CN106421787A - Tumor therapy medicine targeting SCNN1A and application - Google Patents
Tumor therapy medicine targeting SCNN1A and application Download PDFInfo
- Publication number
- CN106421787A CN106421787A CN201610706144.8A CN201610706144A CN106421787A CN 106421787 A CN106421787 A CN 106421787A CN 201610706144 A CN201610706144 A CN 201610706144A CN 106421787 A CN106421787 A CN 106421787A
- Authority
- CN
- China
- Prior art keywords
- scnn1a
- medicine
- group
- tumour
- cancer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/13—Amines
- A61K31/135—Amines having aromatic rings, e.g. ketamine, nortriptyline
- A61K31/137—Arylalkylamines, e.g. amphetamine, epinephrine, salbutamol, ephedrine or methadone
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Epidemiology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Emergency Medicine (AREA)
- Marine Sciences & Fisheries (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention relates to tumor therapy medicine targeting SCNN1A and application and belongs to the technical field of medicine. On one hand, the medicine for effectively treating tumors is provided and can target molecular SCNN1A; on the other hand, the invention provides application of SCNN1A gene medicine and/or SCNN1A agonist in tumor treatment. A new conception is provided for tumor treatment.
Description
Technical field
The invention belongs to technical field of pharmaceuticals, be specifically related to target anti-tumor medicine and the application of SCNN1A.
Background technology
Tumour is the killer of harm human health, and treatment means currently mainly are surgery excision, chemicotherapy, but treatment effect
Fruit and prognosis are unsatisfactory.Molecular targeted agents is a kind of new treatment means, and the generation development being primarily due to tumour is one
The process that multi-step, polygenes participate in.A series of oncogene and tumor suppressor gene（β-catenin, Forkhead Box, p53
Deng）Express imbalance in tumour, by promoting cell proliferation, strengthening the multi-signal such as cell invasion migration, inhibited apoptosis
Path participates in the vicious transformation of tumour.These unconventionality expression genes are the potential targeted moleculars for the treatment of tumour.
ENaC is the ion channel of non-voltage-dependent, including tri-subunits of α, β, γ, its basic physiological function is right
Sodium ion is oriented vertical transmembrane transport, and this has important function to the fluid and electrolyte balance maintaining epithelial cell both sides. SCNN1A
It is the α subunit of ENaC, ENaC function is played a leading role, its widely distributed Thyreoidine, kidney, colon, lungs and liver etc.
Tissue.SCNN1A abnormal expression and the generation of multiple diseases and develop closely related.
The present invention passes through large number of biological sample comparative analysis, the expression of discovery SCNN1A in colon cancer, lung cancer, liver cancer
Significantly reduce, further by inside and outside experiment discovery its with the propagation of tumour, attack closely related, be the molecule treating tumour
One of target.
Content of the invention
The problem existing for prior art, it is an object of the invention to design provides the cancer therapeutics of targeting SCNN1A
Thing and the technical scheme of application.
The described medicine for treating tumour, it is characterised in that this drug targeting SCNN1A gene.
The described medicine for treating tumour, it is characterised in that described tumour includes liver cancer, colon cancer and lung cancer.
The described medicine for treating tumour, it is characterised in that this medicine can improve the expression of SCNN1A.
The described medicine for treating tumour, it is characterised in that include that SCNN1A genomic medicine and/or SCNN1A are exciting
Agent.
The described medicine for treating tumour, it is characterised in that described SCNN1A genomic medicine comprises SCNN1A gene
CDNA, described SCNN1A gene does not limit species, preferably people source or mouse source SCNN1A, the core of described SCNN1A gene cDNA
Nucleotide sequence such as SEQ ID NO:Shown in 1.
The described medicine for treating tumour, it is characterised in that described SCNN1A genomic medicine is that strong promoter starts
Express SCNN1A albumen.
The described medicine for treating tumour, it is characterised in that described SCNN1A genomic medicine is for containing SCNN1A base
Because of the expression plasmid system of nucleotides of cDNA, slow virus system and adenovirus system.
The described medicine for treating tumour, it is characterised in that described SCNN1A activator is Terbutaline.
Described SCNN1A genomic medicine and/or SCNN1A activator answering in preparation liver cancer, colon cancer and lung cancer
With.
Described application, it is characterised in that described SCNN1A genomic medicine comprises SCNN1A gene cDNA, described
SCNN1A activator is Terbutaline.
First aspect present invention proposes a class and effectively treats the medicine of tumour, this medicine can targeted molecular SCNN1A, this
Invention second aspect proposes SCNN1A genomic medicine and/or application in oncotherapy for the SCNN1A activator.The present invention is
Treatment tumour provides a kind of new thinking.
Brief description
Expression in tumor tissues and tumour cell for Fig. 1 SCNN1A, wherein A：SCNN1A is human colon carcinoma, liver
The other comparative analysis of cancer, lung cancer and cancer, B：Quantitative expression result in human liver cell system and SMMC-7721 for the SCNN1A, C:
Immunofluorescence test result in the histotomy of clinical patient for the SCNN1A, D：SCNN1A is at mouse liver and SMMC-7721
Quantitative expression result in Hepa1-6；
Fig. 2 SCNN1A in vitro suppresses Hepa1-6 cell proliferation and invasion and attack result, wherein A:SCNN1A transfection Hepa1-6 obtains
The SCNN1A quantitative expression result of stable cell line, B-E group be Vitro Experimental Results, experiment be grouped into Hepa1-6 group,
PcDNA3.1 group, SCNN1A-pcDNA3.1 group, wherein B：MMT experimental result, C：Flow process detects cell cycle experimental result, D：
Cell colony experimental result；
The nude mice by subcutaneous lotus knurl result of Fig. 3 SCNN1A process LAN Hepa1-6, be grouped into Hepa1-6 group, pcDNA3.1 group,
SCNN1A-pcDNA3.1 group, wherein A：Each group knurl form and size measurement, B：Each group knurl remeasurement result, C：Each group knurl volume
Result of calculation.
The inhibition to nude mice by subcutaneous lotus knurl for Fig. 4 SCNN1A intratumor injection, is grouped into Hepa1-6 group, blank adenovirus
Group, SCNN1A adenovirus group, wherein A：The knurl cubing of each group and adenovirus living imaging testing result, B：Each group knurl stereometer
Calculate result.
The suppression result to liver in situ cancerous tissue for Fig. 5 tail vein injection SCNN1A, is grouped into model group, blank adenovirus
Group, SCNN1A adenovirus group.
The suppression result to nude mice by subcutaneous PDX for Fig. 6 tail vein injection SCNN1A, is grouped into model group, blank adenovirus group,
SCNN1A adenovirus group.
Fig. 7 SCNN1A activator, to the inhibition to liver cancer subcutaneous lotus knurl, is grouped into model group, Terbutaline group, rope
Fei Lani group, drug combination group.
The suppression result to tumor-bearing mice subcutaneous H1975 cancerous lung tissue for Fig. 8 SCNN1A adenovirus.
The suppression result to tumor-bearing mice subcutaneous SW620 colon cancer tissue for Fig. 9 SCNN1A adenovirus.
Detailed description of the invention
Embodiments of the invention are described below in detail, and the example of described embodiment is shown in the drawings, wherein from start to finish
Same or similar label represents same or similar element or has the element of same or like function.Below with reference to attached
The embodiment that figure describes is exemplary, is only used for explaining the present invention, and is not considered as limiting the invention.The present invention's
Second to the 7th embodiment is to illustrate to target application in oncotherapy for the medicine of SCNN1A with liver cancer for representative.
Expression analysis in tumor tissues for embodiment 1 SCNN1A
Use round pcr, have detected by human colon carcinoma and cancer respectively, by liver cancer and cancer, lung cancer and the other SCNN1A expression of cancer,
Each group case is respectively colon cancer tissue 355 case, colon cancer beside organism 19 case；Liver cancer tissue 13 case, liver cancer beside organism 7 case；Lung
Cancerous tissue 112 case, lung cancer beside organism 10 case.Result shows, colon cancer, liver cancer, cancerous lung tissue SCNN1A expression all notable
Less than cancer beside organism, such as Figure 1A.
Further in human liver cancer cell checking：Extract Human normal hepatocyte system LO2, SMMC-7721 Hep3B, Bel7407,
The mRNA of Huh7, HepG2, and use the expression of real-time fluorescence quantitative PCR detection SCNN1A, result display Hep3B,
In the clones such as Bel7407, Huh7, SCNN1A expresses conspicuousness and is less than normal liver cell system LO2, such as Figure 1B.Immunofluorescence test
In patient's liver cancer tissue and cancer beside organism's section, SCNN1A expresses, and is also equifinality, such as Fig. 1 C.Extract murine liver tissue, little
The mRNA of hepatoma cells Hepa1-6, Real_time quantitative detection SCNN1A express, and obtain the result similar with people source SCNN1A, as
Fig. 1 D.
Wherein, SCNN1A gene cDNA has SEQ ID NO:Sequence shown in 1.
Real-time quantitative primer such as table 1：
Table 1 SCNN1A real-time quantitative primer
| SCNN1A-F | CTGCTGGCTACTCAAGATGGC（SEQ ID NO:Shown in 2） |
| SCNN1A-R | AGGAGGCTGACCATCGTGAC（SEQ ID NO:Shown in 3） |
| GAPDH-F | TGTGTCCGTCGTGGATCTGA（SEQ ID NO:Shown in 4） |
| GAPDH-R | TTGCTGTTGAAGTCGCAGGAG（SEQ ID NO:Shown in 5） |
The In-vitro Inhibitory Effect to HCC Hepa1-6 for embodiment 2 SCNN1A
Being building up to the cDNA sequence of mouse source SCNN1A gene in eucaryon process LAN skeleton carrier pcDNA3.1, liposome method turns
Dye Hepa1-6 clone, transfects pcDNA3.1 empty carrier as comparison simultaneously.G418 screening obtains resistance clone, then passes through
Real-time quantitative PCR detection SCNN1A expresses, and chooses the close SCNN1A-pcDNA3.1#1 of hepatic tissue SCNN1A expression
Clone and the pcDNA3.1#1 close with Hepa1-6 expression carry out experiment in vitro.Wherein, quantitative result such as Fig. 2 A.
Respectively to Hepa1-6, pcDNA3.1-Hepa#1 (being called for short pcDNA3.1), SCNN1A-pcDNA3.1-Hepa#1（It is called for short
SCNN1A-pcDNA3.1) clone carries out MTT, cell cut, colony and streaming cycle detection detection SCNN1A to Hepa1-6
The growth inhibition of clone.
Surveying continuously 5 days and carrying out MTT dyeing to each group, Fig. 2 B result shows from second day beginning SCNN1A-pcDNA3.1 group
Cell concentration is just few than two groups of comparisons, only had about the 60% of control group by the 5th day, has significant difference, SCNN1A energy is described
Enough suppress the growth of SMMC-7721 Hepa1-6.MTT result is verified, such as Fig. 2 D result by colony experiment.
Cell scratch experiment shows, when 0 nondistinctive three groups, and after 24h, the spacing of SCNN1A-pcDNA3.1 group cut is bright
Aobvious increase, the crawling exercises ability of the Hepa1-6 cell of this explanation stable transfection Scnn1 α substantially weakens, thus demonstrates
SCNN1A can suppress the invasive ability of Hepa1-6 cell.
Cell streaming cycle detection result shows, SCNN1A-pcDNA3.1 group with two groups comparison compared with, S phase cell quantity
Reducing, G1 phase and G2 phase cell quantity increase（Such as Fig. 2 C）, this shows Scnn1 α process LAN by HCC Hepa1-6 growth resistance
Stagnant in the G1/S phase, thus suppress cell proliferation.
Finding based on the above results, SCNN1A in vitro can be by retardance Hepa1-6 cell in the G1/S phase, and suppression is thin
Born of the same parents breed, and also can suppress the invasive ability of cell simultaneously.
The nude mice by subcutaneous lotus knurl result of embodiment 3 SCNN1A process LAN Hepa1-6
15 male nude mouses are randomly divided into 3 groups, often organize 5, according to every inoculation 6 × 106Individual cell concentration, respectively will
It is subcutaneous that tri-groups of clones of SCNN1A-pcDNA3.1, pcDNA3.1, Hepa1-6 are inoculated into nude mice left upper extremity.After inoculation, every day observes
Have or not tumour to be formed.The 7th day after injection inoculation starts, and measures gross tumor volume size in required time.With diameter of tumor 3mm
It is considered as into knurl, record tumor size.With vernier caliper measurement transplantation tumor major diameter and minor axis, every 3 days 1 time, gross tumor volume
Calculate the volume size calculating tumour according to formula " gross tumor volume V=major diameter × minor axis × minor axis/2 ".Average body according to tumour
Long-pending, draw tumor growth curve.Putting to death nude mice after the size of the 15th day measurement tumour, tumor tissue is peeled off and is weighed.
Experimental result shows, the volume of Scnn1 α process LAN Hepa1-6 groups of cells transplanted tumor in nude mice is apparently higher than empty plasmid
Group and untransfected group（P<0.01）, empty plasmid transfection group and untransfected group comparing difference not statistically significant, such as Fig. 3.Thus say
Bright, SCNN1A is possible not only in vitro suppress the propagation of HCC Hepa1-6 to attack, subcutaneous lotus knurl model experiment in vivo also
Demonstrate the inhibitory action to liver cancer model for the SCNN1A.
The liver cancer treatment effect of embodiment 4 SCNN1A suppression nude mice by subcutaneous lotus knurl
SCNN1A is building up in the adenovirus vector with green fluorescence, and is packaged into virus liquid and tests.
4-8 week old male nude mouse 40, Animal House concentration raising, abundant feeding, mouse growth is good.Hepa1-6 is thin
Adjusting concentration after born of the same parents' digestion is 1 × 107/ ml, is inoculated into nude mice left upper extremity subcutaneous.
Proportionately knurl size homogeneity principle, selects 30 to be divided into three groups with table of random number, often organizes 10, is grouped into model
Group, blank adenovirus group, SCNN1A adenovirus group.Carry out intratumor injection adenovirus at the 7th day and the 11st day.Wherein, blank gland
Virus and SCNN1A adenovirus group injection dosage are 1 × 1012The each 15ul of VP/ml, model group injects 15ul physiological saline.
After injection, every 4 days measurement tumor sizes, record 3 times, calculate and press formula：Major diameter × wide footpath × wide footpath/2 calculate tumour
Volume.Put to death nude mice after 15 days, dissect and peel off tumour, visually observe tumor tissues situation, and use small animal living body image checking
Fluorescence intensity in knurl.
Contrasting with model group and blank adenovirus group, the growth of tumour after being administered in Scnn1 α knurl is substantially pressed down
System, such as Fig. 4.
Wherein, adenoviral injection dosage is selected from 1 × 103VP/ml to 1 × 1016Between VP/ml optionally, it is preferable that injection
Amount is 1 × 1012VP/ml.
The inhibition to liver cancer primary tumor for embodiment 5 SCNN1A
The Hepal-6 cell suspension 2ml of 5 × 105/ml is passed through tail i.v. bolus, 5s by 4-8 week old male nude mouse 15
Inside complete.15th day, mouse is divided into three groups, often organizes 3, respectively model group, blank adenovirus group, Scnn1 α adenovirus
Group.Virus group tail vein injection dosage is 3 × 1010Adenovirus 2ml of VP/ml, model group injects 2ml physiological saline.20th day
Inject again once.Within 23rd day, put to death mouse.
Dissect each group of mouse, it has been observed that there is many places tumor tissues on model group and blank adenovirus group liver, and Scnn1 α
Tumor tissue on adenovirus group liver is few and little, such as Fig. 5.Result illustrates, SCNN1A also has preferably suppression to original position liver cancer
Effect.
The inhibition to PDX for embodiment 6 SCNN1A
Take the fresh sterile liver cancer tissue sample that clinical operation cuts, select tumour vigor preferably to organize, will be swollen with tissue shear
Tumor tissue is cut into the fritter of about 1 mm × 2, mm × 2 mm, and rear load mixed with Matrigel inoculates nude mice left upper extremity
Subcutaneous.15th day, mouse is divided into three groups, often organizes 3, respectively model group, blank adenovirus group, SCNN1A adenovirus group.
Virus group tail vein injection dosage is 3 × 1010Adenovirus 2ml of VP/ml, model group injects 2ml physiological saline.Within 20th day, note again
Penetrate once.Within 24th day, put to death mouse.
Compared with model group and blank adenovirus group, the subcutaneous tumors poor growth of SCNN1A adenovirus group, knurl volume is obvious
Less, such as Fig. 6, show that SCNN1A can suppress the growth of PDX rat liver cancer tissue.
The result for the treatment of to subcutaneous lotus knurl liver cancer model for the embodiment 7 SCNN1A activator
4-8 week old Female nude mice 40, Animal House concentration raising, abundant feeding, mouse growth is good.Hepa1-6 cell is disappeared
Adjusting concentration after change is 1 × 107/ ml, is inoculated into nude mice left upper extremity subcutaneous.
7th day proportionately knurl size homogeneity principle be divided into 4 groups, often organize 10, be model group respectively, Terbutaline group, rope
Fei Lani group, drug combination group.Start intraperitoneal administration according to packet respectively, Terbutaline 12.5ug/, Sorafenib 2mg/
Only, associating is all given, and model gives isopyknic physiological saline.It is administered once daily, successive administration 5 days, within the 11st day, process.
Respectively organizing knurl volume and knurl weight, Terbutaline, Sorafenib and drug combination group tumor tissue are relatively slower, such as figure
7, show the growth of SCNN1A activator suppression rat liver cancer tissue.
Equally, test as identical in embodiment 2-7 is carried out to colon cancer and lung cancer, be finally also able to verify that and targetted
Application in colon cancer and lung cancer therapy for the medicine of SCNN1A.
The lung cancer therapy effect of embodiment 8 SCNN1A suppression nude mice by subcutaneous lotus knurl
SCNN1A is building up in the adenovirus vector with green fluorescence, and is packaged into virus liquid and tests.
4-8 week old male nude mouse 40, Animal House concentration raising, abundant feeding, mouse growth is good.By H1975 lung cancer
Adjusting concentration after cell dissociation is 1 × 107/ ml, is inoculated into nude mice left upper extremity subcutaneous.
Proportionately knurl size homogeneity principle, selects 30 to be divided into three groups with table of random number, often organizes 10, is grouped into model
Group, blank adenovirus group, SCNN1A adenovirus group.Carry out intratumor injection adenovirus at the 7th day and the 11st day.Wherein, blank gland
Virus and SCNN1A adenovirus group injection dosage are 1 × 1012The each 15ul of VP/ml, model group injects 15ul physiological saline.After injection
Within 15th day, put to death nude mice, dissect and peel off tumour, visually observe tumor tissues situation, and weigh knurl weight.
Compared with model group and blank adenovirus group, the subcutaneous tumors poor growth of SCNN1A adenovirus group, knurl volume is obvious
Less, such as Fig. 8, show that SCNN1A can suppress the growth of the subcutaneous cancerous lung tissue of tumor bearing nude mice.
The treatment of colon cancer effect of embodiment 9 SCNN1A suppression nude mice by subcutaneous lotus knurl
SCNN1A is building up in the adenovirus vector with green fluorescence, and is packaged into virus liquid and tests.
4-8 week old male nude mouse 40, Animal House concentration raising, abundant feeding, mouse growth is good.By SW620 colon
Adjusting concentration after cancer cell digestion is 1 × 107/ ml, is inoculated into nude mice left upper extremity subcutaneous.
Proportionately knurl size homogeneity principle, selects 30 to be divided into three groups with table of random number, often organizes 10, is grouped into model
Group, blank adenovirus group, SCNN1A adenovirus group.Carry out intratumor injection adenovirus at the 7th day and the 11st day.Wherein, blank gland
Virus and SCNN1A adenovirus group injection dosage are 1 × 1012The each 15ul of VP/ml, model group injects 15ul physiological saline.After injection
Within 15th day, put to death nude mice, dissect and peel off tumour, visually observe tumor tissues situation, and weigh knurl weight.
Compared with model group and blank adenovirus group, the subcutaneous tumors poor growth of SCNN1A adenovirus group, knurl volume is obvious
Less, such as Fig. 9, show that SCNN1A can suppress the growth of the subcutaneous colon cancer tissue of tumor bearing nude mice.
SEQUENCE LISTING
<110>Zhejiang Academy of Medical Sciences
<120>The anti-tumor medicine of targeting SCNN1A and application
<130> 1
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 2103
<212> DNA
<213>People or mouse
<400> 1
atgatgctgg accacaccag agcccctgag ctcaaccttg acctagacct tgacgtctcc 60
aactcaccga agggatccat gaagggcaac aatttcaagg agcaagacct ttgtcctcct 120
ctgcccatgc aaggactggg caagggggac aagcgtgaag aacaggcgct gggcccggaa 180
ccctcagagc cccggcagcc caccgaggag gaggaggcac tgatcgagtt ccaccgctcc 240
taccgggagc tcttccagtt cttctgcaac aataccacca tccacggtgc catccgcctg 300
gtgtgctcca agcacaaccg catgaagacg gccttctggg cggtgctctg gctctgcacc 360
ttcggcatga tgtactggca gtttgctttg ctgttcgagg aatacttcag ctaccccgtg 420
agtctcaaca tcaacctcaa ttcggacaag ctggtcttcc ctgccgtcac tgtgtgcacc 480
cttaatcctt acagatacac tgaaattaaa gaggatctgg aagagctgga ccgcatcacg 540
gaacagacgc tttttgacct gtacaaatac aactcttcct acactcgcca ggctgggggc 600
cgccgccgca gcacccgcga cctccggggt gctctcccac accccctgca gcgcctgcgc 660
acaccacctc cgcccaatcc cgcccgctcg gcgcgcagcg cgtcctccag tgtacgcgac 720
aacaatcccc aagtggacag gaaggactgg aaaatcggct tccaactgtg caaccagaac 780
aaatcagact gcttctacca gacatactca tccggggtgg atgccgtgag agaatggtac 840
cgcttccatt acatcaacat tctgtccaga ctgcccgaca cctcgcctgc tctagaggaa 900
gaagccctgg gcagcttcat ctttacctgt cgtttcaacc aggccccctg caatcaggcg 960
aattattctc agttccacca ccccatgtat gggaactgct acactttcaa caacaagaac 1020
aactccaatc tctggatgtc ttccatgcct ggagtcaaca atggtttgtc cctgacactg 1080
cgcacagagc agaatgactt catccccctg ctgtccacag tgacgggggc cagggtgatg 1140
gtgcacggtc aggatgagcc tgcttttatg gatgatggtg gcttcaacgt gaggcctggt 1200
gtggagacct ccatcagtat gagaaaggaa gccctggaca gcctcggagg caactacgga 1260
gactgcactg agaatggcag tgatgtccct gtcaagaacc tttacccctc caagtacaca 1320
cagcaggtgt gcattcactc ctgcttccag gagaacatga tcaagaagtg tggctgtgcc 1380
tacatcttct accctaagcc caagggtgta gagttctgtg actacctaaa gcagagctcc 1440
tggggctact gctactataa actgcaggct gccttctcct tggatagcct gggctgcttc 1500
tccaagtgca ggaagccgtg cagtgtgacc aactacaagc tctctgctgg ctactcaaga 1560
tggccgtctg tgaagtccca ggattggatc ttcgagatgc tatccttgca gaataattac 1620
acgatcaaca acaaaagaaa cggagttgct aaactcaaca tcttcttcaa agagctgaac 1680
tataaaacta attcggagtc tccctctgtc acgatggtca gcctcctgtc caacctgggc 1740
agccagtgga gcctgtggtt cggctcatct gtgctgtccg tggtggaaat ggcggagctc 1800
atcttcgacc tcctggtcat cacactcatc atgttactgc acaggttccg gagccggtac 1860
tggtctccag gacgaggggc caggggtgcc agggaggtgg cctctacccc agcttcctcc 1920
ttcccttccc gtttctgtcc ccaccctaca tccccgccac cttctttgcc ccagcagggc 1980
acgacccctc ccctggccct gacagcccct ccacctgcct atgctaccct aggcccctct 2040
gcctctccac tggactcggc tgtgcctggc tcttctgcct gtgctccggc catggcactc 2100
tga 2103
<210> 2
<211> 21
<212> DNA
<213>Prof. Du Yucang
<400> 2
ctgctggcta ctcaagatgg c 21
<210> 3
<211> 20
<212> DNA
<213>Prof. Du Yucang
<400> 3
aggaggctga ccatcgtgac 20
<210> 4
<211> 20
<212> DNA
<213>Prof. Du Yucang
<400> 4
tgtgtccgtc gtggatctga 20
<210> 5
<211> 21
<212> DNA
<213>Prof. Du Yucang
<400> 5
ttgctgttga agtcgcagga g 21
Claims (10)
1. for treating the medicine of tumour, it is characterised in that this drug targeting SCNN1A gene.
2. the medicine for treating tumour as claimed in claim 1, it is characterised in that described tumour includes liver cancer, colon cancer
And lung cancer.
3. the medicine for treating tumour as claimed in claim 1, it is characterised in that this medicine can improve the table of SCNN1A
The amount of reaching.
4. the medicine for treating tumour as described in claim 1 or 2 or 3, it is characterised in that include SCNN1A genomic medicine
And/or SCNN1A activator.
5. the medicine for treating tumour as claimed in claim 4, it is characterised in that described SCNN1A genomic medicine comprises
SCNN1A gene cDNA, described SCNN1A gene does not limit species, preferably people source or mouse source SCNN1A, described SCNN1A base
Nucleotide sequence such as SEQ ID NO because of cDNA:Shown in 1.
6. the medicine for treating tumour as claimed in claim 4, it is characterised in that described SCNN1A genomic medicine is strong
Promoter starts expresses SCNN1A albumen.
7. the medicine for treating tumour as claimed in claim 4, it is characterised in that described SCNN1A genomic medicine for containing
Have expression plasmid system, slow virus system and the adenovirus system of the nucleotides of SCNN1A gene cDNA.
8. the medicine for treating tumour as claimed in claim 4, it is characterised in that described SCNN1A activator is special cloth
His woods.
9.SCNN1A genomic medicine and/or application in preparation liver cancer, colon cancer and lung cancer for the SCNN1A activator.
10. apply as claimed in claim 9, it is characterised in that described SCNN1A genomic medicine comprises SCNN1A gene
CDNA, described SCNN1A activator is Terbutaline.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610706144.8A CN106421787A (en) | 2016-08-23 | 2016-08-23 | Tumor therapy medicine targeting SCNN1A and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610706144.8A CN106421787A (en) | 2016-08-23 | 2016-08-23 | Tumor therapy medicine targeting SCNN1A and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106421787A true CN106421787A (en) | 2017-02-22 |
Family
ID=58181633
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610706144.8A Pending CN106421787A (en) | 2016-08-23 | 2016-08-23 | Tumor therapy medicine targeting SCNN1A and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106421787A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050084872A1 (en) * | 2003-01-24 | 2005-04-21 | Lum Pek Y. | Methods for determining whether an agent possesses a defined biological activity |
| EP2245057A1 (en) * | 2008-01-25 | 2010-11-03 | Chromocell Corporation | Novel cell lines expressing enac and methods using them |
| CN105125576A (en) * | 2015-09-23 | 2015-12-09 | 广东省第二人民医院 | Pharmaceutical composition containing titanium dioxide nanoparticles for preventing or treating cancer and application thereof |
-
2016
- 2016-08-23 CN CN201610706144.8A patent/CN106421787A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050084872A1 (en) * | 2003-01-24 | 2005-04-21 | Lum Pek Y. | Methods for determining whether an agent possesses a defined biological activity |
| EP2245057A1 (en) * | 2008-01-25 | 2010-11-03 | Chromocell Corporation | Novel cell lines expressing enac and methods using them |
| US20160237136A1 (en) * | 2008-01-25 | 2016-08-18 | Chromocell Corporation | NOVEL CELL LINES EXPRESSING ENaC and METHODS USING THEM |
| CN105125576A (en) * | 2015-09-23 | 2015-12-09 | 广东省第二人民医院 | Pharmaceutical composition containing titanium dioxide nanoparticles for preventing or treating cancer and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| ZHANG X ET AL: "Mus musculus sodium channel, nonvoltage-gated 1 alpha (Scnn1a), mRNA", 《GENEBANK DATABASE》 * |
| ZHENZHEN ZHANG，ET AL.: "miR-125b inhibits hepatitis B virus expression in vitro through targeting of the SCNN1A gene", 《ARCH VIROL》 * |
| 彭朝胜，等: "特布他林对海水浸泡人肺泡上皮细胞钠水转运通道的影响", 《中华医学会航海医学分会第九次学术会议暨全军第九届航海医学专业委员会第一次学术会议论文集》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Dai et al. | Targeting CAMKII to reprogram tumor-associated macrophages and inhibit tumor cells for cancer immunotherapy with an injectable hybrid peptide hydrogel | |
| Yang et al. | Genetic engineering of human stem cells for enhanced angiogenesis using biodegradable polymeric nanoparticles | |
| Mao et al. | MicroRNA-23a is involved in tumor necrosis factor-α induced apoptosis in mesenchymal stem cells and myocardial infarction | |
| CN107075515A (en) | C/EBP α compositions and application method | |
| CN105983103A (en) | Application of genetically engineered bacterium VNP-20009-M in preparation of medicines for preventing and treating cancer metastasis | |
| JP2012001566A (en) | Method for treating solid tumor and metastasis by gene therapy | |
| CN105079821A (en) | Application of long noncoding RNA HNF1A-AS1 ((hepatocyte nuclear factor-1Alpha Antisense 1) in preparation of drugs for treating human malignant solid tumors | |
| Wan et al. | Peptide hydrogels loaded with irradiated tumor cell secretions enhance cancer immunotherapy | |
| Yang et al. | “Star” miR-34a and CXCR4 antagonist based nanoplex for binary cooperative migration treatment against metastatic breast cancer | |
| Sultan et al. | Exploring small nucleolar RNA host gene 3 as a therapeutic target in breast cancer through metabolic reprogramming | |
| CN103290029A (en) | Survivin promoter mediated recombinant vector for expressing Gelonin phytotoxin genes and usage thereof | |
| CN105534956A (en) | Anticancer miRNA (microRNA)-based medicinal composition for treating esophageal cancer | |
| CN106421787A (en) | Tumor therapy medicine targeting SCNN1A and application | |
| CN114306614A (en) | Biological response immune gel and preparation method and application thereof | |
| Zhu et al. | CXC motif chemokine receptor type 4 disrupts blood-brain barrier and promotes brain metastasis through activation of the PI3K/AKT pathway in lung cancer | |
| CN112999211A (en) | Application of ceramide molecule in preparation of medicine for inhibiting esophageal squamous cell carcinoma metastasis | |
| Hanyu et al. | Immunogene therapy by adenovirus vector expressing CD40 ligand for metastatic liver cancer in rats | |
| Jin et al. | Robust anti-tumor immunity through the integration of targeted lipid nanoparticle-based mRNA nanovaccines with PD-1/PD-L1 blockade | |
| CN105543182A (en) | Recombinant oncolytic bovine vaccine virus carrying microRNA-101 and drug composition of recombinant oncolytic bovine vaccine virus | |
| CN110960546A (en) | Application of MicroRNAs in preparation of reinforcing agent for treating liver cancer by sorafenib | |
| Rossmeisl et al. | EXTH-43. Effective treatment of canine spontaneous gliomas with a cytotoxic cocktail targeting Il-13ra2 And Epha2 receptors | |
| CN104840976A (en) | MiR125 and use thereof in regulating protooncogene Pokemon expression | |
| US20240002855A1 (en) | Nucleic Acid Molecule Binding to YB-1 Protein | |
| WO2022127788A1 (en) | Application of lenvatinib and aurora-a kinase inhibitor in preparing cancer-inhibiting drugs | |
| CN107217054A (en) | The application of G6PD genes and its expression product in treatment colorectal cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170222 |