as SEQ ID NO.1 in a sequence table; or a nucleotide sequence which has more than 90 percent of homology with the nucleotide sequence shown in the sequence table SEQ ID NO.1 and is related to acid resistance.

The nucleotide sequence of the carrier containing the non-coding small RNA c263 of lactococcus lactis subspecies YF11 is shown as SEQ ID NO.3 in the sequence table.

Recombinant lactococcus lactis comprising the vector.

The recombinant lactococcus lactis is applied to fermentation production of nisin.

The invention has the advantages that:

the experimental results show that: after the non-coding small RNA c263 of the lactococcus lactis subspecies YF11 is overexpressed, the survival capacity of the lactococcus lactis containing c263 overexpression is obviously enhanced in an acidic environment, the survival rate of acidic fermentation liquor is improved, the stability of nisin is increased, and therefore the nisin yield is improved.

Drawings

FIG. 1 is a physical map of a non-coding small RNA c263 deletion mutant vector pNZ5319- Δ c263 of lactococcus lactis subspecies lactococcus lactis YF 11.

FIG. 2 is a physical map of a non-coding small RNA c263 overexpression vector pLEB124-c263 of lactococcus lactis subspecies lactococcus lactis YF 11.

FIG. 3 is a graph of the biomass of the strain as a function of time.

FIG. 4 is a graph of nisin titer of strains over time.

FIG. 5 shows the survival rate of the strain after being stressed for 3h by tryptone aqueous solutions with different pH values.

In fig. 3-5:

lactococcus lactis subspecies lactococcus lactis YF11 is an original strain, and is marked as YF11 bacteria in the figure;

the lactococcus lactis subspecies lactococcus lactis YF11 control strain containing empty plasmid pLEB124 is schematically represented as YF11+ strain;

the recombinant lactococcus lactis (strain of the invention) strain containing the pLEB124 vector carrying the non-coding small RNA c263 of lactococcus lactis subspecies lactococcus lactis YF11 was named lactococcus lactis YF 11-c 263, and is depicted as c263 strain in the figure;

the small RNA c263 deletion strain of lactococcus lactis subspecies lactococcus lactis YF11 was named lactococcus lactis YF 11- Δ c263 and is graphically represented as Δ c263 strain.

Detailed Description

The present invention is further described with reference to the following specific examples, which are provided to enable those skilled in the art to better understand the present invention, but are not intended to limit the present invention in any way.

The Lactococcus lactis subsp. YF11 strain used in each example was deposited in China general microbiological culture Collection center (CGMCC) with a collection number of CGMCC NO.12429 and a storage time of 2015, 5 months and 10 days. The address is the microbiological research institute of the Chinese academy of sciences, No.3, Xilu No.1, Beijing, Chaoyang, Beijing.

The experimental methods used in the present invention are conventional methods unless otherwise specified.

The plasmids pLEB124 and PNZ5319 were purchased from Jinzhi Biotechnology, Inc., Suzhou.

Example 1

Obtaining of non-coding small RNA c263 (c 263 for short) sequence of lactococcus lactis subspecies lactococcus lactis YF11

1. Library construction and sequencing

Small RNA library: extracting total RNA of sample, recovering fragment (18-150nt) with gel cutting, and making into desired dosage form according to Illumina TruSeq^TMSmallRNA Sample Preparation protocol A small library was constructed and the final library was sequenced using Illumina HiSeq 2000.

Chain-specific library: rRNA of total RNA of the extracted sample is removed and then broken into short segments, mRNA is taken as a template to synthesize two cDNA chains in sequence, the second cDNA chain is modified properly, PCR amplification is carried out, and the built sequencing library is sequenced by IlluminaHiSeq 2000.

2. Data preprocessing and bioinformatics analysis

The raw data obtained by sequencing needs to be removed with impurity data: and (3) obtaining clean reads, wherein the ratio of reads containing the adaptor to N is more than 10 percent of reads and low-quality reads. Then performing splicing treatment on clean reads to obtain Full-length Tags, and comparing the Tags to genomes, genes, rRNA and tRNA to obtain comparison statistical information.

The expression level of the gene was calculated by the RPKM method (Reads Per Kb Per Million Reads) according to the following equation:

wherein, RPKM is the expression quantity of a certain gene, C is the number of reads which are uniquely compared to the gene, N is the total number of reads which are uniquely compared to a reference gene, and L is the number of bases of a coding region of the gene.

3. Preparation of samples and extraction of Total RNA

Taking out YF11 strain of lactococcus lactis subspecies lactococcus lactis preserved at-80 ℃, inoculating the strain into a seed culture medium, performing activation culture at 30 ℃ for three generations, then respectively transferring 10% of the inoculum size into fermentation culture media with pH 7.0 and pH5.0, continuing stress culture for 1h, centrifuging at 4 ℃ and 8000rpm for 5min, removing supernatant, collecting thalli, washing the thalli with sterile physiological saline for three times, and quickly freezing with liquid nitrogen. The cells were mechanically disrupted on ice using a cell disrupter (5 s sonication, 5s pause for 10min) and resuspended in trizol reagent and mixed well. Total RNA of the cells was extracted using ZR RNA MiniPrepTM, and the RNA samples were stored in RNase free water containing RNase inhibitor at-80 ℃. The procedure was performed according to the kit instructions. The concentration and purity of the extracted total RNA were checked and the qualified sample was used for subsequent cDNA synthesis.

Using the RevertAId First Strand cDNA Synthesis Kit, each reaction was added to a PCR tube according to the cDNA Synthesis system and centrifuged at 3000r/min for 30 s. Procedure for cDNA synthesis: incubation is carried out at 25 ℃ for 5min, water bath at 42 ℃ for 60min for cDNA synthesis reaction, and heating is carried out at 70 ℃ for 5min to terminate the reaction. The cDNA samples were assayed for concentration and purity and stored at-20 ℃ until use.

Table 1: synthesis of cDNA system composition:

the formula of the lactococcus lactis seed culture medium comprises the following components: yeast powder 15g, peptone 15g, KH₂PO₄20g, sucrose 15g, NaCl 1.5g, MgSO₄·7H₂0.15g of O, adding water to 1L, adjusting the pH value to 7.2, and sterilizing 15g of agar powder (solid culture medium) by high-temperature steam at 121 ℃ for 20 min;

the fermentation medium of lactococcus lactis comprises 15g of yeast powder, 15g of peptone and KH₂PO₄2 percent of cane sugar, 2 percent of corn steep liquor, 3g of cysteine, 2.6g of NaCl, 1.5g of MgSO₄·7H₂0.15g of O, adding water to 1L, adjusting the pH value to 7.2, and sterilizing with high-temperature steam at 121 ℃ for 20 min.

4. Real-time fluorescent quantitative PCR verification

The obtained cDNA was subjected to the following procedures (480 SYBR Green I Master) to a certain concentration, adding the template into a centrifuge tube according to an RT-PCR reaction system, transferring the sample to a 96-well plate, setting 3 parallel plates, adding other reactants, performing the above operation steps on ice, and verifying the primer design as shown in Table 2. After brief centrifugation at 3000r/min, RT-PCR reactions were performed. The RT-PCR reaction program is as follows: pre-denaturation at 95 ℃ for 10 min; denaturation at 95 ℃ for 10s, renaturation at 50 ℃ for 10s, and extension at 72 ℃ for 1min for 55 cycles; extending for 5min at 72 ℃; melting curve 65 ℃ onset 1min, 95 ℃ termination.

RT-PCR reaction system:

TABLE 2

The primer sequences are as follows:

description of the drawings: amplifying to obtain a 16S RNA target fragment by using SEQ ID NO.4 and SEQ ID NO.5 and combining other components in the table 2;

the target fragment of c263 is obtained by combining the other components in the table 2 with SEQ ID NO.6 and SEQ ID NO.7 and amplifying.

5. Prediction and determination of small RNAs

For the small RNA library, according to the alignment information, after filtering, obtaining All-units aligned to the intergenic regions IGR (intergenic region) and AM (antisense to mRNA) type, and the All-units with the total expression amount more than 20 are listed as candidate sRNA, and the sRNA is listed as candidate sRNA which is non-coding small RNA c263 of lactococcus lactis YF11, and the nucleotide sequence of the sRNA is shown as SEQ ID NO. 1.

For the strand-specific library, gene models (TARs) with a length of 100bp or more and an average coverage depth of 2 or more were selected, and new transcripts located in the intergenic region (between 100bp downstream of the 3 'end of one gene and 100bp upstream of the 5' end of the next gene) were found from the selected gene models, and these transcripts were not aligned with the protein pool (NR) and were used as candidate sRNAs.

For the candidate small RNA, in order to verify the predicted change of the expression level of the candidate sRNA after 1h of acid stress in the fermentation medium, a 2- Δ Δ Cp method, which is a relative quantification method for detecting the target sRNA relative to the reference gene 16S rRNA, was used. The specific calculation method is as follows:

Δ Cp ═ Cp (gene of interest) -Cp (reference gene)

Δ Δ Cp ═ Δ Cp (experimental group) - Δ Cp (control group)

Relative multiple (experimental/control) 2^-ΔΔCpThe control group was set at pH 7.0, the relative transcription level was set to 1, and the other conditions were set as the experimental group. The experiment was repeated 3 times and the average was calculated.

To verify the relative expression difference of the candidate sRNA obtained by deep sequencing under acid stress, the change of the expression level of the sRNA gene after acid stress treatment was detected by a qRT-PCR method, 2 was used^-ΔΔCtAssay of acid-tolerant related sRNA at pH5.0 (Experimental group)) And differential expression under stress at pH 7.0 (control). sRNA with the expression quantity obviously up-regulated under acidic stress is screened from the fluorescent quantitative RCR result.

The sRNA upregulation was verified by fluorescent quantitative PCR as shown in table 3:

TABLE 3

ID Length Log2 Ratio(pH5/pH7)(RNA-Seq)Log2 Ratio(pH5/pH7)(qRT-PCR)

c263 356 2.336 1.143

Functional analysis of example 2, c263

To analyze the role of c263 in the survival and tolerance of lactococcus lactis, c263 overexpression strains and deletion strains were constructed and relevant detection experiments were performed.

1. construction and verification of c263 overexpression strain and deletion strain

And (3) taking the genome of lactococcus lactis YF11 as a template, and designing primers sRNA-F and sRNA-R according to the nucleotide sequence of c263 to perform PCR1 amplification. The amplified product was purified by agarose gel electrophoresis, recovered with a DNA purification recovery kit, digested with BamHI and HindIII, and ligated with T4DNA ligase with plasmid pLEB 124. The ligation products were transformed into TG1 E.coli competent cells and the transformation products were plated on LB plates resistant to erythromycin (150 ug/ml). PCR2 reaction verification is carried out on colonies on the plate by using a primer General-sRNA-F, General-sRNA-R, a 567bp fragment amplified is considered as a positive clone, the positive colony is cultured in an LB liquid culture medium overnight, and plasmids are extracted and sequenced. The plasmid with the correct result is an overexpression vector (a vector containing non-coding small RNA c263 of lactococcus lactis subsp. lactis YF 11), and is named as pLEB124-c263, and the nucleotide sequence of the vector is shown in SEQ ID NO. 3. Electrically transferring the over-expression vector pLEB124-c263 into lactococcus lactis YF11 competent cells, coating a seed culture medium plate containing erythromycin (20ug/ml) resistance, culturing for 36 hours at 30 ℃, and performing PCR3 by using a primer General-sRNA-F, General-sRNA-R to screen a positive clone transformant, namely a lactococcus lactis over-expression strain, namely the recombinant lactococcus lactis strain containing the pLEB124 vector carrying the non-coding small RNA c263 of the lactococcus lactis YF11 is named lactococcus lactis YF 11-c 263, namely YF 11-c 263 and marked as c263 bacteria in a diagram;

amplifying c263 upstream genes by using c263-up-F and c263-up-R, performing double enzyme digestion by using PmeI and XhoI overnight after cutting and recovering the gel, and purifying and recovering for later use; c263-down-F and c263-down-R are used for amplifying c263 downstream genes, after gel cutting and recovery, PvuI and BglII are used for double enzyme digestion overnight, and purification and recovery are carried out for later use; carrying out double enzyme digestion on the plasmid PNZ5319 by PvuI and BglII overnight, purifying and recovering, connecting with downstream genes at 22 ℃ for 3h, transforming escherichia coli TG1, and then verifying positive cloning by colony pcr; and (3) carrying out overnight culture on positive clones, carrying out double enzyme digestion on the positive clones overnight by using PmeI and XhoI, purifying and recovering the positive clones, connecting the positive clones with an upstream gene at 22 ℃ for 3 hours, transforming Escherichia coli TG1, and then verifying the positive clones by a colony pcr. The plasmid vector pNZ 5319-delta c263 is extracted, and the nucleotide sequence is shown in SEQ ID NO. 2. The pNZ 5319-delta c263 is transferred into the lactococcus lactis, and a positive clone transformant obtained by screening is the lactococcus lactis deletion strain which is named lactococcus lactis subspecies YF 11-delta c263 and marked as delta c263 bacteria in the figure.

(1) Primer sequences

sRNA-F：CCCAAGCTTAAGTAAGATGATA ACCATTGGGT(SEQ ID NO.8)

sRNA-R：CGCGGATCCAAGCCCATTTTTA ATAGAATGAG(SEQ ID NO.9)

General-sRNA-F：ATTACTGAAGGGAACCTAGAATAGT(SEQ ID NO.10)

General-sRNA-R：CGACCTGAGGTAATTATAACCC(SEQ ID NO.11)

c263-up-F：CCGCTCGAG AAATCTTGATATGGATAACCGAT(SEQ ID NO.12)

c263-up-R：AGCTTTGTTTAAACGAAAGACCCAATGGTTATCATC(SEQ ID NO.13)

c263-down-F：ATCGATCG CTCATTCTATTAAAAATGGGCTT(SEQ ID NO.14)

c263-down-R：GAAGATCT AAAAAATTGGAAAAAAGTTTAGC(SEQ ID NO.15)

(2) PCR reaction system

PCR1 reaction System:

PCR1 reaction conditions: pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 20s, renaturation at Tm-5 ℃ for 20s, and extension at 72 ℃ for 20s for 35 cycles; extension at 72 ℃ for 5 min. Overlap extension PCR reaction procedure: pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 20s, Tm +5 ℃ for 20s (temperature drop of 0.5 ℃ per cycle until Tm-5 ℃), extension at 72 ℃ for 20s, and 20 cycles; pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 20s, renaturation at Tm-5 ℃ for 20s, extension at 72 ℃ for 20s, and 15 cycles; extension at 72 ℃ for 5 min.

PCR2 and PCR3 reaction system:

PCR2PCR3 reaction conditions: pre-denaturation at 97 deg.C for 7 min; denaturation at 94 ℃ for 30s, renaturation at 55 ℃ for 30s, and extension at 72 ℃ for 1min for 30 cycles; extension at 72 ℃ for 5 min.

2. Viability of different L.lactis after stress in tryptone aqueous solutions of different pH was analyzed.

The growth of the bacteria can be seriously influenced by the reduction of the pH value of the fermentation liquor of the lactococcus lactis at the later stage of fermentation. In order to research the viability of the small RNA molecules under acidic stress, tryptone aqueous solution is used as a stress medium, and the survival rate is calculated by dilution and coating after the stress for 3 hours.

The strains used were: YF11 strain, YF11+ strain, YF 11-c 263 strain and YF 11- Δ c263 strain

The method comprises the following steps:

respectively inoculating YF11 bacteria, YF11+ bacteria, YF 11-c 263 bacteria and YF 11-deltac 263 bacteria into a seed culture medium, and performing static culture at 30 ℃. After the third generation, 6mL of the late logarithmic growth phase (about 8h) is taken, 8000r/min is centrifuged at 4 ℃ for 10min, and the supernatant is discarded to collect the thalli. Suspending the thallus with equal volume of physiological saline, centrifuging at 8000r/min at 4 deg.C for 10min, discarding the supernatant, collecting thallus, and repeating the washing step once again. Suspending the cells in 3mL of physiological saline, and inoculating 500. mu.L of each cell suspension to 8mL of tryptone aqueous medium (tryptone aqueous medium: 2%, sodium chloride (NaCl)) with different pH gradients, adjusting the pH values to 7.0, 5.0, 40, 3.0, 2.0, 121 ℃ high-temperature steam sterilization for 20min), standing and stressing for 3h at 30 ℃. The cell culture medium was diluted to 10 with physiological saline at pH 7.0, pH5.0, and pH4.0^-7The cell culture medium at pH3.0 and pH2.0 was diluted to 10 with physiological saline^-6. 100. mu.L of each sample was applied to a seed medium plate of pH 7.2 and cultured in an inverted state at 30 ℃. Counting the number of colonies on each plate, and averaging the three parallel samples; the colony numbers under the conditions of pH5.0, pH4.0, pH3.0 and pH2.0 are divided by the colony number under the condition of pH 7.0 respectively to calculate the survival rate of the serial pH gradient tryptone water culture medium after being stressed for 3 hours; the survival rates of the strains of the experimental group and the control group under the same pH condition are then used as ratios to measure the change of the acid resistance of the lactococcus lactis subspecies YF 11-c 263.

The detection results are shown in FIG. 5, and it can be seen that the survival rate of the over-expressed strain lactococcus lactis YF 11-c 263 after acid stress is higher than that of the control group, indicating that the over-expressed sRNA gene is helpful for the survival of the strain at low pH.

3. c263 determination of the growth status of overexpressing strains

To examine the effect of small RNA c263 on the viability of the bacteria, a fermentation experiment was performed: YF11 bacteria, YF11+ bacteria, YF 11-c 263 bacteria and YF 11-deltac 263 bacteria stored at the temperature of 20 ℃ below zero are taken out, activated for 3 generations, and then inoculated into a fermentation medium (lactococcus lactis fermentation medium (g/L): yeast extract 15, peptone 15, monopotassium phosphate 20, sucrose 20, corn steep liquor 3, cysteine 2.6, iodine-free refined salt 1.5, MgSO 4.7H 2O 0.15.15, pH 7.2) according to the inoculation amount of 5 percent, kept at the constant temperature of 30 ℃ for static culture, fermentation liquor samples are taken every 2 hours, and centrifuged for 5min at 8000r/min to separate thalli. Resuspending the strain in an equal volume of physiological saline, and then diluting the suspension to determine OD₆₀₀Value, using physiological saline as control, to ensure OD₆₀₀The measured values are in the linear range between 0.3 and 0.7, and the biomass of the fermentation broth is plotted against time as shown in FIG. 3. It can be seen that the strain of the overexpression lactococcus lactis YF 11-c 263 has higher strain quantity and better growth condition than the empty plasmid control group in the same period compared with the empty plasmid control group. The small RNA molecules are presumed to be associated with the viability of the cells.

Nisin potency assay

YF11 bacteria, YF11+ bacteria, YF 11-c 263 bacteria and YF 11-deltac 263 bacteria which are stored at the temperature of 20 ℃ below zero are taken out, activated for 3 generations and then inoculated into a fermentation medium according to the inoculum size of 5 percent, the mixture is kept stand and cultured at the constant temperature of 30 ℃, 500 mu L of fermentation liquid samples of the four bacteria are respectively taken every 2 hours and mixed with 500 mu L of sterile HCl solution (0.02mol/L) evenly, then the mixture is boiled for 5min, and then the mixture is centrifuged for 5min at 8000 r/min. The supernatant was diluted with sterile HCl (0.02mol/L) to prepare samples of these four bacteria at different time points.

Taking out the slant of sarcina lutea (Micrococcus flavus ATCC 10240, purchased from Shanghai research and practice Co., Ltd at 6-17 days 2012) stored at 4 ℃, washing off lawn with 2mL of sterile physiological saline, collecting the obtained bacterial suspension in a sterile centrifuge tube, taking 100 μ L of bacterial suspension, and uniformly mixing in 6mL of sterile physiological saline. Heating and melting nisin titer culture medium (26mL), cooling to about 70 ℃, adding 1.5% Tween-20 (390 mu L), cooling to about 50 ℃, adding the bacterial suspension, quickly shaking up, and pouring into a 9mm sterile culture dish. After it had solidified, 8 wells (6 of which were added with the sample and 2 of which were added with the nisin standard) were punched evenly on the plate with a sterilized punch with a diameter of 7 mm. 8mgnisin standard substance is weighed and dissolved in 8mL sterile HCl solution (0.02mol/L) to prepare 10000IU/mL standard solution, and then the standard solution is diluted to prepare 2000IU/mL, 1000IU/mL, 200IU/mL, 100IU/mL, 50IU/mL and 25IU/mL series nisin standard solution. Three samples are arranged in parallel, 100 mu L of sample or standard solution is added into each hole, samples obtained by four strains at the same time point are distributed on the same flat plate as much as possible when the samples are added, and the samples are cultured for 24 hours at the constant temperature of 37 ℃. The diameter of the inhibition zone is measured by a vernier caliper, and a standard curve is drawn by taking the average value of the diameter as the abscissa and the logarithm value of the nisin titer as the ordinate. And substituting the diameter value of the inhibition zone of the sample into a standard equation to calculate the nisin titer of the sample.

From FIG. 4 it can be seen that c263 over-expression increases nisin production, while the yield decreases after knock-out, indicating that c263 is related to nisin production.

SEQUENCE LISTING

<110> Tianjin university

<120> non-coding small RNA c263 of lactococcus lactis subspecies lactococcus lactis YF11

<130>

<160> 15

<170> PatentIn version 3.3

<210> 1

<211> 356

<212> RNA

<213> Lactococcus lactis subsp.lactis

<400> 1

aaaguaucaa uaaaaaguuc ccaaguugaa guuuuuuucu uuucuuucaa uucauugaaa 60

ccaucuuuag cuugacgauu uucaacuucu uuugggcuca aaccuucgaa uugacuuuua 120

guuuccucua aaacuucauu gacggauuga uuguaaggcu gcauaaugau ucuccuuuau 180

uucuaacuga uaucaugaga gguuuuacaa aaaaagaccu cugccagaua ucaaaacugg 240

caaaggucuu gcuaaacaua cauaaguaug ucaacaaagc cggugagaau cucacgaauu 300

gacgacuuug uuucggucuu accgacgcua cuccccuuug gaauauuuaa guuacc 356

<210> 2

<211> 5762

<212> DNA

<213> Artificial Synthesis

<400> 2

atgaacttta ataaaattga tttagacaat tggaagagaa aagagatatt taatcattat 60

ttgaaccaac aaacgacttt tagtataacc acagaaattg atattagtgt tttataccga 120

aacataaaac aagaaggata taaattttac cctgcattta ttttcttagt gacaagggtg 180

ataaactcaa atacagcttt tagaactggt tacaatagcg acggagagtt aggttattgg 240

gataagttag agccacttta tacaattttt gatggtgtat ctaaaacatt ctctggtatt 300

tggactcctg taaagaatga cttcaaagag ttttatgatt tatacctttc tgatgtagag 360

aaatataatg gttcggggaa attgtttccc aaaacaccta tacctgaaaa tgctttttct 420

ctttctatta ttccatggac ttcatttact gggtttaact taaatatcaa taataatagt 480

aattaccttc tacccattat tacagcagga aaattcatta ataaaggtaa ttcaatatat 540

ttaccgctat ctttacaggt acatcattct gtttgtgatg gttatcatgc aggattgttt 600

atgaactcta ttcaggaatt gtcagatagg cctaatgact ggcttttata atatgagata 660

atgccgactg tactttcgga tcctaaacgc aattgatgat tggttcggaa ggcacgttag 720

gaatcattac cgaagtaatc gttaaactgt tgccgattcc gctagggacc cataacttcg 780

tataatgtat gctatacgaa cggtacagcc cgggcatgag ctccgatctc attctattaa 840

aaatgggctt ttttgtcaag ttattttctt attttttaaa tacaaatcta tgattatgat 900

tgatttctaa taaatttaat agcttctcga ttctgttctt ttaaatcaat cccttgtgct 960

ttagccgcaa aaatacatcc acaataacat tgacgataaa catcgtattc tttacacatc 1020

tctactgaac gtttataacc attattcttc ttaaaatcac ttggaagata attcacatca 1080

taaatctttt gaatatcaag accaatttca ttaattaatt ggctattctt ctttggtgat 1140

aaagtcaaag cactaccaaa ataatcaaaa ccaagttcta aagccttctc agcaactata 1200

tccaatcgca tttcaaaaca agaggtgcaa cgtttcccac cctcaggttc attttctaaa 1260

tgtttttgac gaaccatttg taaaaagaca tttggttcat attcggcagc aataaattga 1320

acattatttc ctgtccgttc attaaaatct tttacaaatt gttcttgaac catttttctt 1380

cttgtatatt cagttgacgg atgaatattt gaattagcaa aataaatcgt cacatcggct 1440

gattgcgtaa ggtattctaa tgaataagta ctacaagggg cacaacaaga atgaagcaaa 1500

attttgggac gaacagaatc tctttcccaa ctttcacgaa ctttttgaaa aacacgatca 1560

taatttattt tttgattagg attcattttt tcaatgatat ttaaactatt ttccatcatt 1620

atatccttaa attctctcta tttctgtcaa ttattatatc acattttgaa ataaaaaatg 1680

acctctttca agaggtcact attggttatt atatctgtta aatcaaattc ttggaaattt 1740

gaaaaatcta agagatattg gataagataa ttctacccat tttcgagttc gctttcaata 1800

ccatttattg gtaacttttg ttaatcacaa aaatatctac tcactaaaag aactattttt 1860

tcttcttctc gctaaacttt tttgatctct aaagctgacg gggtaaacta tataaaatcc 1920

aaataaattt ctaaaaataa aaaagtctgt cgatgaacag acttttttat tatagtttaa 1980

agcaaacttt taaatataat aaaaagagtt agttgaaatt ttctactaac tcttttttat 2040

ttttagtttt taactgcaga agcaaattct tctttagcaa aagcttcatc gatgatagct 2100

ttcaattgag cgtgtaactt tccaaattta caaaagcgac tcatagaatt atttcctccc 2160

gttaaataat agataactat taaaaataga caatacttgc tcataagtaa cggtacttaa 2220

attgtttact ttggcgtgtt tcattgcttg atgaaactga tttttagtaa acagttgacg 2280

atattctcga ttgacccatt ttgaaacaaa gtacgtatat agcttccaat atttatctgg 2340

aacatctgtg gtatggcggg taagttttat taagacactg tttacttttg gtttaggatg 2400

aaagcattcc gctggcagct taagcaattg ctgaatcgag acttgagtgt gcaagagcaa 2460

ccctagtgtt cggtgaatat ccaaggtacg cttgtagaat ccttcttcaa caatcagata 2520

gatgtcagac gcatggcttt caaaaaccac ttttttaata atttgtgtgc ttaaatggta 2580

aggaatactc ccaacaattt tatacctctg tttgttaggg aattgaaact gtagaatatc 2640

ttggtgaatt aaagtgacac gagtattcag ttttaatttt tctgacgata agttgaatag 2700

atgactgtct aattcaatag acgttacctg tttacttatt ttagccagtt tcgtcgttaa 2760

atgcccttta cctgttccaa tttcgtaaac ggtatcggtt tcttttaaat tcaattgttt 2820

tattatttgg ttgagtactt tttcactcgt taaaaagttt tgagaatatt ttatattttt 2880

gttcatgtaa tcactccttc ttaattacaa atttttagca tctaatttaa cttcaattcc 2940

tattatacaa aattttaaga tactgcacta tcaacacact cttaagtttg cttctaagtc 3000

ttatttccat aacttctttt acgtttccgc cattctttgc tgtttcgatt tttatgatat 3060

ggtgcaagtc agcacgaaca cgaaccgtct tatctcccat tatatctttt tttgcactga 3120

ttggtgtatc atttcgtttt tcttttgcgg acctgcagat gcgatatcat gcgcatgcaa 3180

gcttatcgat gataagctgt caaacatgag aattacaact tatatcgtat ggggctgact 3240

tcaggtgcta catttgaaga gataaattgc actgaaatct agaaatattt tatctgatta 3300

ataagatgat cttcttgaga tcgttttggt ctgcgcgtaa tctcttgctc tgaaaacgaa 3360

aaaaccgcct tgcagggcgg tttttcgaag gttctctgag ctaccaactc tttgaaccga 3420

ggtaactggc ttggaggagc gcagtcacca aaacttgtcc tttcagttta gccttaaccg 3480

gcgcatgact tcaagactaa ctcctctaaa tcaattacca gtggctgctg ccagtggtgc 3540

ttttgcatgt ctttccgggt tggactcaag acgatagtta ccggataagg cgcagcggtc 3600

ggactgaacg gggggttcgt gcatacagtc cagcttggag cgaactgcct acccggaact 3660

gagtgtcagg cgtggaatga gacaaacgcg gccataacag cggaatgaca ccggtaaacc 3720

gaaaggcagg aacaggagag cgcacgaggg agccgccagg gggaaacgcc tggtatcttt 3780

atagtcctgt cgggtttcgc caccactgat ttgagcgtca gatttcgtga tgcttgtcag 3840

gggggcggag cctatggaaa aacggctttg ccgcggccct ctcacttccc tgttaagtat 3900

cttcctggca tcttccagga aatctccgcc ccgttcgtaa gccatttccg ctcgccgcag 3960

tcgaacgacc gagcgtagcg agtcagtgag cgaggaagcg gaatatatcc tgtatcacat 4020

attctgctga cgcaccggtg cagccttttt tctcctgcca catgaagcac ttcactgaca 4080

ccctcatcag tgccaacata gtaagccagt atacactccg ctagcgctga tgtccggcgg 4140

tgcttttgcc gttacgcacc accccgtcag tagctgaaca ggagggacag cgtgttgctt 4200

tgattgatag ccaaaaagca gcagttgata aagcaattac tgatattgct gaaaaattgt 4260

aatttataaa taaaaatcac cttttagagg tggttttttt atttataaat tattcgtttg 4320

atttcgcttt cgatagaaca atcaaagcga gaataaggaa gataaatccc ataagggcgg 4380

gagcagaatg tccgagacta atgtaaattt gtccaccaat taaaggaccg ataacgcgct 4440

cgagcaaatc ttgatatgga taaccgattt tatcactgta agcaattaaa gccacttcag 4500

tagggtcacc aagtagctga ccttcttgtg aaaatgatga atcattacaa agcaccattg 4560

cattaagtaa caatttttgg tctgcctgtg ttaaatctgt cagttcttta ctgccttgcg 4620

ttggcaagaa agaatcaaca acggtcattt tgttttgcgt caaagttccg gttttgtcag 4680

tacaaatgac tgaagttgaa cccaatgttt ctacagctgg caaattacgc ataatcgcat 4740

gctgttttgc cattttattt gttccaacag ataaaacaat tgtaacaaca gatgaaagag 4800

cttcaggaat tgcagcaacc gcaaccgcaa ctgcaaacat gaatgaatca agaacagcct 4860

tttgcatatc agccgtttga tttgtcgtaa agagtctcag aatttgaaca gcaaaaatta 4920

aagcacagag cgctaaaatt gcccaaccta attgtttccc aaatttttcc aatttttgtt 4980

gaagtggcgt ttgtttagct tccgcagttt ccaacatttg agcaatttta ccaatctcgg 5040

tttgctcagc aattgctgtt acaagaaaat ctgctcgtcc ataaacaaca agacttgaac 5100

tgaagaccat attcttgcgg tcaccaagtg caacttctcc ctcaatgaca tccgaaaatt 5160

tttcaactgg ttcagactca cctgtcagca ttccttcttc gacacgtaag ttttgaacat 5220

caattaaacg tccatctgct ggaataaaat caccggcctc aagtgaaaca atatcgccaa 5280

caacaagctc acgcgcagga attgatgttt tctctccatt acgtaaaact ttagctgagg 5340

gtgccgacat ctgtctcaaa gcatctaaag aactttctgc tcgtttagtt tgcacgaccg 5400

caaccactga attaatcatc aaaacaatga aaataacaag tgattcaaca aattccccca 5460

agaaaagttg gacaaaagca actaaaagta agatgataac cattgggtct ttcttaaaca 5520

atttaaatct accgttcgta taatgtatgc tatacgaagt tatgacaatg tcttaggcgt 5580

taaggtcgtt ttagccgatg gtcgcgaagt taagtaaggt accatgcagt ttaaattcgg 5640

tcctcgggat atgataagaa tggcttaata aagcggttac tttggatttt tgtgagcttg 5700

gactagaaaa aaacttcaca aaatgctata ctaggtagat aaaaatttag gaggcatatc 5760

aa 5762

<210> 3

<211> 4938

<212> DNA

<213> Artificial Synthesis

<400> 3

gaccggaaat atttacaaaa atcaatttaa caattcctta aaacatgcag gaattgacga 60

tttaaacaat attagctttg aacaattctt atctcttttc aatagctata aattatttaa 120

taagtaagtt aagggatgca taaactgcat cccttaactt gtttttcgtg tgcctatttt 180

ttgtgaatcg gattcacaga tgtctgcctg ttcatccgcg tccagctcgt tgagtttctc 240

cagaagcgtt aatgtctggc ttctgataaa gcgggccatg ttaagggcgg ttttttcctg 300

tttggtcact gatgcctccg tgtaaggggg atttctgttc atgggggtaa tgataccgat 360

gaaacgagag aggatgctca cgatacgggt tactgatgat gaacatgccc ggttactgga 420

acgttgtgag ggtaaacaac tggcggtatg gatgcggcgg gaccagagaa aaatcactca 480

gggtcaatgc cagcgcttcg ttaatacaga tgtaggtgtt ccacagggta gccagcagca 540

tcctgcgatg cagatccgga acataatggt gcagggcgct gacttccgcg tttccagact 600

ttacgaaaca cggaaaccga agaccattca tgttgttgct caggtcgcag acgttttgca 660

gcagcagtcg cttcacgttc gctcgcgtat cggtgattca ttctgctaac cagtaaggca 720

accccgccag cctagccggg tcctcaacga caggagcacg atcatgcgca cccgtggcca 780

ggacccaacg ctgcccgaaa ttctgcagga attcgaatgg ccatgggacg tcgacctgag 840

gtaattataa cccgggccct atatatggat ccaaagtatc aataaaaagt tcccaagttg 900

aagttttttt cttttctttc aattcattga aaccatcttt agcttgacga ttttcaactt 960

cttttgggct caaaccttcg aattgacttt tagtttcctc taaaacttca ttgacggatt 1020

gattgtaagg ctgcataatg attctccttt atttctaact gatatcatga gaggttttac 1080

aaaaaaagac ctctgccaga tatcaaaact ggcaaaggtc ttgctaaaca tacataagta 1140

tgtcaacaaa gccggtgaga atctcacgaa ttgacgactt tgtttcggtc ttaccgacgc 1200

tactcccctt tggaatattt aagttaccaa gcttacttaa gttaattttt ttcactattc 1260

taggttccct tcagtaatac gtttcaaacc catctctttt aggttcgaaa gccatgtgat 1320

ttcacatcgc tttttgccca atgcaaaaat acctcttata acatctctct tcttgaatta 1380

tattttttca atatgatcat tgtataagtt cttcttactc gtaccttatt ttatcaaatt 1440

tgacagaatt ttgatagaat agtagtaata aatttttgta agcggttttt acataatgaa 1500

atatttaact tttatcatgt aaatcaattt tgggggaaaa tttttatgaa tcatattcca 1560

gtttttggcg aaaagaatga aggaaaagac tatcaagcaa gatatggcgt ctactcaatt 1620

gtagcaagag agaacaaaga aatttgcctt gttcaagccc ctaacggaat tccaaatctt 1680

taaaatgccc cttaaaattc aaaataaagg catttaaaat ttaaatattt cttgtgataa 1740

agtttgttaa aaaggagtgg ttttatgact gttatgtggt tatcgataga tctgcgcgcg 1800

atcgatatca gcgctttaaa tttgcgcatg ctagctatag ttctagaggt accggttgtt 1860

aacgttagcc ggctacgtat actccggaat attaataggc ctaggatgca tatggcggcc 1920

gcctgcagca actcttcgta agtcatcttg cccaacgtga atttttctag tgctatatat 1980

gttttctccg ctgaggtatt cattctatta tgacattcat tcactaactc attttcattt 2040

gttattggct catgtatatg ttcttttttt cgaaatgctt cataatatct tataccaaat 2100

attctctggg acatcgcatt gatgtgaatt aattcgatca ttttgtttat tgcaatcgta 2160

ttgctattaa tcgcaacatc aaaccaaaat aaaagccccc ttcgactttc gtcagggggg 2220

cttttattta ttcaataatc cctcctctca ataaatctat tgttgtactt aattcaactt 2280

ccatttctct gtatctttca atacgctctt ttaagtcctt aatttctttt tttaattcct 2340

cattttcagc aaataactct ttttctttgt ttgtcatttt atttcccccg tttcagcatc 2400

aagaaccttt gcataacttg ctctatatcc acactgataa ttgccctcaa accataatct 2460

aaaggcgcta gagtttgttg aaacaatatc ttttacatca ttcgtattta aaattccaaa 2520

ctccgctccc ctaaggcgaa taaaagccat taaatctttt gtatttacca aattatagtc 2580

atccactata tctaaaagta aattcttcaa ttctcttttt tggctttcat caagtgttat 2640

atagcggtca atatcaaaat cattaatgtt caaaatatct tttttgtcgt atatatgttt 2700

attcttagca atagcgtcct ttgattcatg agtcaaatat tcatatgaac ctttgatata 2760

atcaagtatc tcaacatgag caactgaact attccccaat tttcgcttaa tcttgttcct 2820

aacgctttct attgttacag gatttcgtgc aatatatata acgtgatagt gtggtttttt 2880

atagtgcttt ccatttcgta taacatcact actattccat gtatctttat cttttttttc 2940

gtccatatcg tgtaaaggac tgacagccat agatacgccc aaactctcta atttttcttt 3000

ccaatcatta ggaattgagt caggatataa taaaaatcca aaatttctag ctttagtatt 3060

tttaatagcc atgatataat taccttgtca aaaacaagta gcgaaaactc gtatccttct 3120

aaaaacgcga gctttcgctt attttttttg ttctgattcc tttcttgcat attcttctat 3180

agctaacgcc gcaaccgcag attttgaaaa acctttttgt ttcgccatat ctgttaattt 3240

tttatcttgc tcttttgtca gagaaatcat aactcttttt ttcgattctg aaatcaccat 3300

ttaaaaaact ccaatcaaat aattttataa aattagtgta tcactttgta atcataaaaa 3360

caacaataaa gctacttaaa tatagattta taaaaaacgt tggcgaaaac gttggcgatt 3420

cgttggcgat tgaaaaaccc ctcaaaccct tgagccagtt gggatagagc gtttttggca 3480

caaaaattgg cactcggcac ttaatggggg gtcgtagtac ggaagcaaaa ttcgcttcct 3540

ttccccccca tttttttcca aattccaaat ttttttcaaa aattttccag cgctaccgct 3600

cggcaaaatt gcaagcaatt tttaaaatca aacccatgag ggaatttcat tccctcaaac 3660

tcccttgagc ctcctccaac cgaaatagaa ggacgctgcg cttattattt cattcagtca 3720

tcggctttca taatctaaca gacaacatct tcgctgcaaa gccacgctac gctcaagggc 3780

ttttacgcta cgataacgcc tgttttaacg attatgccga taactaaacg aaataaacgc 3840

taaaacgtct cagaaacgat tttgagacgt tttaataaaa aatcgtgcgg taaagctcat 3900

cagcgtggtc gtgaagcagc ttatcggata ataaatatat ataaacgtat atagatttca 3960

taaagtctaa cacactagac ttatttactt cgtaattaag tcgttaaacc gtgtgctcta 4020

cgaccaaaac tataaaacct ttaagaactt tcttttttta caagaaaaaa gaaattagat 4080

aaatctctca tatcttttat tcaataatcg catccgattg cagtataaat ttaacgatca 4140

ctcatcatgt tcatatttat cagagctcgt gctataatta tactaatttt ataaggagga 4200

aaaaatatgg gcatttttag tatttttgta atcagcacag ttcattatca accaaacaaa 4260

aaataagtgg ttataatgaa tcgttaataa gcaaaattca tataaccaaa ttaaagaggg 4320

ttataatgaa cgagaaaaat ataaaacaca gtcaaaactt tattacttca aaacataata 4380

tagataaaat aatgacaaat ataagattaa atgaacatga taatatcttt gaaatcggct 4440

caggaaaagg ccattttacc cttgaattag taaagaggtg taatttcgta actgccattg 4500

aaatagacca taaattatgc aaaactacag aaaataaact tgttgatcac gataatttcc 4560

aagttttaaa caaggatata ttgcagttta aatttcctaa aaaccaatcc tataaaatat 4620

atggtaatat accttataac ataagtacgg atataatacg caaaattgtt tttgatagta 4680

tagctaatga gatttattta atcgtggaat acgggtttgc taaaagatta ttaaatacaa 4740

aacgctcatt ggcattactt ttaatggcag aagttgatat ttctatatta agtatggttc 4800

caagagaata ttttcatcct aaacctaaag tgaatagctc acttatcaga ttaagtagaa 4860

aaaaatcaag aatatcacac aaagataaac aaaagtataa ttatttcgtt atgaaatggg 4920

ttaacaaaga atacaaga 4938

<210> 4

<211> 21

<212> DNA

<213> Artificial Synthesis

<400> 4

gatgatacat agccgacctg a 21

<210> 5

<211> 18

<212> DNA

<213> Artificial Synthesis

<400> 5

ttccctactg ctgcctcc 18

<210> 6

<211> 23

<212> DNA

<213> Artificial Synthesis

<400> 6

caaaggtctt gctaaacata cat 23

<210> 7

<211> 23

<212> DNA

<213> Artificial Synthesis

<400> 7

ttaaatattc caaaggggag tag 23

<210> 8

<211> 32

<212> DNA

<213> Artificial Synthesis

<400> 8

cccaagctta agtaagatga taaccattgg gt 32

<210> 9

<211> 32

<212> DNA

<213> Artificial Synthesis

<400> 9

cgcggatcca agcccatttt taatagaatg ag 32

<210> 10

<211> 25

<212> DNA

<213> Artificial Synthesis

<400> 10

attactgaag ggaacctaga atagt 25

<210> 11

<211> 22

<212> DNA

<213> Artificial Synthesis

<400> 11

cgacctgagg taattataac cc 22

<210> 12

<211> 32

<212> DNA

<213> Artificial Synthesis

<400> 12

ccgctcgaga aatcttgata tggataaccg at 32

<210> 13

<211> 36

<212> DNA

<213> Artificial Synthesis

<400> 13

agctttgttt aaacgaaaga cccaatggtt atcatc 36

<210> 14

<211> 31

<212> DNA

<213> Artificial Synthesis

<400> 14

atcgatcgct cattctatta aaaatgggct t 31

<210> 15

<211> 31

<212> DNA

<213> Artificial Synthesis

<400> 15

gaagatctaa aaaattggaa aaaagtttag c 31

Claims (4)

1. The non-coding small RNA c263 of lactococcus lactis subspecies lactococcus lactis YF11 is characterized in that the nucleotide sequence is shown as SEQ ID NO.1 in a sequence table.

2. The carrier containing the non-coding small RNA c263 of claim 1, and the nucleotide sequence of the carrier is shown as SEQ ID NO.3 in a sequence table.

3. A recombinant lactococcus lactis bacterium comprising the vector of claim 2.

4. Use of the recombinant lactococcus lactis bacterium of claim 3 for the fermentative production of nisin.