CN106399338B - A kind of bioprobe detecting living cell membrane surface tension variations - Google Patents
A kind of bioprobe detecting living cell membrane surface tension variations Download PDFInfo
- Publication number
- CN106399338B CN106399338B CN201610752206.9A CN201610752206A CN106399338B CN 106399338 B CN106399338 B CN 106399338B CN 201610752206 A CN201610752206 A CN 201610752206A CN 106399338 B CN106399338 B CN 106399338B
- Authority
- CN
- China
- Prior art keywords
- cell membrane
- cell
- surface tension
- membrane surface
- bioprobe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43595—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from coelenteratae, e.g. medusae
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6486—Measuring fluorescence of biological material, e.g. DNA, RNA, cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56966—Animal cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Food Science & Technology (AREA)
- Zoology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Genetics & Genomics (AREA)
- Toxicology (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to cell biology and technical field of molecular biology, it is a kind of bioprobe based on FRET technology, it can dynamically detect the variation of living cell membrane surface tension, specifically disclose a kind of bioprobe for detecting living cell membrane surface tension variations.The probe includes FRET fluorescin to ECFP and five YPet, elastomeric sequences Linker, Lyn sequence and K-ras sequence parts.After the probe and the Transfected Recombinant Plasmid to living cells of pcDNA3.1 (+), spontaneous in cell fluorescin fusion probe can be given expression to, qualitatively detect the variation of cell layer tension, and do not influence on cell original function.The probe realizes in active somatic cell to the dynamic detection of cell membrane surface tension variation, have the characteristics that it is at low cost, to cytotoxic side effect, provide a kind of visualization tool for research cell membrane tension variation.
Description
Technical field
It is based on fluorescence resonance energy transfer the invention belongs to cell biology and technical field of molecular biology
(fluorescence resonance energy transfer, FRET) technology and the biology of Subcloned technology design preparation are visited
Needle.It can voluntarily be expressed in living cells, and the variation of cell membrane surface tension is qualitatively reflected by the variation of fluorescence signal.
Background technique
Shear stress causes the change of cell membrane surface tension in cell membrane upper surface first, this physically changed
It may be the basis of tumour cell directional migration.The method of current detecting cell film tension has deformable polymer substrate
Method, microtrabeculae method etc., but they there are spatial resolutions it is low, high to base material requirement the defects of, there is no a kind of has at present conscientiously
The method of effect can measure the variation of living cell membrane surface tension.The present invention proposes a kind of based on FRET skill as a result,
Art, the bioprobe for detecting cell membrane surface tension variation, it has temporal resolution height, low manufacture cost, to cell
The advantages that nonhazardous acts on.
Summary of the invention
The present invention provides a kind of new bio probe of detectable living cell membrane surface tension variations, will in design
FRET technology is in conjunction with Subcloned technology.
Technical solution of the present invention:
A kind of bioprobe detecting living cell membrane surface tension variations, which includes FRET fluorescin
To five ECFP (1-2), YPet (1-4), elastomeric sequences Linker (1-3), Lyn sequence (1-1) and K-ras sequence (1-5) portions
Point, DNA sequence dna is sheared by Subcloned technology and is spliced, and forms recombinant plasmid with vector plasmid pcDNA3.1 (+).
Wherein, the amino acid sequence of Lyn are as follows:
AAATMGCIKSKRKDNLNDDGVDMKT
Its corresponding DNA sequence dna are as follows:
GCGGCCGCCACCATGGGCTGCATCAAGAGCAAGCGCAAGGACAACCTGAACGACGACGGCGTGGACAT
GAAGACC;
The amino acid sequence of K-ras are as follows:
KKKKKKSKTKCVIM
Corresponding DNA sequence dna are as follows:
AAGAAGAAGAAGAAGAAGAGCAAGACCAAGTGCGTGATCATG;
The amino acid sequence of elastomeric sequences Linker are as follows:
GPGGAGPGGAGPGGAGPGGAGPGGAGPGGAGPGGAGPGGA
Corresponding DNA sequence dna are as follows:
GGTCCAGGAGGCGCAGGACCTGGCGGGGCTGGACCGGGTGGCGCGGGACCCGGCGGAGCCGGCCCAGG
TGGGGCGGGCCCTGGTGGTGCTGGTCCGGGAGGGGCAGGGCCCGGAGGTGCC。
Beneficial effects of the present invention: the probe, which is realized, examines the dynamic of cell membrane surface tension variation in active somatic cell
Survey, have the characteristics that it is at low cost, to cytotoxic side effect, provide a kind of visual chemical industry to study cell membrane tension variation
Tool.
Detailed description of the invention
Fig. 1 is the schematic diagram of bioprobe MSS for detecting living cell membrane surface tension variations a kind of.
Fig. 2 is the working principle diagram for detecting the bioprobe MSS of living cell membrane surface tension variations.
In figure: 1-1Lyn sequence;1-2FRET fluorescin is to ECFP;1-3 elastomeric sequences Linker;1-4YPet;
1-5K-ras sequence.
Specific embodiment
Below in conjunction with attached drawing and technical solution, a specific embodiment of the invention is further illustrated.
After this probe is transfected into living cell body using transfection reagent, it can voluntarily give expression to fluorescin fusion and visit
The Lyn sequence 1-1 and K-ras sequence 1-5 of needle construction, both ends is connected with cell membrane respectively, when external force makes cell membrane surface
When power changes, elastomeric sequences Linker1-3 can be stretched or compress, cause FRET fluorescin to ECFP 1-2 and
The change of distance between YPet1-4, so as to cause the change of FRET signal.Swashing for 436nm wavelength is given to the cell after transfection
Hair is acquired the fluorescent image on 474nm and 530nm wavelength simultaneously using FRET microscope, then passes through 474nm/530nm fluorescence
The efficiency of intensity analysing energy transfer, to obtain the information of cell membrane surface tension variation.
A kind of bioprobe that can detect living cell membrane surface tension variations, nucleotide sequence:
A kind of bioprobe that can detect living cell membrane surface tension variations, amino acid sequence:
Claims (1)
1. a kind of bioprobe for detecting living cell membrane surface tension variations, which is characterized in that the bioprobe includes
FRET fluorescin is to ECFP (1-2), YPet (1-4), elastomeric sequences Linker (1-3), Lyn sequence (1-1) and K-ras sequence
Five parts (1-5) are sheared DNA sequence dna by Subcloned technology and are spliced, and form recombination matter with vector plasmid pcDNA3.1 (+)
Grain;
Wherein, the amino acid sequence of Lyn are as follows:
AAATMGCIKSKRKDNLNDDGVDMKT
Its corresponding DNA sequence dna are as follows:
GCGGCCGCCACCATGGGCTGCATCAAGAGCAAGCGCAAGGACAACCTGAACGACGACGGCGTGGACATGAAG
ACC;
The amino acid sequence of K-ras are as follows:
KKKKKKSKTKCVIM
Corresponding DNA sequence dna are as follows:
AAGAAGAAGAAGAAGAAGAGCAAGACCAAGTGCGTGATCATG;
The amino acid sequence of elastomeric sequences Linker are as follows:
GPGGAGPGGAGPGGAGPGGAGPGGAGPGGAGPGGAGPGGA
Corresponding DNA sequence dna are as follows:
GGTCCAGGAGGCGCAGGACCTGGCGGGGCTGGACCGGGTGGCGCGGGACCCGGCGGAGCCGGCCCAGGTGGG
GCGGGCCCTGGTGGTGCTGGTCCGGGAGGGGCAGGGCCCGGAGGTGCC。
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610752206.9A CN106399338B (en) | 2016-08-29 | 2016-08-29 | A kind of bioprobe detecting living cell membrane surface tension variations |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610752206.9A CN106399338B (en) | 2016-08-29 | 2016-08-29 | A kind of bioprobe detecting living cell membrane surface tension variations |
Publications (2)
Publication Number | Publication Date |
---|---|
CN106399338A CN106399338A (en) | 2017-02-15 |
CN106399338B true CN106399338B (en) | 2019-05-14 |
Family
ID=58003761
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610752206.9A Active CN106399338B (en) | 2016-08-29 | 2016-08-29 | A kind of bioprobe detecting living cell membrane surface tension variations |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106399338B (en) |
Families Citing this family (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108120836B (en) * | 2017-12-06 | 2020-08-14 | 大连理工大学 | Fluorescent biological probe for detecting force transfer of Paxillin protein in living cells |
CN111378050B (en) * | 2018-12-29 | 2023-04-07 | 深圳先进技术研究院 | Fusion protein and application thereof |
CN110981943B (en) * | 2019-12-02 | 2021-08-03 | 清华大学 | Polypeptide, application thereof in preparation of medicine and medicine |
CN114672503B (en) * | 2022-03-21 | 2023-10-13 | 大连理工大学 | Biological stress sensor for connecting microfilaments and local adhesive spots in living cells |
CN115947866B (en) * | 2022-09-28 | 2024-04-19 | 大连理工大学 | FRET-based biological probe for detecting Paxillin protein activity in living cells and recombinant plasmid thereof |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2003043577A2 (en) * | 2001-11-19 | 2003-05-30 | Iconix Pharmaceuticals, Inc. | Modulators of rho c activity |
CN103228669A (en) * | 2010-09-27 | 2013-07-31 | 国立大学法人京都大学 | Linker for unimolecular FRET biosensor based on principle of fluorescence resonance energy transfer |
CN105784656A (en) * | 2016-03-16 | 2016-07-20 | 大连理工大学 | Biological probe for detecting activity of RhoGDIalpha (Rho GDP dissociation inhibitor alpha) protein in living cell |
-
2016
- 2016-08-29 CN CN201610752206.9A patent/CN106399338B/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2003043577A2 (en) * | 2001-11-19 | 2003-05-30 | Iconix Pharmaceuticals, Inc. | Modulators of rho c activity |
CN103228669A (en) * | 2010-09-27 | 2013-07-31 | 国立大学法人京都大学 | Linker for unimolecular FRET biosensor based on principle of fluorescence resonance energy transfer |
CN105784656A (en) * | 2016-03-16 | 2016-07-20 | 大连理工大学 | Biological probe for detecting activity of RhoGDIalpha (Rho GDP dissociation inhibitor alpha) protein in living cell |
Also Published As
Publication number | Publication date |
---|---|
CN106399338A (en) | 2017-02-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN106399338B (en) | A kind of bioprobe detecting living cell membrane surface tension variations | |
Abrego-Martinez et al. | Aptamer-based electrochemical biosensor for rapid detection of SARS-CoV-2: Nanoscale electrode-aptamer-SARS-CoV-2 imaging by photo-induced force microscopy | |
Moghadam et al. | Isotachophoretic preconcenetration on paper-based microfluidic devices | |
Löf et al. | Multiplexed protein force spectroscopy reveals equilibrium protein folding dynamics and the low-force response of von Willebrand factor | |
Patel et al. | Biosensors in health care: the milestones achieved in their development towards lab‐on‐chip‐analysis | |
Kapanidis et al. | Alternating-laser excitation of single molecules | |
Zhang et al. | Bipolar electrodes with 100% current efficiency for sensors | |
Jurchenko et al. | Lighting up the force: investigating mechanisms of mechanotransduction using fluorescent tension probes | |
Hemmig et al. | Optical voltage sensing using DNA origami | |
Yang et al. | Sudoku-like lab-on-paper cyto-device with dual enhancement of electrochemiluminescence intermediates strategy | |
Peretz-Soroka et al. | Optically-gated self-calibrating nanosensors: monitoring pH and metabolic activity of living cells | |
Xing et al. | Bipolar electrode based reversible fluorescence switch using Prussian blue/Au nanoclusters nanocomposite film | |
Qi et al. | Wireless electrochemiluminescence with disposable minidevice | |
Lemke et al. | Microfluidic device for single-molecule experiments with enhanced photostability | |
Li et al. | Porous graphene oxide enhanced aptamer specific circulating-tumor-cell sensing interface on light addressable potentiometric sensor: clinical application and simulation | |
Minteer | Advances in electroanalytical chemistry | |
Komatsuzaki et al. | Compact halo-ligand-conjugated quantum dots for multicolored single-molecule imaging of overcrowding GPCR proteins on cell membranes. | |
Abdul Ghani et al. | Portable electrochemical biosensors based on microcontrollers for detection of viruses: a review | |
CN105784656B (en) | The bioprobe of RhoGDI α protein active in a kind of detection living cells | |
Zheng et al. | Improving flow bead assay: Combination of near-infrared optical tweezers stabilizing and upconversion luminescence encoding | |
Su et al. | Observing conformations of single FoF1-ATP synthases in a fast anti-Brownian electrokinetic trap | |
Fang et al. | Integrated cardiomyocyte-based biosensing platform for electroporation-triggered intracellular recording in parallel with delivery efficiency evaluation | |
Burden et al. | Mechanically enhancing planar lipid bilayers with a minimal actin cortex | |
Yu et al. | Microfluidic paper-based preconcentration and retrieval for rapid ribonucleic acid biomarker detection and visualization | |
Pan et al. | Quantifying molecular-to cellular-level forces in living cells |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |