CN106434625A

CN106434625A - Translatome RNC-mRNAs library construction method

Info

Publication number: CN106434625A
Application number: CN201610534365.1A
Authority: CN
Inventors: 伍泳彰; 曾宏彬; 陈杰
Original assignee: GUANGZHOU SAGENE BIOTECHNOLOGY Co Ltd
Current assignee: GUANGZHOU SAGENE BIOTECHNOLOGY Co Ltd
Priority date: 2016-07-07
Filing date: 2016-07-07
Publication date: 2017-02-22
Anticipated expiration: 2036-07-07
Also published as: CN106434625B

Abstract

The invention relates to a translatome RNC-mRNAs library construction method. The construction method comprises RNC-mRNAs and mRNA preparation, double-stranded cDNA synthesis, RNC-mRNAs and mRNA library construction, and data quality control and analysis. The method is characterized in that an advanced Beckman MAX-TL ultracentrifugation platform is adopted to carry out RNC capture, the cDNA synthesis and library construction are carried out by first fragmenting the RNA through a metal ion high temperature physical technology and subsequently carrying out cDNA synthesis, end restoration and magnetic bead fragment selection in order to enhance the integrity and the uniformity of RNC-mRNAs information, and a double-primer reverse transcription technology greatly improves the enzyme efficiency and guarantees the integrity of full-length amplification. The whole flow from RNA capture to translatome library construction can be realized in 6 h.

Description

Translation group RNC-mRNAs library constructing method

Technical field

The invention belongs to technical field of life science, it is related to a kind of mRNA library constructing method, particularly to translation group RNC-mRNAs library constructing method.

Background technology

It is known that genetic transcription (mRNA, transcript profile) and protein translation (protein, translation group) are in gene expression Very important step, then the two is not consistent and correlation is relatively low on gene expression abundance.Therefore, to translation in cell MRNA carries out studying particularly important.In translation, the big small subunit of ribosomes combines and moves on mRNA chain cell, and according to MRNA password sub-information synthetic protein polypeptide chain (nascent-chain), thus form ribosomes-new polypeptide chain compound (RNC, Ribosome Nascent-chain Complex).Wherein, it is referred to as RNC-mRNAs in conjunction with mRNA chain on the compositions (ribosome nascent-chain complex-bound mRNAs, RNC-mRNAs).

Early in calendar year 2001, Pradet-Balade et al. proposes hypothesis：The abundance of the mRNA in translation more can reflect protein Abundance.Subsequently research shows, this dyadic correlation is still relatively low, R²Below 0.4.Therefore, from mRNA to protein Quantitative transitive relation is always the problem in science that central dogma does not solve.The professor's research that draws a bow shows：Add the length of mRNA , there is significant ternary log-linear between RNC-mRNAs and protein relative abundance and the length of mRNA related quantitative in factor Relation, R²More than 0.94, that is, the relative abundance of the protein more than 94% can be by the phase of RNC-mRNAs in its translation Amount and mRNA length computation are obtained.To RNC-mRNAs sequencing it is possible to calculate the content of protein.Meanwhile, this research is first Propose the concept (translation ratio, TR) of translation ratio, (Zhang et al.Translating mRNAs strongly correlate to proteins in a multivariate manner and their translation ratios are phenotype specific.Nucleic acids research 41,4743-4754,2013).In addition, RNC-mRNAs sequencing can also be used for finding new albumen.(Zhang et al.How to Discover new proteins-translatome profiling.Science China Life sciences 57, 358-360,2014b).Therefore, efficiently, intactly capture ribosomes new polypeptide chain compound RNC (ribosome Nascent-chain complex), extract RNC-RNA (ribosome nascent-chain complex-RNA), go forward side by side It is particularly important that one step isolates the RNC-mRNAs with poly (A) structure.Total length RNC-mRNAs carries out library construction and sequencing, right High-flux sequence application and life science are all significant.

The ribosomes translated can be made with certain density translation extension inhibitor cycloheximide process tissue or cell It is stuck on mRNA (fixing ribosomes state), using sucrose density gradient centrifugation, RNC can be extracted from fresh cells.But In the case that translation group extends inhibitor concentration and action time deficiency, can not completely fix all of ribose nanocrystal composition. Due to the restriction of original ultracentrifugation platform, simple centrifugation link is with regard to 5 hours.Meanwhile, RNC-mRNAs content is very micro- Amount, frequently can lead to reverse transcription and builds storehouse failure, or part RNC-mRNAs runs off.

Thus apparently, obtain total length, complete RNC-mRNAs still has very big optimization space, not yet has special one at present Plant quick, convenient, economic translation group RNC-mRNAs library construction protocols.Therefore, for catching completely and exactly reflected sample Original physiologic state information, develop a kind of translation group RNC-mRNAs library constructing method of crucial importance.

Content of the invention

The purpose of the present invention is for technical problem to be solved above, provides a kind of quick, convenient, economic translation group RNC-mRNAs library constructing method, this construction method comprises the following steps：

Step 1)：RNC-mRNAs and mRNA prepares, and this step comprises the following specific steps that：

Sample is grouped；

RNC captures；

RNC-RNA and Total RNA extracts；

RNC-mRNAs with mRNA separates；

Step 2) synthetic double chain cDNA, this step comprises the following specific steps that：

RNA fragmentation；

Reverse transcription synthesizes the first chain cDNA；

It is polymerized the second chain cDNA；

Magnetic beads for purifying double-strand cDNA；

Step 3) RNC-mRNAs and mRNA library construction, this step comprises the following specific steps that：

End is repaired；

Jointing；

Piece Selection；

Amplification library；

Magnetic beads for purifying library；

Library Quality Control；

Step 4) data Quality Control and analysis

In said method, wherein step 1) in the method for sample packet be：Setting sample treatment group and blank control group, Every group at least two is repeated, and must cultivate with group between group under equivalent environment, is subsequently used for RNC-mRNAs and mRNA extracting.

In said method, wherein step 1) in RNC catching method be：RNC fixes, cleaning, cell cracking, sucrose density Gradient centrifugation.First, culture medium adds final concentration of 200 μ g/mL translations extend inhibitor cycloheximide, and put back to rapidly former Culture environment.Purpose is that the TI of high concentration more can stably fix all RNC.

Wherein, according to ribosomes sedimentation coefficient, using 30% sucrose as the density-gradient centrifugation method of buffer solution, it is directed to Beckman Coulter Optima MAX-TL ultracentrifugation machine platform, supports the use Ploycarbonate Thick Wall3.2mL heavy wall is transparent to be surpassed from pipe, and parameter of noncentricity is 4 DEG C, 110000rpm, 45min.This step substantially reduces sample Process time, is more beneficial for protecting RNC-mRNAs integrality.

In said method, wherein step 1) in RNC-RNA and Total RNA method for extracting be：Using containing 0.1% β-mercapto The TRIGene total RNA extraction reagent (GenStar) of base ethanol.Aldehydes matter so can be suppressed to aoxidize, make ribosomal protein Disulfide bond open, destroy its protein structure, make ribosomes and binding RNA separate.

In said method, wherein step 2) in RNA fragmentation and reverse transcription synthesize the first chain cDNA method and be：Use first Metal ion interrupts method fragmentation RNA, then adopts the reverse transcription method that decoding for DTMF combines, extension of time only 20 minutes.To RNC- MRNAs is interrupted using Physical, can guarantee that the randomness interrupting, and substantially increases the effect propety of follow-up enzyme simultaneously, shortens Time, it is to avoid cDNA generated time is long, reverse transcription extends the phenomenon of breach.This is to ensure that RNC-mRNAs and mRNA by RNA To DNA total length, complete conversion key one step.

Wherein, metal ion interrupts method and is：Add final concentration of 1mM using in 5X RNC First RT Buffer Mg²⁺, 94 DEG C of high temperature, 15 minutes, the clip size for 200nt for the RNA fragmentation to main peak adds genetic transcription suppression during reverse transcription Preparation Actinomycin D (0.1 μ g/ μ l).The DNA that so can effectively prevent remaining is transcribed into RNA again.Wherein decoding for DTMF Containing volume components than for Random Hexamer primer (100pM): Oligo (dT)₁₈Primer (100pM)=3: 1.(i.e. Join the reactant liquor needs 3 μ l Random Hexamer primer and 1 μ l Oligo (dT) of 4 μ l₁₈primer.If hereinafter occurring Ratio containing volume components, then represent in the same manner).Reverse transcriptase is preferably the PrimeScript after a kind of improvement M-MLV^TMReverse Transcriptase, it has extremely strong extension ability, high efficiency, synthesizes the first chain cDNA with high fidelity.

In said method, wherein step 2) in magnetic beads for purifying double-strand cDNA method be：Double-strand cDNA product and AMPure The volume ratio of XP Beads is 1.8.So the double-stranded DNA of more than 50bp all completely can be captured.

In said method, wherein step 3) in end restorative procedure be：The cDNA 5 ' of double-strand is added phosphate group, Flat end, by breach filling-in.Wherein 10X End Repair Buffer ratio containing volume components：10×T4DNA Polymerase Buffer: 0.1%BSA: dNTP mixture, 25mM=8: 1: 1；Wherein End Repair Enzyme Mix Ratio containing volume components：T4DNA Polymerase: Klenow Fragment: T4Polynucleotide Kinase=6: 1: 1.

In said method, wherein step 3) in jointing method be：DNA after end modified is connected 5 ' The DNA P1Adapter of tape label, 3 ' add DNA P1Adapter.Combine and recognition sequence in order to primer.Its coupled reaction tries Agent is 5X Ligase master Mix, and its ratio containing volume components is：T4 DNA Ligase: Klenow Fragment, exo-: 10 × T4DNA Ligase Buffer: dNTP mixture, 25mM: Water (HPLC Grade)=3: 1: 20: 1: 15.

In said method, wherein step 3) in Piece Selection method be：Be firstly added double-stranded DNA connection product with AMPure XP Beads, both volume ratios are 0.7, and magnetic bead combines large fragment or unwanted fragment, and the supernatant of reservation comprises Purpose fragment.Be subsequently adding the AMPure XP Beads with 0.15 times of sample, magnetic bead binding purpose fragment, and small fragment or Unwanted fragment, in supernatant, does not combine magnetic bead.300-370bp scope can accurately be obtained by this magnetic bead back-and-forth method to purify DNA library.

In said method, wherein step 3) in amplification library approach be：To connect after DNA carry out efficiently, fidelity Ground amplified library, requires for follow-up library Quality Control and the enrichment of positive library.How high-fidelity, the amplification library pair of high specific The reflection original state of RNC-mRNA is particularly important.Its 2X PCR Super High-Fidelity Mix ratio containing volume components is PrimeSTAR Max DNA Polymerase: PrimeSTAR Max Premix (2 ×): dNTP mixture, 25mM=1: 50∶1；Response parameter is 98 DEG C of denaturation, 5min；Amplification (98 DEG C, 15sec；58 DEG C, 15sec；72 DEG C, 45sec；) 10 follow Ring；Extend 72 DEG C afterwards, 5min.

In said method, wherein step 3) in magnetic beads for purifying library approach be；Library after amplification and AMPure XP The volume ratio of Beads is 0.9, and the part of below 250bp and more than 350bp is removed, and retains the single main peak of about 330bp.

In said method, wherein step 4) data Quality Control with analysis method is：Quick using superhigh precision high-flux sequence Compare FANSe2 algorithm and open cloud analysis platform with holding, carry out translation group RNC-mRNAs and mRNA sequencing data is compared.

Compared with prior art, the present invention has advantages below and effect：

1) applied widely：This experimental program and reagent are specifically designed in RNC-mRNAs and mRNA synchronization library construction, It is applied to transcript profile, the Total RNA sequencing of routine.Due to using first wife's built-in DNA label joint, under flux allows, going back Can compatible DNA library go up machine sequencing simultaneously, realize RNA, synchronization excavation that DNA, protein information are unified on line.

2) ensure purpose sample message integrality：All true from links such as RNC capture, fragmentation, reverse transcription and amplified libraries The total length information of RNC-mRNAs and mRNA and the integrality of internal state are protected.Can truly be reflected carefully by high-flux sequence The original translation state of born of the same parents.

3) operating process simplifies and experimental period is compact：In RNC capture, employ advanced Beckman MAX-TL and surpass Fast centrifugal platform, making to surpass from time concentration is 45 minutes.In cDNA synthesis and library construction, initially with metal ion high temperature Physical, to RNA fragmentation, subsequently just carries out cDNA synthesis, end is repaired and magnetic bead Piece Selection, this can increase RNC- The integrality of mRNAs information, homogeneity.Then use decoding for DTMF reverse transcription method, this method substantially increases the efficiency of enzyme it is ensured that total length Expand is complete.In 6 hours, it is possible to achieve capture translation group library construction entire work flow from RNC.

Meanwhile, reaction link many places adopt optimized mixing Mix working solution, simplify step and increased experimental implementation Uniformity.

4) reduce sequencing cost：Entire work flow captures and builds storehouse almost all with domestic reagent as raw material, by optimizing Be formulated with debugging, primer and joint also can self-defining and synthesis, greatly reduce sequencing cost, broken away from single anti- The former official import RNA 800 yuan of your valencys should just be reached builds storehouse kit.

5) novelty：The method that the present invention provides, departing from Ion Torrent platform to RNA and single double-stranded adapters hybridization Official RNA build storehouse scheme, continued to use the RNA after the illumina pad optimization of authenticating authority for many years and built storehouse experimental considerations, its It is consistent that sequencing data quality and official build storehouse kit the data obtained.

The method that the present invention provides breaches the restriction to nucleic acid type for the high-flux sequence platform, realizes DNA, RNA simultaneously Upper machine sequencing, provides convenience for studying RNC-mRNAs further.

6) case actual combat：Most commonly seen MCF-7 Human Breast Cancer Cells are selected to be research object, in typical antineoplastic When thing taxol and cis-platinum independent medication or drug combination are processed, itself RNC-mRNAs and mRNA of high throughput assay, to speculate medication The effect selecting.

The present invention with high-flux sequence as means, RNC- that is fast and convenient, that sample is detected economy, efficient and sensible The ecological composition of mRNAs and mRNA, realizes the Identification of Species to RNA and protein in translation and accurate quantification.

In clinicing aspect, be sequenced by translation group RNC-mRNAs, can not only truly describe disease occur, development and The state of organism metabolism and change in therapeutic process, are the diagnosis of clinical disease, the exploration of pathomechanism, the sending out of new therapy target New approach and thinking are now provided, external environment (the medicine, diet) impact to body for the disturbing factor can also be disclosed, be drug effect Evaluate and more front rear monitor in real time provides basic data.

In terms of scientific research, RNC-mRNAs accuracy of detection remote superprotein omics technology, can exhaustive all turn over The gene translated, can detect extremely low abundance protein effectively, realize accurate protein group quantitative.The annotation of correction human genome is wrong By mistake, find in the past from undiscovered new albumen.The method is applied to each disease and biotechnology research mechanism carries out protein and determines Amount, has wide market prospects and medical value, social benefit, is suitable to popularization and application on a large scale.

Brief description

Fig. 1：Z, S, ZS, N group RNC-RNA electrophoresis detection result；

Fig. 2：2100 testing results in Z group RNC-mRNAs library；

Fig. 3：2100 testing results in S group RNC-mRNAs library；

Fig. 4：2100 testing results in ZS group RNC-mRNAs library；

Fig. 5：2100 testing results in N group RNC-mRNAs library；

Fig. 6：Sequence quality is distributed box traction substation.

Specific embodiment

With reference to instantiation, the present invention is further described.

Embodiment one：

The present embodiments relate to kit main material proportioning as follows：

1.RNC-mRNAs extracts modular reagent：

RB binding solution：20mg/mL(200X)cycloheximide；

RB buffer：HEPS-KOH, 15mM MgCl of 20mM, pH 7.4₂、200mM KCl、100ug/mL Cycloheximide, 2mM dithithreitol, distilled water；

RB lysis solution：RB buffer containing 1%Triton X-100；

RB 30%sucrose：RB buffer is configured to 30% sucrose solution；

RB Trizol solution：TRIGene total RNA extraction reagent (GenStar) containing 0.1% beta -mercaptoethanol；

2.RNC-seq cDNA Synthesis kit modular reagent box：

5X RNC First RT Buffer ratio containing volume components：5×PrimeScript Buffer∶25mM MgCl₂∶ DNTP mixture, 25mM=4: 1: 1；

Super Reverse Trancriptase ratio containing volume components：PrimeScript^TMReverse Transcriptase；

RNC RT Primers ratio containing volume components：Random Hexamer primer(100pM)∶Oligo (dT)₁₈Primer (100pM)=3: 1；

Actinomycin D：7-Aminoactinomycin D(0.1μg/μl)；

10X RNC Second RT Buffer ratio containing volume components：10×E.coli DNA Polymerase I Buffer (containing 0.025%BSA): dNTP mixture, 25mM=8: 1；

3.RNC-seq DNA Library Construction kit modular reagent box：

10X End Repair Buffer ratio containing volume components：10 × T4DNA Polymerase Buffer: 0.1% BSA: dNTPmixture, 25mM=8: 1: 1；

End Repair Enzyme Mix ratio containing volume components：T4DNA Polymerase∶Klenow Fragment∶ T4Polynucleotide Kinase=6: 1: 1；

5X Ligase master Mix ratio containing volume components：T4DNA Ligase: Klenow Fragment, exo- (5U/ μ L): 10 × T4DNALigase Buffer: dNTP mixture, 25mM: Water (HPLC Grade)=3: 1: 20: 1: 15；

2X PCR Super High-Fidelity Mix ratio containing volume components：PrimeSTAR Max DNA Polymerase: PrimeSTAR Max Premix (2 ×): dNTP mixture, 25mM=1: 50: 1；

The present embodiments relate to primer and joint composite signal as follows：

1st, amplified library PCR primer synthetic method PCR Primers Mix

Reagent name	Sequence number (Primer)	Component (5 ' -3 ')	Base number
				PCR Primers Mix	1-PCR-A	CCATCTCATCCCTGCGTGTC	20
	2-PCR-P1	CCACTACGCCTCCGCTTTCCTCTCTATG	28

By the 1 PCR-A and 2-PCR-P1 10mM Tris pH 7.5 after synthesis, it is diluted to 20 μM, then by two Primer equal-volume mixes, you can be configured to PCR primer mix (10 μM) reagent that can be directly used for reacting.

2nd, label joint pre-treatment DNA A Barcode X and DNA P1 Adapter

Note：In sequence in wherein above-mentioned table " * T*T " represent to the 3 of sequence ' two T bases of end carry out thio-modification, " * " represents phosphorothioate bond.

The way of purification of sequent synthesis is HPLC way of purification, is hydroxyl single-stranded nucleotide, needs pre-treatment to become complementary Double-stranded adapters.

1) the single-stranded primer dry powder of synthesis is diluted to 200 μM with 1 × Low TE.

2) DNA library 5 ' end A joint synthesis double-strand method：Respectively take the A-BarcodeX-F 20uL, A- having diluted BarcodeX-R20 μ L, adds 20 μ L 5 × T4DNA Ligase Buffer and the seedless sour water of 40 μ L, makes final concentration of after mixing 40μM.Annealing synthesis double-stranded adapters in PCR instrument, reaction condition is as follows：95 DEG C, 5min；72 DEG C, 5min；60 DEG C, 5min；50 DEG C, 3min；40 DEG C, 3min；30 DEG C, 3min；20 DEG C, 3min；10 DEG C, 3min；4 DEG C, ∞ min.Finally give 40 μM of double-strands to connect Head DNAA Barcode X (X refers to 1-08), puts -20 DEG C of preservations.

3) DNA library 3 ' end DNA P1 Adapter joint synthesis double-strand method：Ibid DNAA Barcode X process.

Below by with reference to the drawings and specific embodiments, technical scheme is described in further details, but this Bright it is not limited to following examples.In the present embodiment, material used provides for Guangzhou Sai Zhe biotech inc MCF-7 Human Breast Cancer Cells, after adding taxol, cisplatin medicine 48 hours, carry out high pass measurement to RNC-mRNAs, mRNA Sequence, the expression relatively individually and during drug combination.

The experiment flow of the present invention comprises the following steps that.

1 cell sample prepares

1.1 medicine

Paclitaxel injection (Biological Engineering Co., Ltd., Hayao Group, 5ml: 30mg, Chinese medicines quasi-word H20059962)；Note Penetrate with cis-platinum (Qilu Pharmaceutical Co., Ltd., 10mg, Chinese medicines quasi-word H20073652).Above medicine is trained with RPMI 1640 before use Nutrient solution is all made into 2umol/L.

1.2 cell culture and packet

MCF-7 Human Breast Cancer Cells with containing 10% calf serum RPMI 1640 culture medium (Gibco, 22400121) In 37 DEG C, 5%CO₂Subculture in incubator.When cell confluency rate reaches more than 70%, start agent-feeding treatment.Passage It is grouped dosing afterwards, first group adds taxol (Z group), and second group adds cis-platinum (S group), and the 3rd group adds taxol and cis-platinum (ZS group), The 4th group of control group (N group) being to be not added with any medicine.After agent-feeding treatment 48 hours, it is for further processing.

Z group, S group, ZS group, N group each group at least two plate are cultivated.The cell of extracting Total RNA and RNC-RNA Must be with a collection of, cultivate under equivalent environment.Select one of plate to carry out RNC capture first, be subsequently used for RNC-mRNAs Extracting, another plate is used for Total RNA and extracts, and is subsequently used for mRNA extracting.Finally, four groups of human breast carcinoma MCF-7 are obtained thin RNC-mRNAs, mRNA product under the specific space-time of born of the same parents.

2.RNC captures

2.1RNC it is fixing

To the 10^6-10^7 cell cultivated, add 100ul RB binding solution to culture medium, gently Tilt to mix, put back in former incubator at once, be incubated 30min.This RB binding solution volume is the 1/ of culture medium 100.Culture medium add translation extend the final concentration of 200 μ g/mL of inhibitor cycloheximide.

2.2 cleaning

Outwell culture medium, add 0 DEG C of 1 × PBS submergence cell of 5mL precooling, soft inclination is rinsed, and abandons supernatant, rinses two Secondary.Finally, with pipette tips, residual liquid is blotted only, be placed in stand-by on ice.

2.3 cell cracking

(1) adding 1mL RB lysis solution, soft inclination mixes it is ensured that being completely covered, placing 30min on ice.

(2) scraped with clean cell and gently cell is collected, transfer in the 1.5mL centrifuge tube of precooling on ice.

(3) cell pyrolysis liquid is centrifuged under 4 DEG C of centrifuges, 16000g, 10min, is removed cell fragment, in reservation Clearly.

2.4 SDGC

(1) carefully 500ul supernatant is transferred to precooling and surpassing on pipe equipped with 2.7mL RB 30%sucrose Layer, numbers from pipe to surpassing, and carries out trim two-by-two from pipe it is desirable to weighing error is less than 0.01g according to surpassing of rotary head offside numbering. This RB 30%sucrose is more than or equal to 5: 1 with supernatant volume ratio.

(2) it is placed in 4 DEG C of ultracentrifuge, 110000rpm, 45min.

(3) after centrifugation terminates, rapid transfer surpasses from pipe on ice, slowly siphons away supernatant, must remove the sucrose of residual Totally, will softly be dissolved in RB lysis solution with micro- yellow, transparent precipitation in base wall, obtain cell RNC. Next step carries out RNC-RNA extracting.

3.RNC-RNA and Total RNA extracts

Total RNA need to carry out sample clean first, and after capture, RNC then directly carries out 3.2 sample dissociations.

3.1 sample clean

Cell for Total RNA extracting first need to carry out sample clean, and other process steps and RNC-RNA process same Step.

3.2 sample dissociation

It is separately added in the RNC to after cell obtained in the previous step or capture for the 1mL RB lysis solution, soft top Fall 5 times, place 5min on ice.

3.3 chloroform extraction

(1) by sample dissociation liquid, add 200uL chloroform (lysate: chloroform volume ratio=5: 1), overturn 5 times, put on ice Put 5min.

(2) 4 DEG C of refrigerated centrifuges, 12000g, 15min are put, after centrifugation, transfer supernatant is in new 1.5mL centrifuge tube.

3.4 ethanol are frozen and clean

(1) add the absolute ethyl alcohol (absolute ethyl alcohol: supernatant volume ratio >=2.5: 1), fully reverse mixed of 4 DEG C of precoolings of 1mL Even, be placed in -80 DEG C frozen 1 hour.

(2) take out centrifuge tube, observe after no luming, put 4 DEG C of refrigerated centrifuges, 12000g, 20min, abandon supernatant, retain white Color precipitates, and tentatively obtains RNA precipitate.

3.5 dissolving RNA

Add 30-60ul DEPC water dissolving RNA, -80 DEG C of preservations.Products therefrom is RNC-RNA, Total RNA.

3.6RNA Quality Control

(1) ultraviolet spectrometry detection

The detection of micro ultraviolet spectrometry, according to 10^6 cell initial amount, typically up to 2ug total amount more than, have height at OD260 Absworption peak.OD260/280 is 1.8-2.2, and OD260/230 is qualified for 1.8-2.2.If there being high protrusion absworption peak at 230, Often for sucrose residual.

(2) agar sugar detection

Run 1% agarose gel electrophoresis, 120V, 30min, 28S and 18S band can be detected bright, limpid is then matter Amount is qualified.If 28S is in disperse shape, show that RNC-mRNAs, mRNA are degraded.If having bright wisp band in Jiao Kongchu, it is often sucrose Macromolecular remains.

Quality Control partial results are shown in Fig. 1 Z, S, ZS, N group RNC-RNA electrophoresis detection result, and from left to right, swimming lane 1 is Z group to figure RNC-RNA；Swimming lane 2 is S group RNC-RNA；Swimming lane 3 is ZS group RNC-RNA；Swimming lane 4 is N group RNC-RNA；Swimming lane 5 is Maker D2000, stripe size is 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp；Swimming lane 6 is that people total RNA compares. Show from result, four groups of RNC-RNA are all qualified, no degrade.

4.RNC-mRNAs with mRNA separates

Using the polyA tail feature of poly (A) RNA 3 ' end, using Oligo (dT)₂₅Paramagnetic particle method from RNC-RNA, Separate RNC-mRNAs and mRNAs in Total RNA, can be directly used for subsequent translation group sequencing library and build.This flow process usesMRNA Purification Kit (#61006), and operational manual is optimized.

4.1RNA denaturation

(1) it is separately added into DEPC water by 15ug RNC-RNA, Total RNA, mend and be diluted to 100uL.

(2), after mixing, sample, to open secondary structure, is then immediately placed on ice by 65 DEG C of denaturation 2min.

4.2Dynabeads magnetic bead prepares

(1) by 50ul, the Dynabeads magnetic bead after resuspended is added in low adsorption tube, puts standing 30s on magnetic frame.

(2) discard supernatant, 100ul Binding Buffer is added in pipe, gently resuspended mixing, is placed on magnetic frame 2min, carefully suctions out supernatant.

4.3 capture RNC-mRNAs, mRNA

(1) by magnetic bead be resuspended in 100ul Binding Buffer (Binding Buffer volume: sample volume=1: 1) the 15ug RNC-RNA, and after first step denaturation, Total RNA are separately added in pipe, are placed on rotation in vertical rotary device Incubation, incubation time extends to 15min it is ensured that all purposes RNA is all completely attached to magnetic bead from original 5min.

(2) pipe is placed in standing 2min on magnetic frame, carefully sucks supernatant.

(3) add 500ul Washing Buffer in pipe, gently resuspended mixing, it is placed in 2min on magnetic frame, carefully Suck supernatant.Wash number from original once, increase to twice.Washing Buffer volume is increased by original 200ul To 500ul it is ensured that non-purpose RNA, DNA being free on outside magnetic bead and on tube wall can be removed clean completely.Keep away to greatest extent Exempt from the pollution of rRNA and DNA, it is not necessary to add DNase I digestion DNA step compared with conventional procedures.

4.4 wash-out RNC-mRNAs, mRNA

(1) add 10ul 10mM Tris-HCl, 7.5,80 DEG C of pH heating 2min in the pipe containing magnetic bead, by mRNA from Elute on magnetic bead, go to pipe on magnetic frame rapidly, mRNA is in new RNase-free pipe for transfer.Ice put immediately by sample On, proceed next step, or -80 DEG C of preservations.

4.5RNC-mRNAs, mRNA Quality Control

RNC-mRNAs, mRNA only account for the 1-5% of RNC-RNA, Total RNA respectively.Therefore, sample initial amount and purifying RNC-mRNAs, mRNA yield should strictly utilize Qubit fluorogenic quantitative detection afterwards.Can be used as the reference judging rRNA residual.

5. double-strand cDNA synthesis

5.1RNA fragmentation

Sequentially add following reagent and softly mix.

Composition	Volume (μ l)
		5X RNC First RT Buffer	4
RNC RT Primers	2
		RNC-mRNAs or mRNA	5ng
Nuclese-free water	Mend to 20
		Total	20

Sample is placed in 94 DEG C in PCR amplification instrument, 15min (105 DEG C of heat lid).After reaction terminates, rapidly reaction tube is inserted Enter to cooled on ice.This step reaction can utilize Mg²⁺Metal ion at high temperature, by the piece for 200nt for the RNA fragmentation to main peak Duan great little.

5.2cDNA first chain synthesizes

Composition	Volume (μ l)
		RT reaction Mix	20
RNase Inhibitor	0.5
		Actinomycin D(0.1μg/μl)	5
Super Reverse Trancriptase	2
		Nuclese-free water	12.5
Total	40

Sample is placed in PCR amplification instrument (105 DEG C of heat lid), following reaction temperature is set：

25 DEG C of Step1,10min；

42 DEG C of Step2,20min；

70 DEG C of Step3,10min；

04 DEG C of Step4, hold；

After reaction terminates, it is immediately placed on ice, and carries out cDNA second chain synthesis reaction.

5.3cDNA second chain synthesizes

Sequentially add following reagent and softly to mix in cDNA the first chain synthesis reaction liquid (40 μ l).

Composition	Volume (μ l)
		cDNA first strand reaction Mix	40
10X RNC Second RT Buffer	8
		Super DNA Synthesis Enzyme mix	4
Nuclese-free water	28
		Total	80

Sample is placed in PCR amplification instrument (heat lid is closed), 16 DEG C, 60min.

After reaction terminates, you can the product obtaining is double-strand cDNA of non-flat end.Then carry out magnetic beads for purifying, remove anti- Answer the impurity such as enzyme and substrate in liquid.

5.4 magnetic beads for purifying double-strands cDNA

1) thoroughly resuspended AMPure XP Beads, equilibrium at room temperature 30min.

2) the low absorption of AMPure XP Beads to the 1.5mL after adding 144 μ l (1.8X) resuspended to double-strand cDNA product Guan Zhong, piping and druming up and down mixes 10 times.

3) incubated at room 5min, incubation period avoids sharp pounding.

4) the low adsorption tube of 1.5mL is transferred on magnetic frame, make supernatant and Beads enrichment.Standing 3min, until solution After becoming limpid, careful shifting abandons supernatant.Comprise target DNA in magnetic bead, should avoid touching.

5) add freshly prepared 80% ethanol of 500 μ l on the pipe of magnetic frame, using the effect of magnetic force, rotate low absorption Pipe 3 times, to clean magnetic bead.Then the static 30s of room temperature, careful shifting abandons supernatant.

6) repeat step 5) once, 2 cleanings altogether.

7) by of short duration for low adsorption tube centrifugation 2s, with pipette tips, the ethanol remaining is removed clean.On magnetic frame, open lid Son, magnetic bead is dried at room temperature for 5min, until the no glistening ethanol residual of magnetic bead surfaces.

8) pipe is moved away to outside magnetic frame, add 45 μ l 1X TE buffer wash-outs, piping and druming up and down mixes 10 times, room temperature Incubation 2min.Then pipe is placed on magnetic frame, until solution clarification.

9) 43 μ l supernatants are transferred on the 0.2PCR pipe of a clean free nucleic acid.

Note：Carry out next step reaction or preservation immediately.Can preserve two weeks at -20 DEG C, -80 DEG C can preserve one month.

6. library construction

6.1 ends are repaired

1) sequentially add following reagent and softly to mix in double-strand cDNA product (55.5 μ l).

Composition	Volume (μ l)
		double stranded cDNA	43
10X End Repair Buffer	5
		End Repair Enzyme Mix	2
Total	50

2) sample is placed in PCR amplification instrument (105 DEG C of heat lid), following reaction temperature is set：

25 DEG C of Step1,30min；

Step270 DEG C, 10min；

4 DEG C of Step3, hold；

After reaction terminates, it is immediately placed on ice, and carries out next step coupled reaction.

6.2 joints connect

1) sequentially add following reagent and softly to mix in the DNA product (50 μ l) of flat end.

Composition	Volume (μ l)
		Blunt end DNA	50
5X Ligase master Mix	20
		DNA P1 Adapter	1
DNAA Barcode X	1
		Nuclese-free water	28
Total	100

25 DEG C of Step1,15min；

68 DEG C of Step2,5min；

4 DEG C of Step3, hold；

After reaction terminates, it is immediately placed on ice, and carries out next step paramagnetic particle method Piece Selection.

6.3 Piece Selections and purifying

The method that the product in fragment distribution and library is largely dependent upon Piece Selection.Piece Selection can pass through Glue method, E-Gel size select gels method or AMPure XP Beads paramagnetic particle method are cut in Pippin Prep automation.Pin For 200bp library, Pippin Prep automation is cut glue method and is selected " tight " 315bp, E-Gel size select gels It is 330bp that method selects to reclaim main peak, and this paramagnetic particle method selects the fragment of 300-370bp scope.

Step1 removes large fragment：Magnetic bead combines large fragment or unwanted fragment, and supernatant then comprises purpose fragment.

1) coupled reaction product is mended Nuclese-free water to 100 μ l volume.Thoroughly resuspended AMPure XP Beads, equilibrium at room temperature 30min.

2) in the low adsorption tube of AMPure XP Beads to the 1.5mL after adding 70 μ l (0.7X) resuspended to product, Piping and druming mixes 10 times up and down.

3) incubated at room 5min, incubation period avoids sharp pounding.

4) the low adsorption tube of 1.5mL is transferred on magnetic frame, make supernatant and Beads enrichment.Carefully supernatant is transferred to newly The low adsorption tube of 1.5mL in, retain supernatant.And large fragment DNA is comprised on magnetic bead, then move and abandon.

Step2 removes small fragment：Magnetic bead binding purpose fragment, and small fragment or unwanted fragment be in supernatant, no In conjunction with magnetic bead.

5) the low suction of AMPure XP Beads to the 1.5mL after supernatant product adds 15 μ l (0.15X) resuspended one step up In attached pipe, piping and druming up and down mixes 10 times.

6) incubated at room 5min, incubation period avoids sharp pounding.

7) the low adsorption tube of 1.5mL is transferred on magnetic frame, make supernatant and Beads enrichment.Standing 3min, until solution After becoming limpid, careful shifting abandons supernatant.Comprise target DNA in magnetic bead, should avoid touching.

8) add freshly prepared 80% ethanol of 500 μ l on the pipe of magnetic frame, using the effect of magnetic force, rotate low absorption Pipe 3 times, to clean magnetic bead.Then the static 30s of room temperature, careful shifting abandons supernatant.

9) repeat step 5) once, 2 cleanings altogether.

10) by of short duration for low adsorption tube centrifugation 2s, with pipette tips, the ethanol remaining is removed clean.On magnetic frame, open lid Son, magnetic bead is dried at room temperature for 5min, until the no glistening ethanol residual of magnetic bead surfaces.

11) pipe is moved away to outside magnetic frame, add 20 μ l 1X TE buffer wash-outs, piping and druming up and down mixes 10 times, room temperature Incubation 2min.Then pipe is placed on magnetic frame, until solution clarification.

12) 20 μ l supernatants are transferred in the 0.2ml PCR pipe of a clean free nucleic acid.

6.4PCR amplified library

1) sequentially add in following reagent DNA product (40 μ l) to after connect and softly mix.

Composition	Volume (μ l)
		Ligated DNA	20
PCR Primers Mix	5
		2X PCR Super High-Fidelity Mix	25
Total	50

After reaction terminates, it is immediately placed on ice, and carries out next step PCR amplified library product purification.

6.5 magnetic beads for purifying libraries

2) the low absorption of AMPure XP Beads to the 1.5mL after adding 45 μ l (0.9X) resuspended to double-strand cDNA product Guan Zhong, piping and druming up and down mixes 10 times.

3) incubated at room 5min, incubation period avoids sharp pounding.

6) repeat step 5) once, 2 cleanings altogether.

8) pipe is moved away to outside magnetic frame, add 20 μ l 1X TE buffer wash-outs, piping and druming up and down mixes 10 times, room temperature Incubation 2min.Then pipe is placed on magnetic frame, until solution clarification.

9) 20 μ l supernatants are transferred in the 0.2ml PCR pipe of a clean free nucleic acid.

10) library finally giving need to be through strict quality control：Qubit Concentration Testing and Agilent 2100 detect, library is fixed Template preparation, the sequencing of upper machine can be carried out after amount.

Note：Library can preserve two weeks at -20 DEG C, and -80 DEG C can preserve a month even longer time.Using front, Ying Thaw on ice.

7. library Quality Control

1) take 1ul DNA library, using Qubit dsDNAHS Assay Kit fluoremetry library concentration and total amount.? In 20 μ l eluent system, the RNC-mRNAs library of Z, S, ZS, N group, mRNA library concentration, all between 2-5ng/ μ l, keep relatively High amplification efficiency, and undistorted, meet expected 1-10ng/ μ l scope.

2) take 1 μ l library (concentration measuring according to previous step, be diluted to 1ng/ μ l), useHigh Sensitivity DNA Kit detects clip size and the molar concentration in library.Clip size requires to be had between 290-370bp Single protrusion peak.Show through 2100 testing results, four groups of eight libraries, all in the range of 320-360bp, meet 200base literary composition Long requirement is read in storehouse, and library Quality Control is qualified.The qualified library accurate quantification of Quality Control, to 100pM, can be directly used for template preparation.Fig. 2, 3rd, 4,5 represent 2100 testing results in the RNC-mRNAs library of Z, S, ZS, N group respectively, main peak length respectively 349bp, 339bp, 352bp, 326bp, meet the requirements.

Prepared by 8.Ion Proton template

After taking the RNC-mRNAs library of Z, S, ZS, N group, mRNA library totally 8 encoded libraries being diluted to 100pM, equivalent is mixed Close.Take 5 μ L as template dilution gfactor.According to Ion PI^TMHi-Q^TMOT2 200Kit template reagent preparation box carries out emulsion PCR, concrete operations flow process prepares product description with reference to Ion Proton template.

Machine sequencing on 9.Ion Proton

Carry out sequencing procedures in strict accordance with instrumentation specification, be sequenced using P1 chip in the present embodiment.In core The library template of amplification enzyme, primer and the positive is added, the sequencing time is two and one-half- hours, just can obtain primitive sequencer number in piece According to.

10. sequencing data Quality Control

Carry out with the FastQC analysis software that Ion Torrent PGM server system Torrent Suite4.2 carries Data Quality Control.See Fig. 6 sequence quality distribution box traction substation, abscissa is reads base positions (5 '-＞ 3 '), and ordinate is all Reads is in this site base statistic of attribute, (red including maximum, minimum of a value, upper quartile value, lq, median Solid line) and mean value (blue broken line).It can be seen that the data average quality very high (Q ＞ 28) after this sequencing filtration, base Originally it is distributed in green area.

Sequencing quality control all reaches more than Q20 standard in 50-250bp, shows sequencing data reliable in quality, and result proves design Library adapter-primer and library construction Kit assembling quality qualified.Thus, at the beginning of translation group RNC-mRNAs library construction pattern Step is set up.

11. data analyses

FANSe2 algorithm is quickly compared using superhigh precision high-flux sequence and opens cloud analysis platform with holding, to translation group RNC- MRNAs and mRNA sequencing data is compared.Show from analysis result, first group adds taxol (Z group), and second group adds cis-platinum (S Group), the 3rd group adds taxol and cis-platinum (ZS group), in the 4th group of control group (N group) being not added with any medicine RNC-mRNAs with The quantitative coefficient correlation of mRNA is 0.52,0.68,0.75,0.63 respectively, illustrate translate in mRNA with transcription after total mRNA simultaneously Differ.Find, taxol, the TERT gene (NM_198253, the reverse transcriptase of Telomerase) of cisplatin treated group and BCL2 simultaneously Gene (NM_000633, apoptotic effector) expression reduces, and the reduction of drug combination group becomes apparent from.

Telomerase, is responsible for a kind of enzyme of the prolongation of telomere in cell, telomeric dna can be added to eukaryotic chromosome end End.For keeping chromosome stability and cytoactive to play an important role in different plant species cell, Telomerase can extend telomere The telomere shortening, thus strengthen the multiplication capacity of cell in vitro.Activity inhibited in normal human tissue for the Telomerase, swollen It is reactivated in knurl, Telomerase may participate in vicious transformation.Telomere Stability, genome be complete, cell is long keeping for Telomerase The activity of phase and the potential aspects such as multiplication capacity that continue play an important role.TERT gene (reverse transcriptase of encoding telomerase), TERT gene deregulation will lead to decline with telomerase activation, such that it is able to inhibition cancer cell increment.BCL2 (adjust by encoding both apoptosis The control factor), can promote or inhibited apoptosis.Down regulation of gene expression is relevant with cancer apoptosis regulation.In sum, Japanese yew Some critical path it is suppressed that cell growth, and have synergy during joint in MCF-7 cells blocks for alcohol and cisplatin effect.

Finally it should be noted that above example is merely to illustrate technical scheme and unrestricted, although ginseng According to preferred embodiment, the present invention is described in detail, it will be understood by those within the art that, can be to invention Technical scheme is modified or equivalent, and without deviating from the spirit and scope of technical solution of the present invention, it all should be covered In scope of the presently claimed invention.

Claims

1. a kind of translation group RNC-mRNAs library constructing method, this construction method comprises the following steps：

Sample is grouped；

RNC captures；

RNC-RNA and Total RNA extracts；

RNC-mRNAs with mRNA separates；

RNA fragmentation；

Reverse transcription synthesizes the first chain cDNA；

It is polymerized the second chain cDNA；

Magnetic beads for purifying double-strand cDNA；

End is repaired；

Jointing；

Piece Selection；

Amplification library；

Magnetic beads for purifying library；

Library Quality Control；

Step 4) data Quality Control and analysis.

2. method according to claim 1, wherein step 1) in sample packet method be：Setting sample treatment group and Blank control group, every group at least two is repeated, and must cultivate with group, be subsequently used for RNC-mRNAs between group under equivalent environment With mRNA extracting.

3. the method according to claim 1-2, wherein step 1) in RNC catching method be：RNC fixes, cleaning, cell Cracking, SDGC, add translation to extend the final concentration of 200 μ g/ of inhibitor cycloheximide first on culture medium ML, and put back to rapidly former culture environment, wherein, according to ribosomes sedimentation coefficient, using 30% sucrose as buffer solution density Gradient centrifugation, is directed to Beckman Coulter Optima MAX-TL ultracentrifugation machine platform, supports the use Ploycarbonate Thick Wall 3.2mL heavy wall is transparent to be surpassed from pipe, and parameter of noncentricity is 4 DEG C, 110000rpm, 45min；And RNC-RNA and Total RNA method for extracting is：TRIGene total RNA extraction reagent using 0.1% beta -mercaptoethanol.

4. the method according to any one of claim 1-3, wherein step 2) in RNA fragmentation and reverse transcription synthesis first Chain cDNA method is：Interrupt method fragmentation RNA with metal ion first, then adopt the reverse transcription method that decoding for DTMF combines, extend Only 20 minutes time, wherein, metal ion interrupts method and is：Using final concentration of to adding in 5X RNC First RT Buffer 1mM Mg²⁺, 94 DEG C of high temperature, 15 minutes, the clip size for 200nt for the RNA fragmentation to main peak add gene to turn during reverse transcription Record inhibitor Actinomycin D (0.1 μ g/ μ l), wherein decoding for DTMF contain volume components ratio for Random Hexamer primer (100pM)∶Oligo (dT)₁₈Primer (100pM)=3: 1；In addition, magnetic beads for purifying double-strand cDNA method is：Double-strand cDNA is produced Thing is 1.8 with the volume ratio of AMPure XP Beads.

5. the method according to any one of claim 1-4, wherein step 3) in end restorative procedure be：By double-strand CDNA 5 ' adds phosphate group, flat end, breach filling-in, wherein 10X End Repair Buffer ratio containing volume components： 10 × T4DNA Polymerase Buffer: 0.1%BSA: dNTP mixture, 25mM=8: 1: 1；Wherein End Repair Enzyme Mix ratio containing volume components：T4DNA Polymerase∶Klenow Fragment∶T4Polynucleotide Kinase=6: 1: 1.

6. the method according to any one of claim 1-5, wherein step 3) in jointing method be：To repair through end In 5 ' the DNA P1Adapter connecting upper tape label, 3 ' add DNA P1Adapter to DNA after decorations, and its coupled reaction reagent is 5X Ligase master Mix, its ratio containing volume components is：T4DNA Ligase: Klenow Fragment, exo-: 10 × T4DNA Ligase Buffer: dNTP mixture, 25mM: Water (HPLC Grade)=3: 1: 20: 1: 15.

7. the method according to any one of claim 1-6, wherein step 3) in Piece Selection method be：It is firstly added double Chain DNA connection product and AMPure XP Beads, both volume ratios are 0.7, are subsequently adding the AMPure with 0.15 times of sample XP Beads.

8. the method according to any one of claim 1-7, wherein step 3) in amplification library approach be：After connecting DNA carry out efficiently, fidelity ground amplified library, require for follow-up library Quality Control and the enrichment of positive library, wherein 2X PCR Super High-Fidelity Mix contains volume components ratio for PrimeSTAR Max DNA Polymerase: PrimeSTAR Max Premix (2 ×): dNTP mixture, 25mM=1: 50: 1；Response parameter is 98 DEG C of denaturation, 5min；Amplification 10 Circulation；Extend 72 DEG C afterwards, 5min, amplification condition is 98 DEG C, 15sec；58 DEG C, 15sec；72 DEG C, 45sec.

9. the method according to any one of claim 1-8, wherein step 3) in magnetic beads for purifying library approach be；After amplification The volume ratio of library and AMPure XP Beads be 0.9.

10. the method according to any one of claim 1-9, wherein step 4) data Quality Control with analysis method is：Using super High accuracy high-flux sequence quickly compares FANSe2 algorithm and opens cloud analysis platform with holding, and carries out translation group RNC-mRNAs and mRNA Sequencing data is compared.