CN106399465B - A kind of detection method of hotspot mutation - Google Patents

Abstract

A kind of detection method abstract present invention of hotspot mutation of denomination of invention is by using carrying out digestion with restriction enzyme to wild type sequence in vitro and incision end be unfavorable for the processing of connection reaction, amplification in vitro segment is subcloned, sequencing analysis then is carried out to the bacterium colony of Clone formation.The present invention is conducive to mutated gene and forms bacterium colony and decline to wild gene segment due to handling its ability for forming bacterium colony by restriction enzyme reaction and inhibition connection.There is application value in terms of the gene mutation analysis of the present invention biological sample low to mutated gene content.

Description

A kind of detection method of hotspot mutation

Technical field

The present invention relates to field of biotechnology, and in particular to molecular biology and field of clinical laboratory medicine are related to gene Engineering and medical diagnosis more particularly to a kind of detection method of hotspot mutation.

Background technique

Generation, the development of tumour are related to gene mutation, including inherited genetic mutation and posteriori somatic cell gene are dashed forward Become.Showing the hot spot mutation there are many gene at present, occurrence frequency is higher, and it is not only related to the occurrence and development of kinds of tumors, It is also closely related with the therapeutic choice of tumour.The common analysis of gene mutation, including direct Sequencing are analyzed at present, site Primer amplified, PCR product melting point curve analysis etc..These technologies respectively have an advantage and disadvantage, but to tumour early screening and Effect monitoring field after treatment, it is also necessary to research and develop no false positive and there is efficient new technology simultaneously.

PCR amplification, restriction enzyme and gene clone technology, extensively individually or with gene sequencing technology phase In conjunction with for genetic analysis and gene mutation analysis.

For the primer of PCR with nucleic acid to be amplified by the Hybridization principle of base complementrity, amplified production has template and primer The requirement being mutually paired.In addition, by site-specific primer and combining for the means such as the label probe of amplified production, benefit It can be used for genetic analysis in several ways with round pcr.

Restriction enzyme is widely used in restricted digestion spectrum analysis because it recognizes the high degree of specificity of recognition site, Restriction fragment length polymorphism etc..

Ligase in mutation analysis, using a kind of ligase chain reaction (Ligation chain reaction, LCR), it is used for mutation analysis.Also, ligase is also widely used in subclone and first generation sequencing and high-flux sequence analysis.

Gene subclone has various ways in gene mutation analysis.On the one hand, can bacterium colony to Clone formation it is straight Connect sequencing.In addition, blue and white screening technology can also be used, the selective bacterium colony for selecting particular color is sequenced.

Blue hickie screening (beta galactosidase system) is selection markers more common in molecular biology experiment, has height Effect and simple advantage are mainly used for basic research, including improve cloning efficiency.Recently, blue hickie screening is prominent for body cell The external basic research become, the latter such as big-blue mouse and rat (ref)；And the gene point for the mutation of human inheritance's property Analysis.But blue hickie screening technique is for mankind's KRAS gene mutation or a kind of has new technology yet-to-be developed.

In vitro study, examples of such carriers carrying lacZ gene, the end N- (α-peptide) of its coding beta-galactosidase, and And in inducer IPTG (isopropyl-β-D-thiogalactoside, it is similar with lactose structure but cannot be dropped by beta galactosidase Solution) induction promoter regulation under.The host strain of plasmid conversion is LacZ △ M15 genotype (containing the coding end N- defect The gene of the beta-galactosidase polypeptides of type).After the plasmid conversion host strain not recombinated, under the induction of IPTG, plasmid and place Two peptides (i.e. α-complementary) that main bacterium expresses defect respectively but can mutually compensate, form functional beta galactosidase, The beta galactosidase can be X-gal (the chloro- 3- indoles-β-D- galactoside of the bromo- 4- of 5-) Substrate hydrolysis colourless in culture medium Chloro- indigo at galactolipin and the bromo- 4- of navy blue 5-, blue is presented in bacterium colony.But when exogenous DNA insertion plasmid is located at α-peptide coding When multiple cloning sites in sequence, due to destroying α-peptide reading frame, the α-peptide for encoding it loses activity, then recon The bacterium at place cannot complete α complementation, cannot form active beta galactosidase, and recombinant bacterium is caused to form white colony. Therefore, recon can be filtered out by blue hickie.

In kinds of tumors related mutation, such as deletion mutation, insertion mutation and a variety of point mutation, or can directly lead TAA, the appearance and forfeiture of the terminator codons such as TAG, TGA are caused, or wild gene and mutation are obtained by artificial frameshit technology Gene has the situation with or without terminator codon.In this way, using the amplimer of mutant nucleotide sequence upstream and downstream is located to it It is expanded, and amplified fragments is inserted into prokaryotic expression carrier, the different bacterium colony of blue white colour can be obtained.

The present invention is for being related to the hot spot mutation of terminator codon, using result PCR amplification, digestion with restriction enzyme, Dephosphorylation is carried out to digestion product, Subcloned technology combines, and the clone containing mutation in the clone to be formed can be made to obtain greatly Width is promoted, and is related to the termination codon period of the day from 11 p.m. to 1 a.m in mutation, this effect that promoted is obtained further due to the difference of bacterium colony indigo plant white colour Raising.Sequencing to colonies can play the role of the confirmation to mutation.

Summary of the invention

The technical problem to be solved in the present invention is to provide it is a kind of can may be mixed with it is wild with mutated gene segment The detection method of hot spot mutation, and detection efficiency with higher are carried out in biological sample.

In order to solve the above technical problems, the present invention provides a kind of to the life containing wild type gene and mutated gene The method of mutated gene analysis is carried out in object sample, which is characterized in that it includes the following steps:

(1) restriction enzyme is added in biological sample to be digested,

(2) hinder to digestion notch the processing of connection enzyme reaction,

(3) connection reaction is mediated with ligase, bacterium colony finally is formed by subclone and carries out mutation analysis.

Contain wild type gene in being preferably implemented at of the invention one, in the biological sample in the step (1) and dashes forward Become gene.

It is corresponding with the mutated gene described wild in the step (1) in a preferred embodiment of the present invention Type gene is by digestion with restriction enzyme, and the segment of the mutated gene is not because containing restriction enzyme site, and cannot be digested.

In a preferred embodiment of the present invention, in the step (1), the segment of the mutated gene contains restriction enzyme site By digestion with restriction enzyme, and the wild type gene corresponding with the mutated gene cannot be by without containing restriction enzyme site Digestion with restriction enzyme.

In a preferred embodiment of the present invention, the step (2) carries out digestion notch to hinder connection enzyme reaction Processing is to digestion notch five ends dephosphorylated processing of progress.

In a preferred embodiment of the present invention, the mutation analysis of the step (3) is bacterium colony PCR primary dcreening operation and the first generation Sequencing analysis.

In a preferred embodiment of the present invention, the wild type gene is KARS gene.

The present invention provides one kind can utilize digestion with restriction enzyme wild gene segment corresponding with mutated gene, And to digestion notch carry out hinder connection enzyme reaction the ends dephosphorylated processing of nucleic acid fragment 5, by DNA ligase will with point The genetic fragment of analysis is subcloned to plasmid body carrier, finally carries out genetic analysis to the bacterium colony of formation.The genetic analysis of bacterium colony is adopted With bacterium colony PCR primary dcreening operation and first generation sequencing analysis.

The present invention can be used for gene mutation and be related to restriction enzyme site disappearance and gene mutation and wild type sequence presence Its corresponding wild gene segment exists and being artificially introduced mutation and obtaining mutated gene segment product without containing restriction enzyme site Two kinds of situations of restriction enzyme site are formed after being artificially introduced mutation.

The situation of restriction enzyme digestion sites disappearance is related to for gene mutation, the present invention is to biology to be analyzed Sample expands it.After obtaining amplified production, being limited property endonuclease digestion makes wild product digestion at two A smaller fragment, and mutated gene segment primer does not contain restriction endonuclease sites, cannot be digested and keep complete.

Application examples of the invention is directed to KRAS hotspot mutation, by designing a pair of sequences specific primer, in KRAS The flank of hotspot mutation starts to carry out pcr amplification reaction；Wild-type sequence corresponding with mutation is drawn by amplified reaction Enter restriction enzyme site, and hinder to digestion notch the ends dephosphorylated processing of nucleic acid fragment 5 of connection enzyme reaction；Again by dephosphorization Product after acidification is subcloned the wild type sequence segment treated in mark sheet to the prokaryotic vector with blue and white screening function and dashes forward Become sequence fragment and carries out the screening of blue white bacterium colony spot.

Primer pair provided by the invention has to be mutated the ability that corresponding wild-type template introduces restriction enzyme site；PCR Wild-type gene fragment can make gram to be formed through digestion with restriction enzyme, then through shrimp alkaline phosphotase dephosphorylation in product Clone containing mutation in grand is increased dramatically, and selects from thousands of and ten hundreds of wild gene segments to have Selecting property forms the ability of white colony to mutant nucleotide sequence, and the white colony that blue hickie screens is analyzed by gene sequencing, can To determine, whether there is or not gene mutations in the sample to be measured.

Key problem in technology of the invention is will be directly containing terminator codon or the gene by being artificially introduced terminator codon Segment and the different genotype genetic fragment of corresponding no terminator codon are by amplification in vitro, digestion with restriction enzyme, The genetic fragment of different genotype is converted into the different large intestine bar of color after subclone by the dephosphorylation process for digesting end Bacterium bacterium colony.The measure that the technology is implemented is that design has introducing restriction enzyme site, can also be adapted to shellfish by subclone simultaneously The PCR primer pair of tower galactosidase gene reading frame ability will be mutated the enzyme of corresponding wild-type gene fragment introducing Enzyme site digestion, and digestion notch is carried out 5 end of nucleic acid fragment of connection enzyme reaction is hindered to remove phosphoric acid through shrimp alkaline phosphotase Change processing.

For the blue hickie bacterium colony screening experiment of subclone, whether successfully inserted mainly for detection of Insert Fragment after subclone Enter.Its principle is being successively inserted into for the especially long Insert Fragment of Insert Fragment, and new end generally can be all introduced due to insertion Only codon leads to the termination of beta galactosidase gene product expression, and such E. coli clones are in default of beta gala Glycosidase and cannot not will have the coloured chloro- 3- indoles-β-D- galactoside of the bromo- 4- of chemical substance 5- pass through enzymology reaction turn It is chloro- indigo to be changed to the bromo- 4- of 5- with blue.We when insertion is compared with short-movie section by introducing it has recently been demonstrated that terminated Codon can equally carry out blue hickie screening.

Being subcloned common method is that T/A clones and utilize restriction endonuclease sites position cloning.The former the advantages of is PCR Product does not need to post-process, and is directly attached on reaction subclone to corresponding carrier T.The principle of this method is PCR minimum living There are three ends of approximately half of product to have the A base of a non-template dependence in the reaction product of true archaeal dna polymerase, and Five ends of cloning vector are reached with pre-setting a T base outstanding by TA base pair complementarity to PCR product The effect of Direct Cloning.The subclone carried out using restriction enzyme site, the disadvantage is that need that PCR product is continued to post-process, First with restriction enzyme to PCR product digestion, then it is subcloned.The subclone scheme that restriction enzyme site carries out The advantages of be that can guarantee that PCR product, according to design requirement, adapts to the reading frame of cloning vector after subclone.

Primer pair e, f provided in an embodiment of the present invention, such as Seq No.6, shown in Seq No.7；The embodiment of the present invention provides Primer pair g, h, such as Seq No.10, shown in Seq No.11 shown in.5 ends of primer pair e, f and g, h, using upstream primer 5 ends are restriction enzymeHindIIIIt is 5 ends with downstream primer is restriction enzyme BamHI.Restriction enzyme can To generate the technical solution of two different cohesive ends.The use of different cohesive ends avoids and carries out dephosphorylation to carrier Processing, guarantee are efficient simultaneously, moreover it is possible to lower non-specific clone products.

The primer pair e and f that the present invention is included have and carry out sequence spy to No. 12 hot spot mutation regions of KRAS gene Specific amplification ability, simultaneously as KRAS hotspot mutation, which has, carries out the conversion of E. coli clones color by blue white carrier Ability.PCR primer of the invention only increases by 34 amino after being subcloned to blue and white screening carrier to the product of amplification Acid does not form terminator codon, also therefore not influences the expression of beta galactosidase relevant gene product, corresponding after conversion E. coli clones are blue.However, when the primer pair amplifies contain the hot spot mutation of 12 bit codon of KRAS gene, for GG/GA mutation, will generate TGA terminator codon, these pcr amplification products, to procaryotic clone carrier, theoretically turn in subclone The corresponding E. coli clones obtained after change are white.

The primer pair g and h that the present invention is included, which have, carries out sequence spy to No. 13 hot spot mutation regions of KRAS gene Specific amplification ability, simultaneously as KRAS hotspot mutation, which has, carries out the conversion of E. coli clones color by blue white carrier Ability.PCR primer of the invention only increases by 34 amino after being subcloned to blue and white screening carrier to the product of amplification Acid does not form terminator codon, also therefore not influences the expression of beta galactosidase relevant gene product, corresponding after conversion E. coli clones are blue.However, when the primer pair amplifies contain the hot spot mutation of 13 bit codon of KRAS gene, for GG/GA mutation, will generate TGA terminator codon, these pcr amplification products, to procaryotic clone carrier, theoretically turn in subclone The corresponding E. coli clones obtained after change are white.

In terms of the clinical application of diagnosing tumor, sample to be measured is mainly two class of free nucleic acid in tumor tissues and blood.It is right For tumor tissues, when being tumour cell greater than 10 or more in biopsy specimen, the almost institute of detection in Gene Mutation There are the relevant technologies to may be incorporated for the detection in Gene Mutation of the sample, wherein the goldstandard received the most clinical is part chain termination Method sequencing technologies.However, if Tumor Cell Content in biopsy specimen is lower than 10, but it is still higher than percent for the moment, newly Generation high throughput sequencing technologies can be used for the detection in Gene Mutation of such sample.

Centesimal sample and blood middle reaches freestone acidity scale sheet are lower than to Tumor Cell Content in biopsy specimen, due to Wherein the ratio of tumor mutant gene part and normal gene is lower than 1 percent, much for analyzing inherited genetic exception Gene diagnosis technology is difficult to effectively detect these micro mutated genes.Blue and white screening technology has from a large amount of wild bacterium colonies Selecting may be containing the ability of the bacterium colony of mutated gene segment.Plate, the Dan Ke that can be grown are grown to common 10 cm bacterial Grand bacterium colony can achieve 2000-3000 bacterium colony.One is selected from these bacterium colonies to several possible white colonies, by into The sequencing analysis of one step can effectively analyze rare mutation.The method of the present invention is by means of an introducing restriction enzyme site Primer pair, borrowed by means of the high efficiency of PCR amplification by means of the high efficiency and dephosphorylized high efficiency of endonuclease digestion The high specific of the high efficiency of blue and white screening and the exclusion false positive of sequencing technologies is helped, is the rare tumor mutant gene of content The gene diagnosis of sample provides a kind of efficient and reliable technology.

Method of the invention obtains in KRAS gene the 12nd and the detection of the 13rd bit codon hot spot mutation respectively It confirms, can detecte the low content mutation to 3 ten thousand to one.Introduce the primer pair e and f primer pair KRAS gene the of restriction enzyme site In 12 bit codon hot spot mutations, PCR can be made after dephosphorylation by using restriction enzyme BSTNI digestion of the invention Product is converted into the difference of blue white bacterium colony.Introduce primer pair g and h primer pair KRAS gene the 13rd bit codon heat of restriction enzyme site In point mutation, PCR product can be made to be converted into indigo plant after dephosphorylation by using restriction enzyme haeIII digestion of the invention The difference of white bacterium colony.

In gene mutation relevant to Tumor mutations, there are a variety of hot spot mutations can be by adjusting beta gala in vitro The reading frame of glycosidase genes and achieve the purpose that the wild and mutated gene segment using blue white area point corresponding gene.Cause This, the hotspot mutation detection technique for reducing wild type sequence connection reaction can be used as a kind of technical solution, by for not Homogenic mutation designs different primer pairs and introduces restriction enzyme site, and after PCR amplification, digestion with restriction enzyme and mutation are opposite The wild gene segment answered, and hinder to digestion notch the ends dephosphorylated processing of nucleic acid fragment 5 of connection enzyme reaction, lead to It crosses DNA ligase the genetic fragment with analysis is subcloned to plasmid body carrier, genetic analysis finally is carried out to the bacterium colony of formation. Corresponding primer pair can be designed according to different genes, be hindered through corresponding endonuclease digestion, and to digestion notch Corresponding technique of gene detection is researched and developed in the ends dephosphorylated processing of nucleic acid fragment 5 for connecting enzyme reaction.

The present invention will utilize digestion with restriction enzyme and mutation by using the principle of external adjustment gene reading frame frame Corresponding wild gene segment, and hinder to digestion notch the ends dephosphorylated place of nucleic acid fragment 5 of connection enzyme reaction Genetic fragment with analysis is subcloned to plasmid body carrier sense Tumor mutations KRAS gene the 12nd by reason by DNA ligase The hot spot mutation of position and 13 amino acids coding, makes wild product digestion at two smaller fragments, and mutated gene segment draws Object does not contain restriction endonuclease sites, cannot be digested and keep complete.It is combined with Subcloned technology, gram to be formed can be made Clone containing mutation in grand is increased dramatically, and is related to the termination codon period of the day from 11 p.m. to 1 a.m in mutation, this promotion effect is due to bacterium colony indigo plant The difference of white colour, and be further improved.The present invention is made using the KRAS hot spot mutation not directly containing restriction enzyme site For embodiment.For directly containing the hot spot mutation of restriction enzyme site, the present invention is not required to be artificially introduced restriction enzyme site when applying.It is answering It is to be positioned at wild type sequence or mutant nucleotide sequence according to terminator codon with the present invention, determines the clone of sequencing picking always Corresponding to the corresponding clone of mutant nucleotide sequence.

Detailed description of the invention

Fig. 1 is Overlap extension PCR operation principle schematic diagram.

Fig. 2 is a, the wild type PCR product electrophorogram of d primer amplification.

Fig. 3 is first round PCR electrophoretogram.1,2 swimming lanes are product ab；3,4 swimming lanes are product cd；6 swimming lanes are 100bp DNA marker。

Fig. 4 is the wild template plasmid sequencer map of KRAS.

Fig. 5 is the 12nd bit codon template plasmid sequencer map of KRAS.

Fig. 6 is the sequencer map of the 13rd mutant plasmids.

Fig. 7 A is dephosphorylized blue hickie detection bacterium colony formation result schematic diagram after the pure wild plasmid digestion of KRAS.

The blue hickie detection bacterium colony that Fig. 7 B is KRAS wild type and 12 bit codon mutation genetic fragment plasmids are 3000:1 Form result schematic diagram

The blue hickie detection bacterium colony that Fig. 7 C is KRAS wild type and 12 bit codon mutation genetic fragment plasmids are 10000:1 Form result schematic diagram.

The blue hickie detection bacterium colony that Fig. 7 D is KRAS wild type and 12 bit codon mutation genetic fragment plasmids are 30000:1 Form result schematic diagram.

Fig. 8 A is dephosphorylized blue hickie detection bacterium colony formation result schematic diagram after the pure wild plasmid digestion of KRAS.

The blue hickie detection bacterium colony that Fig. 8 B is KRAS wild type and 13 bit codon mutation genetic fragment plasmids are 3000:1 Form result schematic diagram.

The blue hickie detection bacterium colony that Fig. 8 C is KRAS wild type and 13 bit codon mutation genetic fragment plasmids are 10000:1 Form result schematic diagram

The blue hickie detection bacterium colony that Fig. 8 D is KRAS wild type and 13 bit codon mutation genetic fragment plasmids are 30000:1 Form result schematic diagram.

Fig. 9 is using the wild bacterium solution PCR with the white colony of 12 bit codon mutation genes of blue hickie detection 30000:1 Result schematic diagram.

Figure 10 is using the wild white colony bacterium solution PCR with 12 bit codon mutation genes of blue hickie detection 30000:1 Result schematic diagram through restriction endonuclease BstnI digestion, display the 12nd have 5 positive colonies.

Figure 11 is using the wild bacterium solution with the white colony of 13 bit codon mutation genes of blue hickie detection 30000:1 PCR result schematic diagram.

Figure 12 is using the wild white colony bacterium solution PCR with 13 bit codon mutation genes of blue hickie detection 30000:1 Result schematic diagram through restriction endonuclease HaeIII digestion, display the 13rd have 7 positive colonies.

Figure 13 a and Figure 13 b are using the wild white colony with 12 bit codon mutation genes of blue hickie detection 30000:1 Sequencing result schematic diagram, the 12nd bit codon TGG of display sport TGA.

Figure 14 a to Figure 14 e is using the wild white colony with 13 bit codon mutation genes of blue hickie detection 30000:1 Sequencing result schematic diagram, the 13rd bit codon TGG of display sport TGA.

Specific embodiment

Above scheme is described further below in conjunction with specific embodiment.It should be understood that these embodiments are for illustrating The present invention and be not limited to limit the scope of the invention.The item that implementation condition used in the examples can be required according to concrete application Part does further adjustment, and the implementation condition being not specified is usually the condition in routine experiment.

One, material and instrument: HindIII andBamHIRestriction endonuclease and BstnI restriction endonuclease are purchased from New England Biolabs company, PMD-19T plasmid are purchased from TAKARA；PFU enzyme, Tag enzyme, HaeIII, rSAP, T4DNA ligase are purchased from Thermoscientific company.X-gal, IPTG, ampicillin, Tris-bas, EDTA, DMSO, electrophoresis grade agarose, ferment Female extract, tryptone, agar powder etc. are that domestic analysis is pure.

E Coli.DH5 α bacterial strain is purchased from Beijing Tiangeng company.

PCR instrument-BioRad company (U.S.), gel imaging system-BioRad company (U.S.), DYY-6C type electrophoresis apparatus- 61 instrument plant of Shanghai.

Two, specific method

Embodiment one

12 bit codon hot spot mutation of 1.KRAS gene and corresponding wild type sequence plasmid construction

1.1 include the gene order of KRAS hotspot mutation as shown in Seq No1.

Primer a TAGCCAAGCTTTGACTGCATACAAACTTGT, as shown in Seq No 2；

Shown in primer d CGTCAGGATCCTTGGACCATATTCGTCCACA, Seq No3.

Using people's blood genome as template, primer a, d progress PCR constructs wild template.

The above system in PCR instrument by following procedure react: 95 DEG C of initial denaturation 5min, into three steps circulation (95 DEG C of -15s, 58 DEG C of -15s, 72 DEG C of -15s are recycled for 30 totally), last 72 DEG C of -1min.Take 5 μ L reaction solutions in agarose gel electrophoresis, such as Fig. 2 Shown: 1 swimming lane is 100bp DNA marker；2,3 swimming lanes are wild type PCR product.

PCR product purifying, it is rear to connect PMD-19T plasmid, DH5 α Escherichia coli are finally converted, picked clones sequencing result is shown in Figure is shown in Fig. 4.

The plasmid construction (Overlap extension PCR) of the 12nd bit codon mutation of 1.2KRAS gene

It is as follows to construct templa-primer sequence:

Shown in primer a:TAGCCAAGCTTTGACTGCATACAAACTTGT, Seq No.2；

Primer b:ACGCCATCAGCTCCAACTA, as shown in Seq No.4；

Primer c:TTGGAGCTGATGGCGTAGG, as shown in Seq No.5；

Primer d:CGTCAGGATCCTTGGACCATATTCGTCCACA, as shown in Seq No.3.

1.2.1 first round PCR:

PCR amplification system is as follows: people's blood genome is template, and primer a, b carry out PCR.Product is ab.

The above system in PCR instrument by following procedure react: 95 DEG C of initial denaturation 5min, into three steps circulation (95 DEG C of -15s, 58 DEG C of -15s, 72 DEG C of -15s are recycled for 30 totally), last 72 DEG C of -1min.Take 5 μ L reaction solutions in agarose gel electrophoresis, such as Fig. 1 Shown: 1 swimming lane is 100bp DNA marker；2,3 swimming lanes are wild type PCR product.

PCR amplification system is as follows: genome is template, and primer c, d carry out PCR.Product is cd.

The above system in PCR instrument by following procedure react: 95 DEG C of initial denaturation 5min, into three steps circulation (95 DEG C of -15s, 58 DEG C of -15s, 72 DEG C of -15s are recycled for 30 totally), last 72 DEG C of -1min.

1.2.2 the second wheel PCR

With the product ab and cd of first round PCR, template mutually extends to form ad each other.By product ab and product cd difference 100 It dilutes again, then respectively taking 1.0 μ L is template.

PCR amplification system is as follows:

The above system in PCR instrument by following procedure react: 95 DEG C of initial denaturation 5min, into three steps circulation (95 DEG C of -15s, 58 DEG C of -15s, 72 DEG C of -15s are recycled for 30 totally), last 72 DEG C of -1min.

1.2.3PCR product purification, connection

The DNA Purification Kit product of PCR product Tiangeng, with HindIII and BamHI digestion PCR product；Simultaneously With HindIII and BamHI digestion PMD-19T plasmid, glue purification is cut.By the PCR product after DNA Purification Kit, with The carrier connection of digestion after purification.Its linked system is as follows:

Its reaction condition: 22 DEG C are reacted 30 minutes

1.2.4 DH5 α Escherichia coli are converted

Previous step connection product is transformed into DH5 α Escherichia coli, 37 DEG C are incubated overnight.Product chooses bacterium colony after clone, send survey Sequence, sequencing result are shown in Fig. 5.

2.1PCR expands genetic fragment that is wild and containing the 12nd bit codon mutation

Primer e:AAGCTTTGACTGCATACAAACTTGTGGTAGTTGGAC, as shown in Seq No.6；

Primer f:GGATCCTTAGACCATATTCGTCCACA, as shown in Seq No.7.

PCR amplification system is as follows:

The above system is reacted in PCR instrument by following procedure: 95 DEG C of initial denaturation 5min, recycles (95 DEG C of -15s, 58 into three steps DEG C -15s, 72 DEG C of -15s totally 30 circulations), last 72 DEG C of -1min.

Template is the plasmid of the wild plasmid that embodiment one constructs and the 12nd bit codon mutation.First measure template plasmid OD, adjustment concentration to every microlitre of 20ng.Wild plasmid and mutant plasmids are mixed into wild type by molecule copy number: mutation Type is respectively as follows: 3000:1,10000:1,30000:1.Wherein total amount of the wild template plasmid in 25 microlitres of reaction systems is 20ng, corresponding mutated gene segment are followed successively by 6.67pg, 2pg, 0.67pg.

The digestion of 2.2PCR amplified fragments

2.2.1PCR product purification digestion: by the DNA Purification Kit product of abovementioned steps PCR product Tiangeng. With restriction enzyme BstnI digestion PCR product, digestion system is as follows:

Its reaction condition: 37 DEG C are reacted 60 minutes.

2.2.2 the PCR product purifying after digestion

By the DNA Purification Kit product of abovementioned steps PCR product Tiangeng.

PCR product dephosphorylation after 2.3 digestions

By the rSAP dephosphorylation of abovementioned steps PCR product thermoscientific company.

Dephosphorylation system is as follows:

Its reaction condition: 37 DEG C are reacted 4 hours, 80 degree of 30 minutes heat inactivations

The subclone blue and white screening of 2.4PCR amplified fragments is tested

2.4.1PCR the subclone of product and Lan Bai carrier

2.4.1.1 purifying, digestion: the DNA Purification Kit product of abovementioned steps PCR product Tiangeng is used HindIII and BamHI digestion PCR product；HindIII and BamHI digestion PMD-19T plasmid is used simultaneously, cuts glue purification.

2.4.1.2 it connects, the PCR product after DNA Purification Kit is connect with aforementioned carrier after purification. Its linked system is as follows:

Its reaction condition: 22 DEG C are reacted 30 minutes

2.4.1.3 conversion, blue hickie screening

Take 50 μ l competent cells and in melting 10min on ice.Above-mentioned competence is all added in the linked system of 10 μ l Cell flicks mixing.It is placed in 30min on ice.42 DEG C of water-bath thermal shock 45sec, are immediately placed in cooled on ice 15min.It is added The LB culture medium of 37 DEG C of pre-temperatures of 800L, 180rpm shaken cultivation 40min.Low-speed centrifugal, 500 μ l of reject supernatant.With residue 300 μ lLB piping and druming precipitating, and its whole is coated on the L- Agar Plating containing X-Gal, IPTG, Amp, it is inverted in 37 DEG C of incubators are incubated overnight.

Embodiment two

The 13rd bit codon hot spot mutation of 1.KRAS gene and corresponding wild type sequence plasmid construction are same as above, the centre of selection Primer b', c' sequence is as follows:

B':ACGTCACCAGCTCCAACTA, as shown in Seq No.8；

C':TTGGAGCTGGTGACGTAGG, as shown in Seq No.9.

2.PCR expands genetic fragment that is wild and containing the 13rd bit codon mutation

2.1 primer g:AGACATCGTAGGTAGTGACATAGCCAAGCTTTGACTGCATAC, as shown in Seq No.10；

Primer h:AAGGGATCCTTGGACCATATTCGTCCACAAAATGATTCTGAATTAGCTGTATCG TCAAGGCA CTCTTGCCTAGG, as shown in Seq No.11.

PCR amplification system is as follows:

-

The above system is reacted in PCR instrument by following procedure: 95 DEG C of initial denaturation 5min, recycles (95 DEG C of -15s, 58 into three steps DEG C -15s, 72 DEG C of -15s totally 30 circulations), last 72 DEG C of -1min.

Template is the plasmid for the 13rd bit codon mutation that the wild plasmid that embodiment one constructs and embodiment two construct. First measure template plasmid OD, adjustment concentration to every microlitre of 20ng.Wild plasmid and mutant plasmids are mixed by molecule copy number Be combined into wild type: saltant type is respectively as follows: 3000:1,10000:1,30000:1.Wherein wild template plasmid is in 25 microlitres of reactants Total amount in system is 20ng, and corresponding mutated gene segment is followed successively by 6.67pg, 2pg, 0.67pg.

The digestion of 2.2PCR amplified fragments

2.2.1PCR product purification digestion: by the DNA Purification Kit product of abovementioned steps PCR product Tiangeng. With restriction enzyme HaeIII digestion PCR product；

Using the endonuclease reaction system of 60 μ L, digestion system is as follows:

The subclone blue and white screening of 2.4PCR amplified fragments is tested

Its reaction condition: 37 DEG C are reacted 60 minutes

2.2.2 the PCR product purifying after digestion

PCR product dephosphorylation after 2.3 digestions

The subclone blue and white screening of 2.4PCR amplified fragments is tested

The basic principles, main features and advantages of the present invention have been shown and described above.

It should be understood by those skilled in the art that the present invention is not limited by examples detailed above, in examples detailed above and specification Description merely illustrates the principles of the invention, and the present invention also has various changes without departing from the spirit and scope of the present invention Change and improve, these changes and improvements all fall within the protetion scope of the claimed invention.The claimed scope of the invention is by appended The spirit and scope of the invention define.

Claims (3)

1. the method that a kind of pair of wild type gene and mutated gene carry out the mutated gene analysis of non-disease Clinics and Practices purpose, It is characterized in that, the wild type gene is KRAS gene, the mutated gene is the 12nd bit codon of KRAS gene heat Mutation gene；Described method includes following steps:

(1) wild type sequence plasmid construction corresponding with the 12nd bit codon hot spot mutation of KRAS gene: using people's blood genome as mould Plate carries out PCR with primer a and d shown in SEQ ID NO:2 and 3, constructs wild template；PCR product connects PMD- after purification 19T plasmid finally converts DH5 α Escherichia coli, picked clones sequencing；

(2) the 12nd bit codon hot spot mutation sequence plasmid of KRAS gene constructs:

First round PCR: using people's blood genome as template, PCR is carried out with primer a and b shown in SEQ ID NO:2 and 4, product is ab；Using people's blood genome as template, with primer c, d shown in SEQ ID NO:5 and 3, PCR, product cd are carried out；Second wheel PCR: with the product ab and cd of first round PCR, template mutually extends to form ad, PCR amplification system each other are as follows: 2 × Taqmix 1.0 μ l of 12.5 μ l, product ab segment, product cd segment 1.0 μ l, 10 μM of primer a 0.5 μ l, 10 μM of 0.5 μ l of primer d, H2O is supplied to 25 μ l；PCR product purifying, connection, convert DH5 α Escherichia coli, and product chooses bacterium colony after clone, are sequenced；

(3) PCR amplification is wild with the genetic fragment for containing the 12nd bit codon mutation: template is the wild type sequence plasmid of above-mentioned building With the 12nd bit codon hot spot mutation sequence plasmid, primer is primer e and f shown in SEQ ID NO:6 and 7；

(4) PCR product of step (3) is purified into digestion, digestion uses restriction enzyme BstnI；PCR product after digestion Purifying；

(5) hinder to digestion notch the processing of connection enzyme reaction: by the PCR product rSAP dephosphorization after step (4) digestion Acidification；

(6) connection reaction is mediated with ligase, bacterium colony finally is formed by subclone and carries out mutation analysis.

2. the method for mutated gene according to claim 1 analysis, which is characterized in that step (5) be to digestion notch into Row 5 ' holds dephosphorylation process.

3. the method for mutated gene analysis according to claim 1, which is characterized in that the mutation analysis of step (6) is bacterium Fall PCR primary dcreening operation and first generation sequencing analysis.

Images