CN106399258A - Human estrogen receptor [alpha] subtype monoclonal antibody hybridoma cell line, monoclonal antibody, preparation method and application - Google Patents
Human estrogen receptor [alpha] subtype monoclonal antibody hybridoma cell line, monoclonal antibody, preparation method and application Download PDFInfo
- Publication number
- CN106399258A CN106399258A CN201610484775.XA CN201610484775A CN106399258A CN 106399258 A CN106399258 A CN 106399258A CN 201610484775 A CN201610484775 A CN 201610484775A CN 106399258 A CN106399258 A CN 106399258A
- Authority
- CN
- China
- Prior art keywords
- cell
- monoclonal antibody
- human estrogen
- alpha hypotype
- alpha
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2869—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against hormone receptors
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/72—Assays involving receptors, cell surface antigens or cell surface determinants for hormones
- G01N2333/723—Steroid/thyroid hormone superfamily, e.g. GR, EcR, androgen receptor, oestrogen receptor
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Pathology (AREA)
- Microbiology (AREA)
- General Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Endocrinology (AREA)
- Neurology (AREA)
- Genetics & Genomics (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to the field of biotechnology, and in particular discloses a human estrogen receptor [alpha] subtype monoclonal antibody hybridoma cell line, a human estrogen receptor [alpha] subtype monoclonal antibody, a preparation method and an application. The human estrogen receptor [alpha] subtype hybridoma cell line provided by the invention, which is obtained by conducting immunohistochemical validation and screening on human breast carcinoma ER[alpha] tissue wax blocks, is strong in capacity of secreting the antibody, high in valence of the secreted antibody and strong in specificity. The monoclonal antibody provided by the invention can be used for evaluating the expression of estrogen receptor [alpha] subtype in such pathological tissues as breast carcinoma and the like in an immunohistochemical mode, so as to provide guidance for following clinical examination and analysis. Meanwhile, the antibody can be used for preparing an immunoassay tool for detecting the estrogen receptor [alpha] subtype. The antibody provided by the invention can react with human estrogen receptor [alpha] subtype protein while the antibody has no cross reaction with human estrogen receptor [beta] subtype protein and other proteins in cells, so that the specificity, accuracy and reliability of human estrogen receptor [alpha] subtype immunoassay are significantly improved.
Description
Technical field
The present invention relates to biological technical field is and in particular to human estrogen acceptor alpha hypotype monoclonal antibody hybridoma cell strain, human estrogen acceptor alpha hypotype monoclonal antibody, preparation method, application.
Background technology
Estrogen receptor (estrogen receptor, ER) is the nuclear receptor of a class steroid hormone superfamily, generally mediates the secretory action of estrogen in people with animal body.1967, Jensen etc. is found that ER in breast cancer tissue first, 1996, Mosselman etc. is found that a kind of similar nuclear receptor of structure in testis tissue, now it is referred to as ER β hypotype, and the former is referred to as ER alpha hypotype, two hypotypes of above-mentioned estrogen receptor have common structural framing, by three independences but interactional functional areas are constituted：Amino terminal (A/B area), DNA land (C area), the ligand binding domain (D/E/F area) of C-terminal.Estrogen receptor and corresponding ligand binding, cause the change of estrogen receptor configuration, interact with corresponding regulatory factor, and then estrogen receptor is combined with corresponding response gene, and this series of process is all closely related with these three structure function areas.Estrogen (17 β-estradiol, E2) is located in brains or karyon, is the major ligand of estrogen receptor, has the effect turning green base.E2, once being combined with estrogen, will occur change to be configured to dimer, then with Estrogen receptor response element (estrogen response element, ERE) gather, target gene is stimulated to turn green, thus adjusting estrogen to promote hyperplasia, differentiation and the normal physiological function of maintenance.
As one of hypotype, ER α receptor is mainly distributed on the tissue that some have been generally acknowledged that estrogen effect, if uterus, mammary gland, Placenta Hominiss, liver, central nervous system, cardiovascular system and osseous tissue, these tissues are containing more ER α, the expression of E2 response gene can be induced, therefore detect ER α expression in the tissue, by as judging one of marks of tumor cell such as breast carcinoma, pulmonary carcinoma, gastric cancer, colon cancer, cervical cancer, hysteromyoma, bladder cancer, ovarian cancer.Clinically mainly detected by the expression that the method for immunohistochemistry (IHC) is directed to ER α in tumor tissues in the middle of actual pathology detection at present, and then in evaluation pathological tissue estrogen level height, for tumor cell pathological changes situation diagnosis provide foundation.Therefore used in said method, the quality of ER alpha monoclonal antibodies determines the accuracy of whole testing result, therefore develop the high human estrogen acceptor alpha hypotype monoclonal antibody of a kind of high specificity, sensitivity, the diagnosis being clinically directed to the disease such as breast carcinoma, pulmonary carcinoma, gastric cancer, colon cancer, cervical cancer, hysteromyoma, bladder cancer, ovarian cancer is had great importance.
Content of the invention
An object of the present invention is to provide human estrogen acceptor alpha hypotype monoclonal antibody hybridoma cell strain, and this cell strain being capable of the high human estrogen acceptor alpha hypotype monoclonal antibody of stably excreting high specificity, sensitivity.
The second object of the present invention is to provide human estrogen acceptor alpha hypotype monoclonal antibody, and this antibody is combined with ER alpha specific, with albumen no cross reactions such as intracellular ER β, PR, P53, AFP.
The third object of the present invention is to provide the present inventor's estrogen receptor alpha subtype monoclonal antibody to be used for the application in the immune detection instrument detecting ER α albumen in preparation, significantly improve specificity, accuracy and the reliability of the detection of ER alpha immunization, the expression of ER α albumen in actual response tumor cell, can be applicable to the detection to ER α protein expression situation in the associated tumor tissues such as breast carcinoma, pulmonary carcinoma, gastric cancer, colon cancer, cervical cancer, hysteromyoma, bladder cancer, ovarian cancer.
The fourth object of the present invention is the application providing the present inventor's estrogen receptor alpha subtype monoclonal antibody in preparing the reagent being used for tagged tissue cell or test kit.
The fifth object of the present invention is the preparation method providing human estrogen acceptor alpha hypotype monoclonal antibody hybridoma cell strain.
In order to realize object above, the technical solution adopted in the present invention is：
Human estrogen acceptor alpha hypotype monoclonal antibody hybridoma cell strain, is prepared by following methods：Include following operating procedure successively：The structure of ER α expression of recombinant proteins plasmid, the expression and purification of ER α recombiant protein, the Mouse spleen cells of ER α recombiant protein immunity and myeloma cell fusion, cell screening and clone；Wherein cell screening and the concrete grammar of clone are：Cell after culture fusion, preliminary screening goes out to present with ER α antigen the cell of positive reaction in supernatant, take the supernatant of the cell that preliminary screening goes out, using the ER α assaypositive tissue wax stone collecting acquisition, the supernatant of the cell that preliminary screening is gone out carries out SABC checking, screening obtains the cell strain being consistent with the actual clinical testing result of ER α assaypositive tissue wax stone, then according to limiting dilution assay, sub-clone is carried out to this cell strain, obtain final product described human estrogen acceptor alpha hypotype monoclonal antibody hybridoma cell strain.
Above-mentioned SABC checking refers to resist with the cell supernatant that preliminary screening goes out for one, carries out immune detection to human breast carcinoma tissue cell ER α positive wax stone.
The concrete grammar of the structure of described ER α expression of recombinant proteins plasmid is：Nucleotide sequence according to corresponding to human estrogen acceptor alpha hypotype protein sequence, design primer, amplification is from the gene order of 901bp to 1788bp, introduce restriction endonuclease sites BamHI and XhoI at gene order two ends respectively, by in the gene insertion expression vector pET-28a after amplification, obtain final product described ER α expression of recombinant proteins plasmid；The nucleotide sequence of wherein human estrogen acceptor alpha hypotype as shown in SEQ ID NO.1,888bp；ER α protein sequence is as shown in SEQ ID NO.2；Described primer
Upstream primer sequence：SEQ ID NO.3：CGCCATATGTCTAAGAAGAACAGC；
Downstream primer sequence：SEQ ID NO.4：CCGGTGCTCTCAGACCGTGGCAGG.Wherein underscore represents gene insertion site.
The concrete grammar of the expression and purification of described ER α recombiant protein is：By ER α recombinant expression plasmid Transformed E .coli cell，Filter out positive thalline，After induction, cracking is collected by centrifugation supernatant，Supernatant is filtered through 0.22 μm of filter，Cross His purification nickel post using the PBS of the 0.01M pH7.2 containing 2% imidazoles，Cleaning balance，Then with the PBS balance nickel post without imidazoles，The nickel post after supernatant loading balance after filtering，Coutroi velocity is 0.5～1mL/min，Then through 50mM、100mM、200mM、350mM、500mM imidazoles carries out gradient elution，Collect eluting fraction respectively，Carry out gel electrophoresiss checking，Screening is identical with ER α protokaryon part expressing protein theoretical molecular size、One group of single fraction of band，Using the PBS dialyzed overnight of the above-mentioned 0.01M pH7.2 containing 2% imidazoles under the conditions of 4 DEG C，Complete the purification of ER α recombiant protein.
Described ER α recombinant expression plasmid is transfected E.coli cell, filter out positive thalline, cracking after induction is collected by centrifugation the concrete grammar of supernatant and is：Recombiant plasmid is taken 10 μ L to add in E.coil bacterium competence cell, 30～50min is placed on ice after mixing, put into heat shock 90s in 42 DEG C of water-baths immediately after, static 3～5min on ice, add the LB non-resistant culture fluid of 0.8～1mL, 37 DEG C of shaking tables shake 45～60min, are seeded in the LB Semi-solid cell culture plate containing Kana antibiotic, are inverted into incubated overnight 12～14 hours in 37 DEG C of incubators；In monoclonal bacterium colony on picking culture dish and LB culture fluid, 37 DEG C are shaken bacterium to OD value is 0.6～0.8, adds IPTG derivant to final concentration 1～1.5mM, induces 4h, thalline is collected by centrifugation, ultrasonication is collected by centrifugation supernatant at 37 DEG C.
The Mouse spleen cells of described ER α recombiant protein immunity are prepared by following methods：Take ER α recombiant protein immune mouse after purification, carry out secondary immunity, second immunity and first time immunization interval 3 weeks, second immune after take within 2 weeks tail blood to carry out the evaluation of potency ELISA, take the spleen cell of the higher mice of antibody titer to carry out follow-up cell fusion.
The Mouse spleen cells of described ER α recombiant protein immunity with the concrete grammar of myeloma cell fusion are：After Mouse spleen cells after immunity are ground and myeloma cell is according to 5～10:1 ratio mixes, centrifugation, merged with 50% PEG-4000 at 37 DEG C, RPMI-1640 culture medium is added to terminate after fusion, it is centrifuged 10min under the conditions of 1200rpm, using the 10%FBS culture medium containing HAT resuspended after carry out bed board according to the total cell density in 10～200,000/hole, be placed in CO2 gas incubator culture.
The concrete grammar that preliminary screening goes out the cell assuming positive reaction with ER α antigen in supernatant is：When cell mass grows to the number that can be detected on orifice plate, according to the package amount in 200ng/ hole, under the conditions of 4 DEG C, overnight it is coated ER α albumen, after second day pats dry, every hole adds the PBST confining liquid containing 5%BSA of 120～150 μ L, be placed in incubation 2h at 37 DEG C.After pat dry, add cells and supernatant to be detected, after test and have or not the antigen reactive antibody with ER α according in ELISA indirect method detection supernatant, screening retains the cell strain having immunoreation with ER α.
Human estrogen acceptor alpha hypotype monoclonal antibody, is obtained by above-mentioned human estrogen acceptor alpha hypotype monoclonal antibody hybridoma cell strain secretion.
Above-mentioned human estrogen acceptor alpha hypotype monoclonal antibody, is prepared by following methods：Human estrogen acceptor alpha hypotype monoclonal antibody hybridoma cell strain is carried out amplification culture in Cell culture invitro bottle, implants mouse peritoneal afterwards, collect ascites, separate, purification obtains human estrogen acceptor alpha hypotype monoclonal antibody；The concrete grammar of wherein purification is：By the ascites to be purified after separation through in overbalance completely Protein G chromatographic column, citrate buffer solution using pH3.0 carries out eluting, collect at peak value and flow out phase, adjustment pH value between 7.0～7.6, collect and obtain described antibody by the PBS through 0.01M pH 7.2.
Flow velocity after described purge process midfield water flows through Protein G chromatographic column is 0.5～1mL/min.
Above-mentioned human estrogen acceptor alpha hypotype monoclonal antibody is used in preparation applying in the immune detection instrument detect human estrogen acceptor alpha hypotype albumen.
Described immune detection instrument is reagent, test kit, chip, reagent paper or magnetic particle.
Above-mentioned human estrogen acceptor alpha hypotype monoclonal antibody is used for the application in the reagent of tagged tissue cell, test kit or chip in preparation.
Described histiocyte is breast carcinoma, pulmonary carcinoma, gastric cancer, colon cancer, cervical cancer, the histiocyte of hysteromyoma, bladder cancer or ovarian cancer.
The present inventor's estrogen receptor alpha subtype monoclonal antibody hybridoma cell strain，The cell assuming positive reaction with ER α antigen that preliminary screening is gone out，The further human breast carcinoma ER α assaypositive tissue wax stone being obtained using collection，SABC checking is carried out to it，Screening obtains the clinical expected cell strain meeting with human breast carcinoma ER α assaypositive tissue wax stone，This hybridoma cell strain secretion human estrogen acceptor alpha hypotype monoclonal antibody is combined with ER α protein-specific，And with other albumen no cross reactions intracellular，Significantly improve the specificity of ER alpha immunization detection、Accuracy and reliability，ER α protein expression situation in true reflection tumor cell，Can be used for breast carcinoma、Pulmonary carcinoma、Gastric cancer、Colon cancer、Cervical cancer、Hysteromyoma、Bladder cancer、The detection of ER alpha expression situation in ovarian cancer or associated tumor tissue.
Further, the preparation method of the present inventor's estrogen receptor alpha subtype monoclonal antibody hybridoma cell strain, in the building process that people's ER α expression of recombinant proteins is pelletized, nucleotide sequence according to corresponding to human estrogen acceptor alpha hypotype protein sequence, design primer, amplification, from the gene order of 901bp to 1788bp, improves the purposiveness of hybridoma cell strain preparation and screening process, improves preparation efficiency.
Brief description
Fig. 1 is the antibody C3A8 being prepared with embodiment 2 is an anti-human breast carcinoma ImmunohistochemistryResults Results figure；
Fig. 2 is the antibody C3A8 being prepared with embodiment 2 is anti-human cervical carcinoma's ImmunohistochemistryResults Results figure；
Fig. 3 is the antibody C3A8 being prepared with embodiment 2 is anti-people's carcinoma of endometrium ImmunohistochemistryResults Results figure；
Fig. 4 is the antibody C3A8 being prepared with embodiment 2 is an anti-human colon carcinoma ImmunohistochemistryResults Results figure；
Fig. 5 is the antibody C3A8 being prepared with embodiment 2 is anti-human tonsil's ImmunohistochemistryResults Results figure；
Fig. 6 is the antibody C6H7 being prepared with comparative example is anti-human tonsil's ImmunohistochemistryResults Results figure；
Fig. 7 is the antibody C3A8 being prepared with embodiment 2 is an anti-Human Testis ImmunohistochemistryResults Results figure；
Fig. 8 is the antibody C6H7 being prepared with comparative example is an anti-Human Testis ImmunohistochemistryResults Results figure；
Fig. 9 is the antibody C3A8 being prepared with embodiment 2 is an anti-human adrenal gland ImmunohistochemistryResults Results figure；
Figure 10 is the antibody C6H7 being prepared with comparative example is an anti-human adrenal gland ImmunohistochemistryResults Results figure；
Figure 11 is the antibody C3A8 being prepared with embodiment 2 is anti-people's esophaguses ImmunohistochemistryResults Results figure；
Figure 12 is the antibody C6H7 being prepared with comparative example is anti-people's esophaguses ImmunohistochemistryResults Results figure；
Figure 13 is the antibody C3A8 being prepared with embodiment 2 is anti-people's cerebellum ImmunohistochemistryResults Results figure；
Figure 14 is the antibody C6H7 being prepared with comparative example is anti-people's cerebellum ImmunohistochemistryResults Results figure；
Figure 15 is the antibody C3A8 being prepared with embodiment 2 is anti-people's leiomyoma of uterus ImmunohistochemistryResults Results figure；
Figure 16 is the antibody C6H7 being prepared with comparative example is anti-people's leiomyoma of uterus ImmunohistochemistryResults Results figure.
Specific embodiment
The invention discloses a kind of human estrogen acceptor alpha hypotype monoclonal antibody hybridoma cell strain, human estrogen acceptor alpha hypotype monoclonal antibody and application, those skilled in the art can use for reference present disclosure, be suitably modified technological parameter and realize.Specifically, all similar replacements and change are apparent to those skilled in the art, and they are considered as including in the present invention.The method of the present invention and application are described by preferred embodiment, related personnel is substantially modified to method described herein and application in without departing from present invention, spirit and scope or suitably changes and combine, and to realize and to apply the technology of the present invention.
Below by specific embodiment, technical scheme is described in detail.
In following embodiments, the reagent adopting and raw material are commercial goods.
Embodiment 1
The present embodiment human estrogen acceptor alpha hypotype monoclonal antibody hybridoma cell strain, is prepared by following methods, concrete operation step is：
1) build ER α expression of recombinant proteins plasmid：With the plasmid RC213277 that buys from Beijing OriGene Biotechnology Co., Ltd. as template, nucleotide sequence (as shown in SEQ ID NO.1) according to human estrogen acceptor alpha hypotype, ER α protein sequence (as shown in SEQ ID NO.2), two primers of design enter performing PCR amplification, introduce restriction enzyme site BamHI and XhoI respectively, clone ORF 901bp to 1788bp arrives expression vector pET-28a, sets up ER α expression of recombinant proteins plasmid；Cloning site designs；The upstream primer sequence of described primer：SEQ ID NO.3：CGCCATATGTCTAAGAAGAACAGC；Downstream primer sequence：SEQ ID NO.4：CCGGTGCTCTCAGACCGTGGCAGG；
2) expression and purification of ER α recombiant protein：
A：Transformed E .coil cell：E.coil (BL-21) bacterium competence is taken out from -80 DEG C of environment, pat on ice and thaw, ER α expression of recombinant proteins plasmid is taken 10 μ L to add in competent cell, place 30～50min on ice after mixing, after be immediately placed in heat shock 90s in 42 DEG C of water-baths, static 3～5min on ice, add the LB culture fluid of 0.8～1mL, 37 DEG C of shaking tables shake 45～60min, are seeded in the LB Semi-solid cell culture plate containing Kana antibiotic, are inverted into incubated overnight 12～14 hours in 37 DEG C of incubators；
B：Cell lysis：In monoclonal bacterium colony on picking culture dish and LB culture fluid, 37 DEG C are shaken bacterium to OD value is 0.6～0.8, adds IPTG derivant to final concentration to 1～1.5mM, induces 4h, thalline is collected by centrifugation, ultrasonication is collected by centrifugation supernatant；
C：Ni-sepharose purification：By the supernatant collected centrifugation，Supernatant is filtered through 0.22 μm of filter，Cross His purification nickel post using the PBS of the 0.01M pH 7.2 containing 2% imidazoles，Cleaning balance，Then purify nickel post with the identical PBS balance His without imidazoles，The nickel post after supernatant loading balance after filtering，Coutroi velocity is 0.5～1mL/min，Then through 50mM、100mM、200mM、350mM、500mM imidazoles carries out gradient elution，Collect eluting fraction respectively，Carry out gel electrophoresiss checking，Screening is identical with ER α protokaryon part expressing protein theoretical molecular size、One group of single fraction of band，Using the PBS dialyzed overnight of the above-mentioned 0.01M pH7.2 containing 2% imidazoles under the conditions of 4 DEG C，Complete the purification of ER α recombiant protein，Protein concentration is measured under ultraviolet spectrophotometer，Adjust to 1mg/mL；
3) Mouse spleen cells of ER α recombiant protein immunity and myeloma cell fusion：
A:Protein immunization：Using from the fast adjuvant-free of Quickantibody (five weeks) that Beijing Bo Aolong Immune Technology Corp. buys and step 2) in ER α recombiant protein after purification according to volume 1:1 mixing carries out the immunity of Balb/c mice (Henan Province's animal experimental center) leg muscle, carry out immunity twice successively, second immunity and first time immunization interval 3 weeks, take within 2 weeks tail blood to carry out the evaluation of potency ELISA after second immunity, take the mice that antibody titer reaches requirement to carry out cell fusion；
B：Cell fusion：
After taking the spleen cell that antibody titer in step A reaches the mice of requirement to be ground and SP2/0 cell number is according to 5～10:1 proportionate relationship mixes, centrifugation, merged with 50% PEG-4000 at 37 DEG C, RPMI-1640 culture medium is added to terminate after fusion, it is centrifuged 10min under the conditions of 1200rpm, using the 10%FBS culture medium containing HAT resuspended after carry out bed board according to the total cell density in 10～200,000/hole, be placed in CO2 gas incubator culture；
4) cell screening and clone：
Whne step 3) when fused cell group grows to the number that can be detected in aperture plate, package amount according to 200ng/ hole, overnight it is coated ER α antigen under the conditions of 4 DEG C, carry out detecting using ELISA indirect method and in cell conditioned medium, have or not the antigen reactive antibody with ER α, preliminary screening retains the cell having immunoreation with ER α；Take the supernatant of the cell that preliminary screening goes out, using the human breast carcinoma ER α assaypositive tissue wax stone collecting acquisition, the supernatant of the cell that preliminary screening is gone out carries out SABC checking, screening obtains the cell strain that is consistent with the actual clinical testing result of human tissue cell ER α assaypositive tissue wax stone, then according to limiting dilution assay, sub-clone is carried out to this cell strain, obtain final product described human estrogen acceptor alpha hypotype monoclonal antibody hybridoma cell strain, be named as C3A8.
Embodiment 2
The present embodiment human estrogen acceptor alpha hypotype monoclonal antibody, is prepared by following methods, concrete operation step is：
1) ascites preparation：The human estrogen acceptor alpha hypotype monoclonal antibody hybridoma cell strain of Example 1 preparation is enlarged cultivating, after collecting acquisition 100～2,000,000 cell, implantation has been injected into the mouse peritoneal of paraffin oil in advance, collect in good time and obtain ascites, then by ascites through 5000rpm, 2min centrifugation removes erythrocyte and upper strata paraffin oil, and according to 1：The PBS that 1 volume ratio counts 0.01M pH7.2 dilutes the ascites after isolating and purifying；
2) antibody purification：Protein G post is utilized above-mentioned PBS balance, then by loading ring by step 1) ascites after purification add balance after Protein G post on, flow velocity is adjusted to 0.5～1mL/min, after end of the sample, citrate buffer solution using pH 3.0 carries out eluting, collect at peak value and flow out phase, receive the antibody protein flowing out at peak value using pH 8.0Tris buffer, adjustment pH value is between 7.0～7.6, PBS through 0.01M pH 7.2 is collected and is obtained final product human estrogen acceptor alpha hypotype monoclonal antibody, is named as C3A8 antibody.
Comparative example
This comparative example human estrogen acceptor alpha hypotype monoclonal antibody hybridoma cell strain is《Biotechnology communications》Vol.26 No.2Mar, 2015 publications are entitled《The preparation of estrogen receptor alpha type antibody and clinical application research》, author be Liu Lingling, Zhai Jinyu, Qi Hua, the secretory antibody C6H7 described in paper hybridoma cell strain.
Test example 1
The human estrogen acceptor alpha hypotype monoclonal antibody hybridoma cell strain of same number embodiment 1 preparation is taken to cultivate secretory antibody under the same conditions with the human estrogen acceptor alpha hypotype monoclonal antibody hybridoma cell strain of comparative example preparation, by the detection of ELISA indirect method, being detected, result is as shown in table 1 below to the ability of both secretory antibodies and antibody titer：
Table 1
Result shown in above-mentioned table 1, the hybridoma cell strain secretory antibody ability of the embodiment of the present invention 1 preparation is strong, the hybridoma cell strain that the antibody titer of secretion is prepared apparently higher than comparative example.
The specificity of human estrogen acceptor alpha hypotype monoclonal antibody C3A8 antibody of test example 2 embodiment of the present invention 2 preparation and susceptiveness detection
Test method：Human estrogen acceptor alpha hypotype monoclonal antibody and ER β, PR, P53, AFP, ER α albumen is taken to carry out cross reaction checking, (wavelength 450nm is detected using indirect ELISA, reference wavelength 630nm), test group adopts the C3A8 antibody of embodiment 2 preparation, matched group comes card 6F11 antibody using commercially available, and testing result is as shown in table 2 below：
Table 2 C3A8 antibody and each antigenic cross-reaction result
Result shown in above-mentioned table 2, the present inventor's estrogen receptor alpha subtype monoclonal antibody is combined with ER α protein-specific, and with other albumen no cross reactions intracellular, significantly improve specificity, accuracy and the reliability of the detection of ER alpha immunization.
The monoclonal antibody C3A8 antibody of test example 2 embodiment of the present invention 2 preparation is an anti-SABC detection
1st, test method：Concrete operation step is as follows：
(1) take and collected the expressions of ER α positive wax stone obtaining by Henan Prov. People's Hospital, be placed in low temperature in -20 DEG C of refrigerators and place 30～60min, cut into slices using Leica histotome, 3 μm of tissue thickness, it is placed on adhesion microscope slide；
(2) bake piece：The adhesion microscope slide that section is obtained is placed in 60 DEG C and dries roasting piece 20min in piece machine；
(3) dewax：Section after step 2 is processed is placed in each 10min in dimethylbenzene I, dimethylbenzene II；Dimethylbenzene I, II are the pure dimethylbenzene of analysis；
(4) wash dimethylbenzene：Section is respectively placed in each 5min of pure analysis absolute ethyl alcohol I, II, each 5min in 95% concentration, 80% concentration, 70% concentration, 50% concentration ethanol；
(5) antigen retrieval：Antigen retrieval buffers are preheated, and puts into washing the section after dimethylbenzene wherein, heat 20min.Afterwards to about 30 DEG C of room temperature；Deionized water wash soaks 5min, washed once；
(6) endogenous peroxydase closing：With in Leica reagent peroxidase blocking reagent and biopsy tissues endogenous peroxydase 5min, TBS washing (rinse and soak) 10min；
(7) protein blocking agent closing：It is incubated 5min, TBS washing (rinse and soak) 10min using Leica reagent protein blocking agent biopsy tissues；
(8) one resist：Plus C3A8 antibody (1:500 dilution proportion), 37 DEG C of incubation 60min, TBS washing (rinse and soak) 10min；
(9) two resist：Plus NovoLink polymer (two resist) the incubation 30min of leica, TBS washing (rinse and soak) 10min；
(10) DAB colour developing：Using DAB in leica (1:20 proportional arrangement) colour developing 5min, soaks 5min using deionized water rinsing；
(11) haematoxylin redyeing：Using the haematoxylin redyeing 5min in Leica, soak 5min using deionized water rinsing；
(12) dehydration with transparent：Sequentially pass through ethanol and each 2min of dehydrated alcohol I, II of 50%, 70%, 80%, 95% concentration, each 2min of dimethylbenzene II, I；
(13) close：After slice tissue dimethylbenzene volatilization finishes, using neutral gum mounting, it is placed in Microscopic observation, as shown in Figure 1.
Take respectively according to above-mentioned same method and collected the human cervical carcinoma ER α positive wax stone obtaining, carcinoma of endometrium ER α positive wax stone, human colon carcinoma ER α positive wax stone by Henan Prov. People's Hospital, carry out SABC detection, result is as shown in Figure 2, Figure 3, Figure 4.
2nd, experimental result：
By shown in Fig. 2-5, specific cell matter and nuclear staining can be seen in human breast carcinoma, carcinoma of endometrium, gastric cancer, cervical cancer tissues, result and ER α positioning in the cell and tissue expression are consistent, show that the C3A8 antibody of embodiment 2 preparation can be used for Immunohistochemical detection ER α cell inner expression level.
Above-mentioned result of the test also indicates that the above-mentioned human estrogen acceptor alpha hypotype monoclonal antibody of present invention preparation can be used for preparation for detecting the immune detection instrument such as agent, test kit, chip, reagent paper or magnetic particle of human estrogen acceptor alpha hypotype albumen.Same can also be used for preparation for histiocytic reagent, test kit or chips such as labelling breast carcinoma, pulmonary carcinoma, gastric cancer, colon cancer, cervical cancer, hysteromyoma, bladder cancer or ovarian cancers.
Test example 3 SABC contrast verification is tested
Test method：According to the method for immunohistochemical detection described in test example 2 respectively with embodiment 2 preparation antibody C3A8 and comparative example described in antibody C6H7 be one resist, Henan Prov. People's Hospital is collected with the tonsil ER α positive wax stone obtaining, testis ER α positive wax stone, adrenal gland ER α positive wax stone, esophaguses ER α positive wax stone, cerebellum ER α positive wax stone, leiomyoma of uterus ER α positive wax stone, carry out SABC comparison and detection, result is as shown in Fig. 5～Figure 16, same tissue order section ImmunohistochemistryResults Results from figure, non-specific dyeing is all occurred in that in various degree in a group of C6H7 antibody mediated immunity group result, i.e. (cell membrane outside non-positive position, Cytoplasm) occur in that dyeing.It can thus be appreciated that, the antibody C3A8 of embodiment 2 preparation is consistent with ER α positioning in the cell and tissue expression in tonsil, testis, adrenal gland, esophaguses, cerebellum, uterine smooth muscle tumor tissue, no non-specific binding, and the antibody C6H7 described in comparative example occurs in that non-specific binding, show that the present invention prepares the specificity of human estrogen acceptor alpha hypotype monoclonal antibody hybridoma cell strain secretory antibody and is substantially better than the specificity of hybridoma cell strain secretory antibody described in comparative example.
Claims (10)
1. the strain of human estrogen acceptor alpha hypotype monoclonal antibody hybridoma cell is it is characterised in that by following methods system
Standby acquisition：Include following operating procedure successively：The structure of ER α expression of recombinant proteins plasmid, ER α recombiant protein
Expression and purification, Mouse spleen cells and myeloma cell fusion, the cell screening of the immunity of ER α recombiant protein and gram
Grand；Wherein cell screening and the concrete grammar of clone are：Cell after culture fusion, preliminary screening goes out in supernatant
Assume the cell of positive reaction with ER α antigen, take the supernatant of the cell that preliminary screening goes out, obtained using collecting
ER α assaypositive tissue wax stone, the supernatant of the cell that preliminary screening is gone out carries out SABC checking, screening obtain with
The cell strain that the actual clinical testing result of ER α assaypositive tissue wax stone is consistent, then to this cell strain according to limited dilute
Interpretation of the law carries out sub-clone, obtains final product described human estrogen acceptor alpha hypotype monoclonal antibody hybridoma cell strain.
2. human estrogen acceptor alpha hypotype monoclonal antibody hybridoma cell strain as claimed in claim 1, its feature
It is, the concrete grammar of the structure of described ER α expression of recombinant proteins plasmid is：According to human estrogen acceptor alpha hypotype
Nucleotide sequence corresponding to protein sequence, designs primer, expands the gene order from 901bp to 1788bp,
Introduce restriction endonuclease sites BamHI and XhoI at gene order two ends respectively, by the gene insertion table after amplification
Reach in carrier pET-28a, obtain final product described ER α expression of recombinant proteins plasmid；Wherein human estrogen acceptor alpha hypotype
Nucleotide sequence as shown in SEQ ID NO.1,888bp；ER α protein sequence is as shown in SEQ ID NO.2；
Described primer
Upstream primer sequence：SEQ ID NO.3：CGCCATATGTCTAAGAAGAACAGC；
Downstream primer sequence：SEQ ID NO.4：CCGGTGCTCTCAGACCGTGGCAGG.
3. human estrogen acceptor alpha hypotype monoclonal antibody hybridoma cell strain as claimed in claim 1, its feature
It is, the concrete grammar of the expression and purification of described ER α recombiant protein is：ER α recombinant expression plasmid is converted
E.coli cell, filters out positive thalline, and cracking after induction is collected by centrifugation supernatant, by supernatant through 0.22 μm
Filter filters, and crosses His purification nickel post using the PBS of the 0.01M pH7.2 containing 2% imidazoles, and cleaning balances, then
With the PBS balance nickel post without imidazoles, the nickel post after supernatant loading balance after filtering, coutroi velocity is
0.5～1mL/min, then carries out gradient through 50mM, 100mM, 200mM, 350mM, 500mM imidazoles and washes
De-, collect eluting fraction respectively, carry out gel electrophoresiss checking, screening and ER α protokaryon part expressing protein theory point
Son amount one group of fraction that size is identical, band is single, using the above-mentioned 0.01M pH7.2 containing 2% imidazoles under the conditions of 4 DEG C
PBS dialyzed overnight, that is, complete the purification of ER α recombiant protein.
4. human estrogen acceptor alpha hypotype monoclonal antibody is it is characterised in that female by people as claimed in claim 1
Hormone receptor alpha hypotype monoclonal antibody hybridoma cell strain secretion is obtained.
5. human estrogen acceptor alpha hypotype monoclonal antibody as claimed in claim 4 is it is characterised in that by following
Method is prepared：Human estrogen acceptor alpha hypotype monoclonal antibody hybridoma cell strain is carried out Cell culture invitro
Amplification culture in bottle, implants mouse peritoneal afterwards, collects ascites, separates, purification obtains human estrogen acceptor alpha hypotype list
Clonal antibody；The concrete grammar of wherein purification is：By the ascites to be purified after separation through overbalance completely Protein G
In chromatographic column, the citrate buffer solution using pH3.0 carries out eluting, collects and flow out phase at peak value, and adjustment pH value is extremely
Between 7.0～7.6, the PBS through 0.01M pH 7.2 is collected and is obtained described antibody.
6. human estrogen acceptor alpha hypotype monoclonal antibody as claimed in claim 4 is used for detecting that people is female sharp in preparation
Apply in the immune detection instrument of plain receptor alpha subtype albumen.
7. as claimed in claim 6 application it is characterised in that described immune detection instrument be reagent, test kit,
Chip, reagent paper or magnetic particle.
8. human estrogen acceptor alpha hypotype monoclonal antibody as claimed in claim 4 is thin for tagged tissue in preparation
Application in the reagent of born of the same parents, test kit or chip.
9. application as claimed in claim 8 is it is characterised in that described histiocyte is breast carcinoma, pulmonary carcinoma, stomach
The histiocyte of cancer, colon cancer, cervical cancer, hysteromyoma, bladder cancer or ovarian cancer.
10. a kind of human estrogen acceptor alpha hypotype monoclonal antibody hybridoma cell strain as claimed in claim 1
Preparation method is it is characterised in that include following operating procedure successively：The structure of ER α expression of recombinant proteins plasmid,
The expression and purification of ER α recombiant protein, the Mouse spleen cells of ER α recombiant protein immunity and myeloma cell fusion,
Cell screening and clone；Wherein cell screening and the concrete grammar of clone are：Cell after culture fusion, preliminary sieve
Select the cell assuming positive reaction in supernatant with ER α antigen, take the supernatant of the cell that preliminary screening goes out, profit
With collecting the ER α assaypositive tissue wax stone obtaining, the supernatant of the cell that preliminary screening is gone out carries out SABC checking,
Screening obtains the cell strain being consistent with the actual clinical testing result of ER α assaypositive tissue wax stone, then to this cell strain
Carry out sub-clone according to limiting dilution assay, obtain final product described human estrogen acceptor alpha hypotype monoclonal antibody hybridoma thin
Born of the same parents' strain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610484775.XA CN106399258A (en) | 2016-06-24 | 2016-06-24 | Human estrogen receptor [alpha] subtype monoclonal antibody hybridoma cell line, monoclonal antibody, preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610484775.XA CN106399258A (en) | 2016-06-24 | 2016-06-24 | Human estrogen receptor [alpha] subtype monoclonal antibody hybridoma cell line, monoclonal antibody, preparation method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106399258A true CN106399258A (en) | 2017-02-15 |
Family
ID=58006794
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610484775.XA Pending CN106399258A (en) | 2016-06-24 | 2016-06-24 | Human estrogen receptor [alpha] subtype monoclonal antibody hybridoma cell line, monoclonal antibody, preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106399258A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106970227A (en) * | 2017-05-22 | 2017-07-21 | 广州华弘生物科技有限公司 | A kind of quick detection kit and its detection method for being used to detect ERs |
| CN114874326A (en) * | 2022-06-21 | 2022-08-09 | 图凌(杭州)生物医药有限公司 | Monoclonal antibody for detecting estrogen receptor alpha, and preparation method and application thereof |
| CN117603357A (en) * | 2023-11-29 | 2024-02-27 | 武汉爱博泰克生物科技有限公司 | Rabbit monoclonal antibody for human progestogen receptor and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1183560A (en) * | 1996-11-26 | 1998-06-03 | 北京市肿瘤防治研究所 | Preparation and use of anti-human estrogen acceptor monoclonal antibody and anti-human progestogen acceptor monoclonal antibody |
| CN1506684A (en) * | 1996-11-26 | 2004-06-23 | 北京市肿瘤防治研究所 | Prepn and application of human estrin receptor-resisting monoclonal antibody and human progestogen-resisting monoclonal antibody |
-
2016
- 2016-06-24 CN CN201610484775.XA patent/CN106399258A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1183560A (en) * | 1996-11-26 | 1998-06-03 | 北京市肿瘤防治研究所 | Preparation and use of anti-human estrogen acceptor monoclonal antibody and anti-human progestogen acceptor monoclonal antibody |
| CN1506684A (en) * | 1996-11-26 | 2004-06-23 | 北京市肿瘤防治研究所 | Prepn and application of human estrin receptor-resisting monoclonal antibody and human progestogen-resisting monoclonal antibody |
Non-Patent Citations (6)
| Title |
|---|
| GREENE GL ET AL: "Monoclonal antibodies to human estrogen receptor", 《PROC NATL ACAD SCI》 * |
| KAIGHIN VA ET AL: "Homo sapiens estrogen nuclear receptor alpha (ESR1) mRNA, complete cds", 《GENBANK登录号：JF810888.1》 * |
| 刘玲玲 等: "雌激素受体α型抗体的制备及临床应用研究", 《生物技术通讯》 * |
| 王振明 等: "抗hER合成肽单克隆抗体的制备与鉴定", 《免疫学杂志》 * |
| 罗敏 等: "抗人雌激素受体单抗的制备及鉴定", 《中华内分泌代谢杂志》 * |
| 陈伟 等: "抗人hER单克隆抗体的制备及其应用", 《武汉大学学报（医学版）》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106970227A (en) * | 2017-05-22 | 2017-07-21 | 广州华弘生物科技有限公司 | A kind of quick detection kit and its detection method for being used to detect ERs |
| CN106970227B (en) * | 2017-05-22 | 2019-02-15 | 上海拜谱生物科技有限公司 | It is a kind of for detecting the quick detection kit and its detection method of estrogen receptor |
| CN114874326A (en) * | 2022-06-21 | 2022-08-09 | 图凌(杭州)生物医药有限公司 | Monoclonal antibody for detecting estrogen receptor alpha, and preparation method and application thereof |
| CN114874326B (en) * | 2022-06-21 | 2023-01-17 | 图凌(杭州)生物医药有限公司 | Monoclonal antibody for detecting estrogen receptor alpha, and preparation method and application thereof |
| CN117603357A (en) * | 2023-11-29 | 2024-02-27 | 武汉爱博泰克生物科技有限公司 | Rabbit monoclonal antibody for human progestogen receptor and application thereof |
| CN117603357B (en) * | 2023-11-29 | 2024-09-03 | 武汉爱博泰克生物科技有限公司 | Rabbit monoclonal antibody for human progestogen receptor and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107022030B (en) | Monoclonal antibody for detecting alpha-fetoprotein, kit and application | |
| CN108795880B (en) | Mouse hybridoma cell strain for generating human thymidine kinase 1(TK1) specific monoclonal antibody and application thereof | |
| CN110684105B (en) | anti-HSP 90 monoclonal antibody and kit | |
| CN106978400A (en) | Anti- PD L1 protein monoclonal antibodies and application thereof | |
| CN106399258A (en) | Human estrogen receptor [alpha] subtype monoclonal antibody hybridoma cell line, monoclonal antibody, preparation method and application | |
| CN104119440B (en) | Monoclonal antibody, hybridoma cell strain preparation for bladder chalone C and application thereof | |
| CN107987164A (en) | 36 antigen polypeptides of estrogen receptor ER- α and its monoclonal antibody | |
| CN113583132B (en) | anti-PR protein monoclonal antibody and preparation method and application thereof | |
| KR102189893B1 (en) | Antibody specifically binding a bPAG1 and use thereof | |
| CN105131114A (en) | P16 protein resistant monoclonal antibody hybridoma cell, p16 protein resistant monoclonal antibody generated by same and application thereof | |
| CN102924594B (en) | Anti-tumor-protein-P63 monoclonal antibody and purpose thereof | |
| CN107916254B (en) | Homer1 monoclonal antibody and application thereof | |
| CN114891103B (en) | Calprotectin monoclonal antibody and kit | |
| CN115044560B (en) | Hybridoma cell strain, anti-human ERG protein monoclonal antibody and application thereof | |
| CN104830805B (en) | Anti-human Clonorchiasis Sinensis monoclonal antibody hybridoma and its monoclonal antibody and application | |
| CN103102414B (en) | HER2-resistant protein monoclonal antibody and application thereof | |
| CN108623683A (en) | The monoclonal antibody and its cell strain, preparation method and application of anti-Pax-5 albumen | |
| CN112540176B (en) | Kit, method and computer-readable storage medium for diagnosing diseases associated with FAP expression abnormality | |
| CN106978401A (en) | Anti- ROS1 protein monoclonal antibodies and application thereof | |
| CN106977605A (en) | Anti- CD19 protein monoclonal antibodies and application thereof | |
| CN113234158A (en) | anti-TIM 3 protein monoclonal antibody, cell strain thereof, preparation method and application | |
| CN102181400A (en) | Hybridoma cell strain and anti-HCCLM-6 (Human Hepatoma Cell Line) cell secretory protein monoclonal antibody | |
| CN105238763A (en) | Anti-PR protein monoclonal antibody hybridomas cell, anti- PR monoclonal antibody generated by same and application | |
| CN110540591A (en) | anti-Glycoprotein A33 (glycoprotin A33) monoclonal antibody and immunodetection application thereof | |
| CN108997502A (en) | The anti-human ROS1 protein monoclonal antibody preparation of mouse and its immunohistochemistry purposes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170215 |