CN106399477A - Tumor circulation DNA technical detection-cancer early-stage easy-to-occur risk assessment data method - Google Patents
Tumor circulation DNA technical detection-cancer early-stage easy-to-occur risk assessment data method Download PDFInfo
- Publication number
- CN106399477A CN106399477A CN201610761919.1A CN201610761919A CN106399477A CN 106399477 A CN106399477 A CN 106399477A CN 201610761919 A CN201610761919 A CN 201610761919A CN 106399477 A CN106399477 A CN 106399477A
- Authority
- CN
- China
- Prior art keywords
- dna
- detection
- gene
- tumor
- value
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
A novel circulation DNA detection method is applied to assess the cancer early-stage prevalence risk. Characteristics of circulation DNA are utilized to prepare multi-hole-diameter netted nanometer particles for gathering and extracting free small DNA fragments released to plasma by tumor cells located in plasma. The multi-hole-diameter netted nanometer particles are designed to obviously increase the area for gathering ctDNA and are high in gathering efficiency. Hole diameters with different sizes are designed to gather 100-300 bp free small fragments, which can smoothly pass the holes formed in the nanometer particles and stay inside the nanometer particles. Through centrifugation at a certain rotation speed, the free small DNA fragments and the nanometer particles are gathered at the bottom of a centrifuge tube. The method specifically has the following advantages: the extraction and gathering time of ctDNA is shortened, the cost is reduced, a calculated curve is drawn by taking the CT value as a Y axis and the DNA mass as an X axis, and a computational formula is obtained. The copy number range of tumor susceptible genes of the normal healthy group in plasma is determined. The cancer prevalence risk is assessed according to the normal reference range.
Description
Technical field
The invention belongs to clinical auxiliary detects applied patent, more particularly, in blood plasma, the extraction of Circulating DNA and cancer are early
Phase risk assesses the foundation of detection method, specially a kind of method for quick of cancer early stage risk assessment.
Background technology
CtDNA (circulating tumor DNA), abbreviation Circulating tumor DNA, refer to the DNA release in tumour cell
The fragment of the 100-300bp in blood circulation system.In blood free small fragment DNA early in nineteen forty-seven by Mandel and
Metais finds, but due to lacking sensitivity and specific test method, leads to correlation research to be made slow progress, until extracting
The technology of free small pieces segment DNA occurs, and application in detection technique for the combined with fluorescent quantitative PCR technology, will be clinical tumor
Early diagnosis, the determination of therapeutic scheme, observation of curative effect, prognosis evaluation, shift risk analysis；The aspects such as recurrence monitoring provide huge
Big clinical reference value.Sozzi et al. find in the patients with lung cancer of I phase Circulating tumor DNA Already in blood with
And the DNA microsatellite of correlation also changes；Sozzi finds for 38 patient's follow-up studies having carried out operation of lung cancer,
No patients with recurrent has 35 people, and the content of the cycling tumor DNA in 6 middle of the month blood after surgery is substantially less than preoperative average water
Flat, but in 3 people that are substantially doubled and redoubled of postoperative ctDNA, there are 2 people to die from hepatic metastases in postoperative 2 months, another example is then in Second Year
After recur, this explanation cycling tumor DNA and tumour state of an illness detection is closely related.Mulcahy HE etc. artificially suffers from the trouble of cancer of pancreas
Person carries out detection and finds that in blood plasma, DNA K-ras there occurs mutation, mutation rate up to more than 80%, wherein has 4 to be pancreatitis
Patient find in serum K-ras be mutated, be diagnosed as cancer of pancreas in a year afterwards.Illustrate that ctDNA has tumour early
Phase diagnosis capability, therefore also further illustrates, if persistently risen for the patient cycling tumor DNA accepting oncotherapy
Height, then therapeutic scheme should again draft, and the patient of continuous decrease then illustrated still in the paracmasis.CtDNA is as the mark of tumour
Will thing, plays a significant role in diagnosing tumor, treatment, prognosis context of detection.CtDNA mutation in blood plasma and the group of tumor patient
Knit specific consistent property, make benign cell abnormality proliferation, Apoptosis increases, and then leads to ctDNA in blood also to increase therewith
Plus, by more accurately qualitative and quantitative to ctDNA, can preferably be applied to clinic.But currently without a kind of good
Method goes to realize cancer early stage risk assessment.
Content of the invention
Goal of the invention：The present invention provides a kind of method carrying out cancer early stage risk assessment using cycling tumor DNA detection,
Its objective is to solve the problems of in the past.
Technical scheme：
A kind of new Circulating DNA detection method be applied to cancer early stage risk assessment it is characterised in that：Using circulation
The characteristic of DNA, prepares the free small pieces segment DNA that the netted nano particle of multiple aperture is discharged in blood plasma to tumour cell in blood plasma
It is enriched with and is extracted, the design of multiple aperture mesh nano particle is made the area of enrichment ctDNA substantially increase, and bioaccumulation efficiency is more
Height, the free small fragment that different size of aperture design can only be directed to 100～300bp is enriched with, and these free small fragments can
To pass through aperture on nano particle, and rest on inside nano particle, make free small pieces through the centrifugation of certain rotating speed
Segment DNA is enriched to centrifugation bottom of the tube together with nano particle.And then can not be by receiving without the larger dissociative DNA of the fragment cleared up
Aperture in rice grain and then foreclose, with the presence of centrifugation and other reagent disallowable fall.
With the tumor tissues genomic DNA of known quality as template, carry out different gradient dilutions, using having tomour specific
Property gene and its hot spot mutation design molecular probe carry out QPCR detection.With the quality of genomic DNA as X-axis, QPCR detects
The CT value obtaining is Y-axis draw calculation curve, obtains computing formula and calibration curve.
Using the computing formula obtaining and calibration curve, we have collected 50 healthy population samples, using in this patent
Blood plasma in free small fragment DNA extraction kit ctDNA in blood plasma carried out with enrichment extract, with the ctDNA that extracts as template
And carry out QPCR detection using the gene with tumour-specific and its hot spot mutation design molecular probe, obtain QPCR detection
Minimum CT value and highest CT value, are brought in the computing formula that obtains when drawing calibration curve respectively, are calculated X value, and 10xI.e.
For this gene copy number in QPCR template applied sample amount volume contained, using new formula (10x× a)/2b calculates every milliliter of blood
In slurry, (wherein a is ctDNA cumulative volume to this gene copy number；B is QPCR loading template volume) and then calculate contained in blood plasma
The peak of this gene copy number and minimum.
After unknown sample is detected using this detection method, can be right according to the interval at the gene copy number place obtaining
The height of tumor susceptibility is judged.In disturbing factors such as exclusion patient age, personal work and rest custom and recent inflammatory reactions,
Assess whether this gene copy numerical value exception.Regulation detection range is normal, tumor susceptibility relatively low it is proposed that every 6 months
Once rechecked；Detection range is higher value, and tumor susceptibility is higher it is proposed that every 3 months are once rechecked；Detection range
For high level, tumor susceptibility is apparently higher than healthy population it is proposed that every 2 weeks are once rechecked, if rechecking result sustained high value,
Enter the tumour high-incidence season, the frequency that hospital image detects should be increased, in tumour early detection and undertaking therapy.
A kind of cycling tumor DNA is qualitative and quantitative formed cancer early stage easily send out risk assessment data method it is characterised in that：Bag
Include following steps：Human plasma preparation and Circulating DNA extraction, the detection of Circulating DNA extracts kit sensitivity technique, Circulating DNA
Method is set up, and determines that detection method, testing result calculate and determine detection range；
This method mainly utilizes the characteristic of Circulating DNA, prepares the netted nano particle of multiple aperture to tumour cell in blood plasma
The free small pieces segment DNA being discharged in blood plasma is enriched with and is extracted, and with tumor tissues genomic DNA as template, carries out difference
Gradient dilution, carries out QPCR detection using the gene with tumour-specific and its hot spot mutation design molecular probe, with gene
The quality of group DNA is X-axis, and the CT value that QPCR detection obtains is Y-axis draw calculation curve, obtains computing formula.
The step of the method is as follows：
(1) determine that tumor susceptibility gene detection computational methods and nominal reference are interval：
Prepared by (a), template：
Cancerous tissue genomic DNA sample, can measure DNA concentration using Nanodrop or the nucleic acids instrument of quality is carried out
Measurement, different according to DNA concentration, DNA is diluted respectively different gradients, the DNA after to dilute carries out QPCR detection for template；Inspection
Survey result in CT value as Y-axis, with the quality of template DNA for X-axis draw mapping curve and obtain y=kx+b type computing formula and
R2Value；
(b), design of primers：
Obtain the higher site of the tumor susceptibility gene frequency of mutation in NCBI or other databases and document, by this gene
Gene order copy out from NCBI, choose one of hot spot mutation, protogene sequence slight changes are become gene to dash forward
Sequence after change, using the such as primer-design software such as DNAMAN, Oligo, Primer5, carries out molecular probe design, molecular probe
Design principle is：Last bit base of upstream forward primer is consistent with site base after mutation, or reverse downstream primer is anti-
Consistent with site base after mutation to last bit base of complementary series；Amplified fragments size is between 90～120bp；
C (), QPCR detect：Operated using the explanation of any SYBR Green QPCR detection kit；
D (), nominal reference are interval to determine：
Collect normal non-tumor patient 50, extract ctDNA respectively, and carry out QPCR detection using above method, detection
The CT value that result obtains is brought in computing formula y=kx+b that template prepares as Y value, draws X value, and 10xIt is mould
This contained gene copy number in plate applied sample amount 2ul ctDNA, using new formula (10x× a)/2b calculates in every milliliter of blood plasma
(wherein a is ctDNA cumulative volume to this gene copy number；B is QPCR loading template volume).By the detection of 50 healthy populations,
Obtain peak and minimum that QPCR detects tumor susceptibility gene copy number, when being detected, gene for unknown sample
Individuality between peak and minimum scolded by copy, as normal level detection range, to the neurological susceptibility of tumour relatively
Low.
Carry out testing result explanation after the interval determination of nominal reference：
Testing result is divided into low, higher, high three intervals；Testing result display gene copy numerical value is low, then easy to tumour
Perception is low, and such crowd is once rechecked every half a year；Testing result display gene copy number is higher, then to tumor susceptibility relatively
Height, such crowd suggestion is once rechecked for every 3 months；Testing result display gene copy number is close or has exceeded normal model
Enclose, then belong to tumor susceptibility people at highest risk, such crowd suggestion is once rechecked for every 2 weeks.
The disturbing factors such as exclusion patient age, personal work and rest custom and recent inflammatory reaction, assess this gene copy numerical value
Whether exception occurs；Regulation detection range is normal, and tumor susceptibility is relatively low it is proposed that every 6 months are once rechecked；Detection model
Enclose for higher value, tumor susceptibility is higher it is proposed that every 3 months are once rechecked；Detection range is high level, and tumor susceptibility is bright
Aobvious height if rechecking result sustained high value, enters the tumour high-incidence season with healthy population it is proposed that per two weeks is once rechecked, should
Increase the frequency that hospital image detects, in tumour early detection and undertaking therapy.
(1) in step template preparation：Draw calculation curve simultaneously obtains computing formula, just should cover in the calculated curve of drafting
The often minimum of CT value detection range and peak, the k in y=kx+b in computing formula is negative value, and that is, CT value is bigger, reaches threshold
During value, this gene copy number is less；B should be greater than the peak of normal CT value detection range.
(2) in step design of primers：With tumor tissues genomic DNA as template, carry out different gradient dilutions, using having
The gene of tumour-specific and its hot spot mutation design molecular probe carry out QPCR detection, tumor susceptibility gene comprise NCBI and its
Related full gene ill to cancer in his database, tumor susceptibility gene hot spot mutation is pin in NCBI and other databases
Various cancers patient is carried out with the higher gene loci of the frequency of mutation that finds during gene order-checking, by protogene sequence slightly
Change over the sequence after gene mutation, carry out molecular probe design using the special software of design of primers, molecular probe designs
Principle is：Last bit base of upstream forward primer is consistent with site base after mutation, or the reverse mutual of reverse downstream primer
Last bit base of complementary series is consistent with site base after mutation；Amplified fragments size is between 90～120bp.
(3) QPCR detection in step：Circulating DNA extracts kit sensitivity technique, this method kit and QIAGEN examination
Agent box carries out ctDNA extraction, and the ctDNA obtaining carries out QPCR detection, and ctDNA is diluted to different quality, with different quality
CtDNA is template, arbitrarily designs any one gene primer and carries out QPCR detection, the minimum ctDNA of this method kit detects matter
Amount is less than 18.8ng, and CT value is 26.21；QIAGEN kit minimum ctDNA detection quality is 39.2ng, and CT value is 27.01.
Easily send out risk assessment data method using the above-mentioned qualitative and quantitative cancer that formed of cycling tumor DNA in cancer early in early days
Phase easily send out application in risk assessment it is characterised in that：Cancerous tissue extracting genome DNA, this extraction and application arbitrarily organizes base
Because group DNA extraction kit is extracted；Prepare multiple aperture netted nano particle tumour cell in blood plasma is discharged in blood plasma
Free small pieces segment DNA is enriched with and is extracted, and multiple aperture mesh nano particle is mainly modified to nano grain surface,
Multiple adsorption holes are designed on single nano particle and forms net surface structure, under the auxiliary of lysate and Proteinase K, by blood plasma
Non- small pieces segment DNA cleared up, and then retain the free small fragment of 100-300bp, these free small fragments can smoothly lead to
Cross aperture on nano particle, and rest on inside nano particle, make free small pieces segment DNA and receive through the centrifugation of certain rotating speed
Rice grain is enriched to centrifugation bottom of the tube together；And then can not be by nano particle without the larger dissociative DNA of the fragment cleared up
Aperture so that foreclose, with centrifugation and other reagent in the presence of disallowable fall；Blood plasma mainly divides from blood of human body
From the blood plasma obtaining；Circulating DNA is the free small pieces segment DNA that in blood plasma, tumour cell is discharged into 100～300bp in blood,
Then the scope assessing this gene copy numerical value and above-mentioned determination compares and determines whether exception.
1) add 1ml plasma sample in 2ml EP pipe, add 1ml lysis buffer, 30 μ l Proteinase Ks and 60 μ
L nano particle adsorbs magnetic bead.Fully reverse mixing 5min.
2) centrifuge, 12000rpm are put into by mixing sample, normal temperature is centrifuged 3min, and it is (such as more to obtaining that supernatant is abandoned in suction
CtDNA, then repeat step 1,2)；
3) add 1ml wash buffer I in the pipe containing precipitation, repeatedly blown and beaten with liquid-transfering gun, will precipitate fully outstanding
Floating uniform.Put into centrifuge, normal temperature is centrifuged, 13000rpm, 1min.Supernatant is abandoned in suction.
4) add 1ml wash buffer II in the pipe containing precipitation, repeatedly blown and beaten with liquid-transfering gun, will precipitate fully
Suspend uniformly.
5) put into centrifuge, normal temperature is centrifuged, 13000rpm, 1min.Supernatant is abandoned in suction.
6) so that centrifuge tube is kept under uncapped state, heat 3min in 56 DEG C of water-baths, to vapor away the wash failing to exhaust
buffer II.
7) add 50～70 μ l EB buffer solutions, the bead precipitation of abundant suspension ttom of pipe, cover tightly lid, in 56 DEG C of water-baths
15min；
8) take out centrifuge tube and be centrifuged 3min in 14000rpm；
9) gained supernatant is DNA solution, is moved it into liquid-transfering gun and newly manages；DNA is placed in -20 DEG C and saves backup.
Advantage and effect：
The present invention provides a kind of method carrying out cancer early stage risk assessment using cycling tumor DNA detection, the application master
The extraction of ctDNA and detection method in a kind of new blood plasma are provided, and this detection method can be applicable to cancer early stage ill wind
Danger is assessed, and by the copy number detection in ctDNA to tumor susceptibility gene, the risk of a certain cancer of assessment, works as base
Because copy number is higher than substantially and persistently it is meant that coming into the tumour high-incidence season during normal prescribed limit, hospital should be gone in time to enter
Row imaging examination, strives accomplishing in tumor invasion early detection and undertaking therapy.This detection method can be applicable to various tumours
Tumor susceptibility gene and cancer, and Cleaning Principle is clear, simple to operate, the used time is short, and testing result accurately and reliably, is prior to iconography inspection
The important cancer risk evaluation measures surveyed.
Concrete advantage is as follows：
1st, invent a kind of new Circulating DNA extracts kit, shorten ctDNA and extract and enrichment time, reduces cost, for reality
Existing industrialization lays the foundation.
2nd, invent a kind of new ctDNA detection method, design molecular probe using tumor susceptibility gene hot spot mutation, with cancer
Disease tissue gene group DNA carries out QPCR reaction for template.With CT value as Y-axis, DNA mass is X-axis draw calculation curve and obtains
Computing formula.
3rd, determine copy number scope in blood plasma for the normal health crowd's tumor susceptibility gene.
4th, utilize tumor susceptibility gene hot spot mutation, QPCR detection is carried out for template with ctDNA, calculates tumor susceptibility base
Because of the copy number in ctDNA, cancer risk is assessed according to normal reference range.
Brief description：
Fig. 1 is：Tumor susceptibility gene KRAS copy number tendency chart and computing formula in one cancerous lung tissue genomic DNA；
Specific embodiment
A kind of cycling tumor DNA is qualitative and quantitative formed cancer early stage easily send out risk assessment data method it is characterised in that：Bag
Include following steps：Human plasma preparation and Circulating DNA extraction, the detection of Circulating DNA extracts kit sensitivity technique, Circulating DNA
Method is set up, and determines that detection method, testing result calculate and determine detection range；
This method mainly utilizes the characteristic of Circulating DNA, prepares the netted nano particle of multiple aperture to tumour cell in blood plasma
The free small pieces segment DNA being discharged in blood plasma is enriched with and is extracted, and with tumor tissues genomic DNA as template, carries out difference
Gradient dilution, carries out QPCR detection using the gene with tumour-specific and its hot spot mutation design molecular probe, with gene
The quality of group DNA is X-axis, and the CT value that QPCR detection obtains is Y-axis draw calculation curve, obtains computing formula.
The step of the method is as follows：
(1) determine that tumor susceptibility gene detection computational methods and nominal reference are interval：
Prepared by (a), template：
Cancerous tissue genomic DNA sample, can measure DNA concentration using Nanodrop or the nucleic acids instrument of quality is carried out
Measurement, different according to DNA concentration, DNA is diluted respectively different gradients, the DNA after to dilute carries out QPCR detection for template；Inspection
Survey result in CT value as Y-axis, with the quality of template DNA for X-axis draw mapping curve and obtain y=kx+b type computing formula and
R2Value；
(b), design of primers：
Obtain the higher site of the tumor susceptibility gene frequency of mutation in NCBI or other databases and document, by this gene
Gene order copy out from NCBI, choose one of hot spot mutation, protogene sequence slight changes are become gene to dash forward
Sequence after change, using the such as primer-design software such as DNAMAN, Oligo, Primer5, carries out molecular probe design, molecular probe
Design principle is：Last bit base of upstream forward primer is consistent with site base after mutation, or reverse downstream primer is anti-
Consistent with site base after mutation to last bit base of complementary series；Amplified fragments size is between 90～120bp；
C (), QPCR detect：Operated using the explanation of any SYBR Green QPCR detection kit；
D (), nominal reference are interval to determine：
Collect normal non-tumor patient 50, extract ctDNA respectively, and carry out QPCR detection using above method, detection
The CT value that result obtains is brought in computing formula y=kx+b that template prepares as Y value, draws X value, and 10xIt is mould
This contained gene copy number in plate applied sample amount 2ul ctDNA, using new formula (10x× a)/2b calculates in every milliliter of blood plasma
(wherein a is ctDNA cumulative volume to this gene copy number；B is QPCR loading template volume).By the detection of 50 healthy populations,
Obtain peak and minimum that QPCR detects tumor susceptibility gene copy number, when being detected, gene for unknown sample
Individuality between peak and minimum scolded by copy, as normal level detection range, to the neurological susceptibility of tumour relatively
Low.
Carry out testing result explanation after the interval determination of nominal reference：
Testing result is divided into low, higher, high three intervals；Testing result display gene copy numerical value is low, then easy to tumour
Perception is low, and such crowd is once rechecked every half a year；Testing result display gene copy number is higher, then to tumor susceptibility relatively
Height, such crowd suggestion is once rechecked for every 3 months；Testing result display gene copy number is close or has exceeded normal model
Enclose, then belong to tumor susceptibility people at highest risk, such crowd suggestion is once rechecked for every 2 weeks.
The disturbing factors such as exclusion patient age, personal work and rest custom and recent inflammatory reaction, assess this gene copy numerical value
Whether exception occurs；Regulation detection range is normal, and tumor susceptibility is relatively low it is proposed that every 6 months are once rechecked；Detection model
Enclose for higher value, tumor susceptibility is higher it is proposed that every 3 months are once rechecked；Detection range is high level, and tumor susceptibility is bright
Aobvious height if rechecking result sustained high value, enters the tumour high-incidence season with healthy population it is proposed that per two weeks is once rechecked, should
Increase the frequency that hospital image detects, in tumour early detection and undertaking therapy.
(1) in step template preparation：Draw calculation curve simultaneously obtains computing formula, just should cover in the calculated curve of drafting
The often minimum of CT value detection range and peak, the k in y=kx+b in computing formula is negative value, and that is, CT value is bigger, reaches threshold
During value, this gene copy number is less；B should be greater than the peak of normal CT value detection range.
(2) in step design of primers：With tumor tissues genomic DNA as template, carry out different gradient dilutions, using having
The gene of tumour-specific and its hot spot mutation design molecular probe carry out QPCR detection, tumor susceptibility gene comprise NCBI and its
Related full gene ill to cancer in his database, tumor susceptibility gene hot spot mutation is pin in NCBI and other databases
Various cancers patient is carried out with the higher gene loci of the frequency of mutation that finds during gene order-checking, by protogene sequence slightly
Change over the sequence after gene mutation, carry out molecular probe design using the special software of design of primers, molecular probe designs
Principle is：Last bit base of upstream forward primer is consistent with site base after mutation, or the reverse mutual of reverse downstream primer
Last bit base of complementary series is consistent with site base after mutation；Amplified fragments size is between 90～120bp.
(3) QPCR detection in step：Circulating DNA extracts kit sensitivity technique, this method kit and QIAGEN examination
Agent box carries out ctDNA extraction, and the ctDNA obtaining carries out QPCR detection, and ctDNA is diluted to different quality, with different quality
CtDNA is template, arbitrarily designs any one gene primer and carries out QPCR detection, the minimum ctDNA of this method kit detects matter
Amount is less than 18.8ng, and CT value is 26.21；QIAGEN kit minimum ctDNA detection quality is 39.2ng, and CT value is 27.01.
Easily send out risk assessment data method using the above-mentioned qualitative and quantitative cancer that formed of cycling tumor DNA in cancer early in early days
Phase easily send out application in risk assessment it is characterised in that：Cancerous tissue extracting genome DNA, this extraction and application arbitrarily organizes base
Because group DNA extraction kit is extracted；Prepare multiple aperture netted nano particle tumour cell in blood plasma is discharged in blood plasma
Free small pieces segment DNA is enriched with and is extracted, and multiple aperture mesh nano particle is mainly modified to nano grain surface,
Multiple adsorption holes are designed on single nano particle and forms net surface structure, under the auxiliary of lysate and Proteinase K, by blood plasma
Non- small pieces segment DNA cleared up, and then retain the free small fragment of 100-300bp, these free small fragments can smoothly lead to
Cross aperture on nano particle, and rest on inside nano particle, make free small pieces segment DNA and receive through the centrifugation of certain rotating speed
Rice grain is enriched to centrifugation bottom of the tube together；And then can not be by nano particle without the larger dissociative DNA of the fragment cleared up
Aperture so that foreclose, with centrifugation and other reagent in the presence of disallowable fall；Blood plasma mainly divides from blood of human body
From the blood plasma obtaining；Circulating DNA is the free small pieces segment DNA that in blood plasma, tumour cell is discharged into 100～300bp in blood,
Then the scope assessing this gene copy numerical value and above-mentioned determination compares and determines whether exception.
Free small pieces segment DNA in blood plasma is enriched with and is extracted, and the method step is as follows：
1) add 1ml plasma sample in 2ml EP pipe, add 1ml lysis buffer, 30 μ l Proteinase Ks and 60 μ
L nano particle adsorbs magnetic bead.Fully reverse mixing 5min.
2) centrifuge, 12000rpm are put into by mixing sample, normal temperature is centrifuged 3min, and it is (such as more to obtaining that supernatant is abandoned in suction
CtDNA, then repeat step 1,2)；
3) add 1ml wash buffer I in the pipe containing precipitation, repeatedly blown and beaten with liquid-transfering gun, will precipitate fully outstanding
Floating uniform.Put into centrifuge, normal temperature is centrifuged, 13000rpm, 1 min.Supernatant is abandoned in suction.
4) add 1ml wash buffer II in the pipe containing precipitation, repeatedly blown and beaten with liquid-transfering gun, will precipitate fully
Suspend uniformly.
5) put into centrifuge, normal temperature is centrifuged, 13000rpm, 1min.Supernatant is abandoned in suction.
6) so that centrifuge tube is kept under uncapped state, heat 3min in 56 DEG C of water-baths, to vapor away the wash failing to exhaust
buffer II.
7) add 50～70 μ l EB buffer solutions, the bead precipitation of abundant suspension ttom of pipe, cover tightly lid, in 56 DEG C of water-baths
15min；
8) take out centrifuge tube and be centrifuged 3min in 14000rpm；
9) gained supernatant is DNA solution, is moved it into liquid-transfering gun and newly manages；
DNA is placed in -20 DEG C and saves backup.
Detailed description below will be further described to the present invention taking tumor susceptibility gene KRAS as a example, but simultaneously
Do not thereby limit the invention：
First, calibration curve and computing formula obtain：
(1) non-dispersive small cell lung cancer sample genomic dna extracts
(taking give birth to work Ezup pillar animal tissue genome DNA extraction kit as a example)
1) take about 25mg tumor tissues liquid nitrogen grinding to become powder to be added in 1.5ml centrifuge tube, add 180 μ l Buffer
ACL, adds 20 μ l Proteinase K solution, and concussion mixes.56 DEG C of water-bath 1h crack completely to cell.
2) 200 μ l Buffer CL are added, fully reverse mixing.
3) add the absolute ethyl alcohol of 200 μ l, fully reverse mixing.
4) adsorption column is put in collecting pipe, with pipettor, solution and translucent fibre shape suspension are all added absorption
In post, stand 2min, then 10,000rpm room temperature centrifugation 1min, outwell waste liquid in collecting pipe.
5) adsorption column is put back in collecting pipe, add 500 μ l CW1Solution, 10,000rpm centrifugations in adsorption column
30s, outwells collecting pipe waste liquid.
6) adsorption column is put back in collecting pipe, add 500 μ l CW2Solution, 10,000rpm centrifugations in adsorption column
30s, outwells collecting pipe waste liquid.
7) adsorption column is placed back in collecting pipe, be centrifuged 2min, residual of leaving away in 12,000rpm room temperature
CW2Solution.Adsorption column is opened lid and places several minutes in room temperature, thoroughly to dry residual in sorbing material
The residual of CW2Solution, CW2Solution can affect the yield of genomic DNA and follow-up experiment.
8) take out adsorption column, put in a new 1.5ml centrifuge tube, add 50-200 μ l CE Buffer standing
3min, 12,000rpm room temperature centrifugation 2min, collect DNA solution.The DNA extracting can carry out next step experiment or -20 DEG C of guarantors immediately
Deposit.
(2) the cancerous tissue genomic DNA Concentration Testing mode of quantitative DNA (arbitrarily can) is (with Nano100 ultra micro
As a example amount nucleic acids instrument)
Take sample genomic dna 2ul to be added to measured hole, start to measure, DNA concentration can be directly read.
(3) tumor susceptibility gene KRAS hot spot mutation design of primers
, KRAS gene is c.35G taking tumor susceptibility gene KRAS as a example>A, Gly12Asp gene mutation site is in report
Related to the morbidity of kinds cancer in document, NCBI finds this gene order, is the protogene sequence of KRAS gene in subordinate list 2
Row, subordinate list 3 is the gene order after this gene mutation.By the sequence copy after this gene mutation in primer-design software, former
Be then this primer design 5 ' to 3 ' hold primer sequence last be mutated after consistent (or the reverse complementary sequence of site base
In last bit base with mutation after base consistent).Amplified production fragment is optimal between 80-120bp, as shown in subordinate list 4.
(4) acquisition of computing formula
1. template dilution：According to the DNA concentration obtaining in step (two), take 2ul altogether, calculate the quality of 2ul DNA.Will
2ul DNA sample dilutes 10 times, 20 times, 50 times, 100 times, 200 times, 500 times and 1000 times, and the multiple according to dilution respectively
And initially DNA Mass Calculation goes out the DNA mass after dilution.
2.QPCR reaction system：
() taking TAKARA company SYBR Premix Ex Taq as a example
3.QPCR response procedures：
4. draw calculation curve obtain computing formula
With CT value as Y-axis, DNA mass draw mapping curve obtain computing formula in excel for X-axis, Fig. 1 is
KRAS genetic test mapping curve and computing formula.Obtain computing formula：Y=-0.3002+36.775.
2nd, tumor susceptibility gene KRAS copy number normal range (NR) reference interval in blood plasma determines
Collect 50 healthy population blood samples, entered using Circulating DNA extracts kit in the blood plasma referring in the present invention
Row extracts ctDNA, and with ctDNA as template, the molecular probe of tumor susceptibility gene KRAS hot spot mutation design carries out QPCR detection,
The CT obtaining value is brought in the computing formula in Fig. 1, obtains X value, 10xIt is contained in template applied sample amount 2ul ctDNA
This gene copy number, using new formula (10x× a)/2b calculates this gene copy number in every milliliter of blood plasma, and (wherein a is
CtDNA cumulative volume；B is QPCR loading template volume).By the detection of 50 healthy populations, obtain QPCR detection CT value
High level 35.8 and minimum 28.9, are brought in formula respectively and calculate gene copy number, determine normal level detection range:
104～1027copies/ml.
3rd, using this detection method, unknown sample tumor susceptibility is estimated
Regulation detection range is less than 1020Copies/ml is normal, and tumor susceptibility is relatively low it is proposed that every 6 months are carried out once
Recheck；Detection range is between 1020～1027It is higher value between copies/ml, tumor susceptibility is higher it is proposed that every 3 months enter
Row is once rechecked；Detection range is higher than 1027Copies/ml is then high level, and tumor susceptibility is apparently higher than healthy population it is proposed that every
Once being rechecked within 2 weeks, if rechecking result sustained high value, illustrating to come into the tumour high-incidence season, hospital image inspection should be increased
The frequency surveyed, in tumour early detection and undertaking therapy.
Result
We find through continuous experimental study, and this Circulating DNA detection method can be applicable to APC, the institute such as C-KIT, KRAS
There is tumor susceptibility gene.This method through experiment is repeated several times it may be determined that its result accurately and reliably, specificity, repeatability are good.
Those skilled in the art make a little simple modification, equivalent variations or modification using the technology contents of the disclosure above, all fall within this
In the protection domain of invention.
Result and analysis
1. ctDNA extracts kit sensitivity technique in blood plasma
Obtained using Circulating DNA extracts kit in the blood plasma referring in the present invention and QIAGEN company like product
CtDNA, is detected using QPCR, and every result all shows, the kit in the present invention is better than QIAGEN, and detection sensitivity is about
For QIAGEN 2 times about.Kit in the present invention has certain superiority, multiple aperture on nano particle microballoon designs
Mesh nano particle considerably increases the bioaccumulation efficiency to ctDNA so that final ctDNA mass is purer, and concentration is higher, this feature
It is one of the reason present invention is better than other products.
2. the acquisition of calculated curve and its computing formula
KRAS hotspot mutation using one of tumor susceptibility gene designs molecular probe, with cancerous lung tissue genome
DNA carries out QPCR detection for template.There is the abrupt information of tumor susceptibility gene of tumour-specific more fully in cancerous tissue, and
The frequency of mutation is many compared with blood.Therefore, it is in order in the case that DNA concentration is very low from cancerous tissue genomic DNA for template,
Still the copy number of tumor susceptibility gene can be detected.When genomic DNA is diluted to 100 times, the CT value of QPCR is 35.93, continues
Be diluted to 200 times, after 500 times, CT value difference is different less, when illustrating that shelves DNA is diluted to 100 times, has reached detection and has reached the standard grade.Now
Using CT value as Y-axis, genomic DNA quality is drawn curve for X-axis and is obtained computing formula：Y=-0.3002+36.775.Using
This computing formula is calculated, and is inversely proportional between CT value and tumor susceptibility gene copy number, and that is, CT value is bigger, and gene copy number is got over
Little, tumor susceptibility is weaker, and risk is lower.Using this detection method and computing formula, KRAS base is carried out to healthy population
Because of copy number detection, in 50 samples, CT value soprano reaches 35.8, is in gene copy number minimum, is brought into calculating
In formula, show that copy number is about 104copies/ml；CT value minimum is 28.9, is in normal range (NR) gene copy number
High level, is brought in formula, show that copy number is about 1027copies/ml.Determined with this and KRAS gene copy number is being examined
During survey, nominal reference is interval to be 104～1027copies/ml.Regulation detection range is less than 1020Copies/ml is normal, tumour
Neurological susceptibility is relatively low it is proposed that every 6 months are once rechecked；Detection range is between 1020～1027It is higher between copies/ml
Value, tumor susceptibility is higher it is proposed that every 3 months are once rechecked；Detection range is higher than 1027Copies/ml is then high level, swells
Knurl neurological susceptibility, apparently higher than healthy population it is proposed that every 2 weeks are once rechecked, if rechecking result sustained high value, illustrates
Enter the tumour high-incidence season, the frequency of hospital image detection should be increased, in tumour early detection and undertaking therapy.
Table 1 is ctDNA extracts kit of the present invention and QIAGEN kit Sensitivity comparison result (U.S.A adds as inventing)；
Table 2 is KRAS gene protogene sequence
ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAA
TCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTC
TCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGC
TTTCTTTGTGTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAGAGAACAAATTAAAAGAGT
TAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGAT
TTGCCTTCTAGAACAGTAGACACAAAACAGGCTCAGGACTTAGCAAGAAGTTATGGAATTCCTTTTATTGAAACATC
AGCAAAGACAAGACAGGGTGTTGATGATGCCTTCTATACATTAGTTCGAGAAATTCGAAAACATAAAGAAAAGATGA
GCAAAGATGGTAAAAAGAAGAAAAAGAAGTCAAAGACAAAGTGTGTAATTATGTAA
Table 3 sports the gene order after A for KRAS gene 35 site bases G
ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGATGGCGTAGGCAAGAGTGCCTTGACGATACAGCTA
ATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGA
AACCTGTCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTG
GGGAGGGCTTTCTTTGTGTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAGAGAACAAATT
AAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGATTTGCCTTCTAGAACAGTAGA
CACAAAACAGGCTCAGGACTTAGCAAGAAGTTATGGAATTCCTTTTATTGAAACATCAGCAAAGACAAGACAGGGTG
TTGATGATGCCTTCTATACATTAGTTCGAGAAATTCGAAAACATAAAGAAAAGATGAGCAAAGATGGTAAAAAGAAG
AAAAAGAAGTCAAAGACAAAGTGTGTAATTATGTAA
Table 4 is the primer sequence according to KRAS gene order design after mutation
Forward primer：CCTTGGGTTTCAAGTTATATG
Reverse primer：CCCTGACATACTCCCAAGGA
Claims (9)
1. a kind of cycling tumor DNA technique detection-cancer early stage easily send out risk assessment data method it is characterised in that：Including following
Step：Human plasma preparation and Circulating DNA extraction, Circulating DNA extracts kit sensitivity technique, Circulating DNA detection method are built
Vertical, determine that detection method, testing result calculate and determine detection range；
This method mainly utilizes the characteristic of Circulating DNA, prepares multiple aperture netted nano particle and tumour cell in blood plasma is discharged
Free small pieces segment DNA in blood plasma is enriched with and is extracted, and with tumor tissues genomic DNA as template, carries out different gradients
Dilution, carries out QPCR detection using the gene with tumour-specific and its hot spot mutation design molecular probe, with genomic DNA
Quality be X-axis, the QPCR CT value that obtains of detection is Y-axis draw calculation curve, obtains computing formula.
2. cycling tumor DNA technique detection-cancer early stage according to claim 1 easily sends out risk assessment data method, and it is special
Levy and be：
The step of the method is as follows：
(1) determine that tumor susceptibility gene detection computational methods and nominal reference are interval：
Prepared by (a), template：
Cancerous tissue genomic DNA sample, can measure DNA concentration using Nanodrop or the nucleic acids instrument of quality is surveyed
Amount, different according to DNA concentration, DNA is diluted respectively different gradients, the DNA after to dilute carries out QPCR detection for template；Detection
With CT value as Y-axis in result, with the quality of template DNA for X-axis draw mapping curve and obtain y=kx+b type computing formula and
R2Value；
(b), design of primers：
Obtain the higher site of the tumor susceptibility gene frequency of mutation in NCBI or other databases and document, by the base of this gene
Because sequence copies out from NCBI, choose one of hot spot mutation, protogene sequence slight changes are become after gene mutation
Sequence, using primer-design software, carry out molecular probe design, molecular probe design principle is：Upstream forward primer is
Afterwards a bit base with mutation after site base consistent, or last bit base of the reverse complementary sequence of reverse downstream primer with dash forward
After change, site base is consistent；Amplified fragments size is between 90～120bp；
C (), QPCR detect：Operated using the explanation of any SYBR Green QPCR detection kit；
D (), nominal reference are interval to determine：
Collect normal non-tumor patient 50, extract ctDNA respectively, and carry out QPCR detection, testing result using above method
The CT value obtaining is brought in computing formula y=kx+b that template prepares as Y value, draws X value, and 10xIt is in template
This contained gene copy number in sample amount 2ul ctDNA, using new formula (10x× a)/2b calculates this base in every milliliter of blood plasma
Because of copy number, wherein a is ctDNA cumulative volume；B is QPCR loading template volume；By the detection of 50 healthy populations, obtain
QPCR detects peak and the minimum of tumor susceptibility gene copy number, when being detected, gene copy for unknown sample
Scold the individuality between peak and minimum, as normal level detection range, relatively low to the neurological susceptibility of tumour.
3. cycling tumor DNA technique detection-cancer early stage according to claim 2 easily sends out risk assessment data method, and it is special
Levy and be：Carry out testing result explanation after the interval determination of nominal reference：
Testing result is divided into low, higher, high three intervals；Testing result display gene copy numerical value is low, then to tumor susceptibility
Low, such crowd is once rechecked every half a year；Testing result display gene copy number is higher, then higher to tumor susceptibility,
Such crowd suggestion is once rechecked for every 3 months；Testing result display gene copy number is close or has exceeded normal range (NR),
Then belong to tumor susceptibility people at highest risk, such crowd suggestion is once rechecked for every 2 weeks.
4. cycling tumor DNA technique detection-cancer early stage according to claim 4 easily sends out risk assessment data method, and it is special
Levy and be：The disturbing factors such as exclusion patient age, personal work and rest custom and recent inflammatory reaction, assessing this gene copy numerical value is
No occur extremely；Regulation detection range is normal, and tumor susceptibility is relatively low it is proposed that every 6 months are once rechecked；Detection range
For higher value, tumor susceptibility is higher it is proposed that every 3 months are once rechecked；Detection range is high level, and tumor susceptibility is obvious
Height if rechecking result sustained high value, enters tumour high-incidence season, Ying Zeng with healthy population it is proposed that per two weeks is once rechecked
Plus the frequency of hospital image detection, in tumour early detection and undertaking therapy.
5. cycling tumor DNA technique detection-cancer early stage according to claim 2 easily sends out risk assessment data method, and it is special
Levy and be：(1) in step template preparation：Draw calculation curve simultaneously obtains computing formula, just should cover in the calculated curve of drafting
The often minimum of CT value detection range and peak, the k in y=kx+b in computing formula is negative value, and that is, CT value is bigger, reaches threshold
During value, this gene copy number is less；B should be greater than the peak of normal CT value detection range.
6. cycling tumor DNA technique detection-cancer early stage according to claim 2 easily sends out risk assessment data method, and it is special
Levy and be：(2) in step design of primers：With tumor tissues genomic DNA as template, carry out different gradient dilutions, using having
The gene of tumour-specific and its hot spot mutation design molecular probe carry out QPCR detection, tumor susceptibility gene comprise NCBI and its
Related full gene ill to cancer in his database, tumor susceptibility gene hot spot mutation is pin in NCBI and other databases
Various cancers patient is carried out with the higher gene loci of the frequency of mutation that finds during gene order-checking, by protogene sequence slightly
Change over the sequence after gene mutation, carry out molecular probe design using the special software of design of primers, molecular probe designs
Principle is：Last bit base of upstream forward primer is consistent with site base after mutation, or the reverse mutual of reverse downstream primer
Last bit base of complementary series is consistent with site base after mutation；Amplified fragments size is between 90～120bp.
7. cycling tumor DNA technique detection-cancer early stage according to claim 2 easily sends out risk assessment data method, and it is special
Levy and be：(3) QPCR detection in step：Circulating DNA extracts kit sensitivity technique, this method kit and QIAGEN reagent
Box carries out ctDNA extraction, and the ctDNA obtaining carries out QPCR detection, and ctDNA is diluted to different quality, with different quality
CtDNA is template, arbitrarily designs any one gene primer and carries out QPCR detection, the minimum ctDNA of this method kit detects matter
Amount is less than 18.8ng, and CT value is 26.21；QIAGEN kit minimum ctDNA detection quality is 39.2ng, and CT value is 27.01.
8. utilize the cycling tumor DNA technique detection-cancer early stage described in claim 2 easily to send out risk assessment data method in cancer
Early stage easily send out application in risk assessment it is characterised in that：Cancerous tissue extracting genome DNA, this extraction and application is arbitrarily organized
Genome DNA extracting reagent kit extracts；Prepare multiple aperture netted nano particle tumour cell in blood plasma is discharged in blood plasma
Free small pieces segment DNA be enriched with and extracted, multiple aperture mesh nano particle is mainly modified to nano grain surface,
Multiple adsorption holes are designed on single nano particle and forms net surface structure, under the auxiliary of lysate and Proteinase K, by blood plasma
In non-small pieces segment DNA cleared up, and then retain 100-300bp free small fragment, these free small fragments can be smooth
By aperture on nano particle, and rest on inside nano particle, through the centrifugation of certain rotating speed make free small pieces segment DNA with
Nano particle is enriched to centrifugation bottom of the tube together；And then can not pass through nano particle without the larger dissociative DNA of the fragment cleared up
On aperture so that foreclose, with centrifugation and other reagent in the presence of disallowable fall；Blood plasma is mainly from blood of human body
Separate the blood plasma obtaining；Circulating DNA is the free small fragment that in blood plasma, tumour cell is discharged into 100～300bp in blood
DNA, the scope then assessing this gene copy numerical value and above-mentioned determination compares and determines whether exception.
9. according to claim 8 application it is characterised in that：Free small pieces segment DNA in blood plasma is enriched with and is extracted,
The method step is as follows：
1) add 1ml plasma sample in 2ml EP pipe, add 1ml lysis buffer, 30 μ l Proteinase Ks and 60 μ l receive
Rice grain adsorbs magnetic bead；Fully reverse mixing 5min；
2) centrifuge, 12000rpm are put into by mixing sample, normal temperature is centrifuged 3min, and it is (such as more to obtaining that supernatant is abandoned in suction
CtDNA, then repeat step 1,2)；
3) add 1ml wash buffer I in the pipe containing precipitation, repeatedly blown and beaten with liquid-transfering gun, abundant suspension all will be precipitated
Even；Put into centrifuge, normal temperature is centrifuged, 13000rpm, 1min；Supernatant is abandoned in suction；
4) add 1ml wash buffer II in the pipe containing precipitation, repeatedly blown and beaten with liquid-transfering gun, abundant suspension will be precipitated
Uniformly；
5) put into centrifuge, normal temperature is centrifuged, 13000rpm, 1min；Supernatant is abandoned in suction；
6) so that centrifuge tube is kept under uncapped state, heat 3min in 56 DEG C of water-baths, to vapor away the wash failing to exhaust
buffer II；
7) add 50～70 μ l EB buffer solutions, the bead precipitation of abundant suspension ttom of pipe, cover tightly lid, in 56 DEG C of water-bath 15min；
8) take out centrifuge tube and be centrifuged 3min in 14000rpm；
9) gained supernatant is DNA solution, is moved it into liquid-transfering gun and newly manages；
10) DNA is placed in -20 DEG C and saves backup.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2016103275556 | 2016-05-17 | ||
| CN201610327555 | 2016-05-17 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106399477A true CN106399477A (en) | 2017-02-15 |
Family
ID=57901340
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610761919.1A Pending CN106399477A (en) | 2016-05-17 | 2016-08-30 | Tumor circulation DNA technical detection-cancer early-stage easy-to-occur risk assessment data method |
| CN201610762102.6A Pending CN106367490A (en) | 2016-05-17 | 2016-08-30 | Method for monitoring cancer cell number of cancer patient by adopting circulating DNA |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610762102.6A Pending CN106367490A (en) | 2016-05-17 | 2016-08-30 | Method for monitoring cancer cell number of cancer patient by adopting circulating DNA |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN106399477A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109385469A (en) * | 2018-10-09 | 2019-02-26 | 深圳市新合生物医疗科技有限公司 | A kind of high sensitivity double-strand Circulating tumor DNA detection method and kit |
| CN112086129A (en) * | 2020-09-23 | 2020-12-15 | 深圳吉因加医学检验实验室 | Method and system for predicting cfDNA of tumor tissue |
| CN112599197A (en) * | 2020-12-23 | 2021-04-02 | 北京吉因加医学检验实验室有限公司 | Method and device for evaluating cancer risk based on plasma DNA fragment analysis |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107012212B (en) * | 2017-03-24 | 2018-03-02 | 刘长胜 | Early diagnosis of cancer kit and its application based on Cell-free DNA |
| CN106978486A (en) * | 2017-03-24 | 2017-07-25 | 刘长胜 | Molecular target and its application of the Cell-free DNA as cancer immunotherapies therapeutic evaluation |
| CN109112191A (en) * | 2017-06-23 | 2019-01-01 | 沈阳精准医疗技术有限公司 | A kind of information statistical method of tumour ctDNA |
| JP7185700B2 (en) * | 2018-02-13 | 2022-12-07 | エフ．ホフマン－ラ ロシュ アーゲー | Methods for predicting response to therapy by assessing tumor genetic heterogeneity |
| CN110240999B (en) * | 2018-03-09 | 2022-09-06 | 浙江品级基因科技有限公司 | Detection device and method for improving circulating tumor DNA detection rate |
| CN108929911A (en) * | 2018-08-13 | 2018-12-04 | 成都中珠健联基因科技有限责任公司 | A kind of system using low depth genome sequencing detection cancer return |
| FR3087792B1 (en) * | 2018-10-29 | 2023-09-29 | Inovotion | ANIMAL MODEL TO AMPLIFY HUMAN OR ANIMAL CIRCULATING TUMOR CELLS |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102216775A (en) * | 2008-08-18 | 2011-10-12 | 马克斯·普朗克科学促进协会 | Susceptibility to hsp90-inhibitors |
| CN105112400A (en) * | 2015-08-31 | 2015-12-02 | 臻和（北京）科技有限公司 | Kit for extracting free DNA |
| CN105420230A (en) * | 2016-01-14 | 2016-03-23 | 北京纳捷诊断试剂有限公司 | Lysis solution for extracting nucleic acid through magnetic bead method |
| CN105518151A (en) * | 2013-03-15 | 2016-04-20 | 莱兰斯坦福初级大学评议会 | Identification and use of circulating nucleic acid tumor markers |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105838777A (en) * | 2015-01-13 | 2016-08-10 | 上海张江转化医学研发中心有限公司 | Method for monitoring secondary drug resistance of lung cancer patient to tyrosine kinase inhibitor through ddPCR technology |
-
2016
- 2016-08-30 CN CN201610761919.1A patent/CN106399477A/en active Pending
- 2016-08-30 CN CN201610762102.6A patent/CN106367490A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102216775A (en) * | 2008-08-18 | 2011-10-12 | 马克斯·普朗克科学促进协会 | Susceptibility to hsp90-inhibitors |
| CN105518151A (en) * | 2013-03-15 | 2016-04-20 | 莱兰斯坦福初级大学评议会 | Identification and use of circulating nucleic acid tumor markers |
| CN105112400A (en) * | 2015-08-31 | 2015-12-02 | 臻和（北京）科技有限公司 | Kit for extracting free DNA |
| CN105420230A (en) * | 2016-01-14 | 2016-03-23 | 北京纳捷诊断试剂有限公司 | Lysis solution for extracting nucleic acid through magnetic bead method |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109385469A (en) * | 2018-10-09 | 2019-02-26 | 深圳市新合生物医疗科技有限公司 | A kind of high sensitivity double-strand Circulating tumor DNA detection method and kit |
| CN112086129A (en) * | 2020-09-23 | 2020-12-15 | 深圳吉因加医学检验实验室 | Method and system for predicting cfDNA of tumor tissue |
| CN112086129B (en) * | 2020-09-23 | 2021-04-06 | 深圳吉因加医学检验实验室 | Method and system for predicting cfDNA of tumor tissue |
| CN112599197A (en) * | 2020-12-23 | 2021-04-02 | 北京吉因加医学检验实验室有限公司 | Method and device for evaluating cancer risk based on plasma DNA fragment analysis |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106367490A (en) | 2017-02-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106399477A (en) | Tumor circulation DNA technical detection-cancer early-stage easy-to-occur risk assessment data method | |
| CN105780129B (en) | Target area sequencing library construction method | |
| WO2006047482A2 (en) | Method for determining the diagnosis, malignant potential, and biologic behavior of pancreatic cysts using cyst aspirate | |
| CN105603101B (en) | Detect application of the system of 8 miRNA expression quantity in diagnosis or auxiliary diagnosis of hepatoma product is prepared | |
| KR100925337B1 (en) | Prediction of drug-responsibility against breast cancer through chromosomal aberration detection | |
| CN105950753B (en) | One kind blood plasma miRNA marker relevant to adenocarcinoma of lung auxiliary diagnosis and its application | |
| CN108048570A (en) | For primer pair, kit and the method for colorectal cancer related gene Septin9 DNA methylation assays | |
| CN105986031A (en) | Tumor susceptibility 62 genes and application thereof | |
| Ren et al. | Expression of peripheral blood miRNA-720 and miRNA-1246 can be used as a predictor for outcome in multiple myeloma patients | |
| Baby et al. | The scope of liquid biopsy in the clinical management of oral cancer | |
| CN105779433A (en) | Kit and applications thereof | |
| CN112063714A (en) | miRNA related to colorectal cancer and application thereof | |
| CN107164531A (en) | A kind of related serum LncRNA marks of screening lung cancer and its application | |
| KR102211972B1 (en) | Method for early diagnosis of breast cancer and monitoring after treatment using liquid biopsy multi-cancer gene biomarkers | |
| Wei et al. | Epithelial-mesenchymal transition classification of circulating tumor cells predicts clinical outcomes in progressive nasopharyngeal carcinoma | |
| CN107746887A (en) | LncRNA compositions and the purposes for preparing diagnosis indication Luminal A type Bone of Breast Cancer transfering reagent boxes | |
| JP2023529064A (en) | Methods of Identifying Medical Conditions in Human Subjects | |
| CN106939354A (en) | MiRNA 4530 as pulmonary cancer diagnosis mark application | |
| WO2019095541A1 (en) | Composition and method for diagnosing and predicting breast cancer bone metastases | |
| CN110004227A (en) | A kind of biomarker of nasopharyngeal carcinoma diagnosis and/or prognosis evaluation | |
| Mu et al. | P-220 The efficacy of preoperative imatinib in locally advanced gastrointestinal stromal tumors: A single-center retrospective analysis | |
| CN107012244A (en) | The 5p of miRNA 6729 as pulmonary cancer diagnosis mark application | |
| Gao et al. | Differential Non-Coding RNA Profiles for Lung Cancer Early Detection in African and White Americans | |
| CN107699620B (en) | A kind of gene diagnosis kit for diagnosing indication Luminal Type B Bone of Breast Cancer transfer | |
| Gahan et al. | A Comparative Review of the Detection of Early-stage Lung Cancer by Exosomal and Free Nucleic Acids and Standard Screening Methods |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170215 |