CN106381309A - Expression vector of human recombinant interleukin-12 - Google Patents
Expression vector of human recombinant interleukin-12 Download PDFInfo
- Publication number
- CN106381309A CN106381309A CN201610781919.8A CN201610781919A CN106381309A CN 106381309 A CN106381309 A CN 106381309A CN 201610781919 A CN201610781919 A CN 201610781919A CN 106381309 A CN106381309 A CN 106381309A
- Authority
- CN
- China
- Prior art keywords
- subunit
- expression
- expression vector
- human interleukin
- interleukin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/54—Interleukins [IL]
- C07K14/5434—IL-12
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
Abstract
The invention belongs to field of biotechnology and specifically relates to an expression vector of human recombinant interleukin-12. The expression vector of human recombinant interleukin-12 contains nucleotide coding sequences of P35 subunit and P40 subunit of artificially-designed human interleukin-12. The P35 subunit and P40 subunit are respectively controlled by a CMV promoter on respective SV40 enhancer element. There is an Interon element with expression enhancing effect between the coding sequence of the P35 subunit and the promoter. The expression vector of human recombinant interleukin-12 has advantages of high expression efficiency, high activity and continuous expression time, and effectively promotes promotion and application of human recombinant interleukin-12.
Description
Technical field
The invention belongs to biological technical field is and in particular to a kind of expression vector of recombinant human interleukin 12.
Background technology
Interleukin (interleukin, IL) is to be produced and acted on by various kinds of cell one class cell of various kinds of cell
The factor.Due to being initially to be produced by leukocyte to play a role between leukocyte again, so thus gaining the name, now still continue to use always.?
Just refer to produce, by leukocyte, the cytokine again playing regulatory role between leukocyte.Refer to now molecule structure and biology
Learn function substantially clear and definite, there is the cytokine of important regulative and Uniform Name, it and the blood cell development factor belong to together
Cytokine.Both are mutually coordinated, interact, jointly complete hemopoietic and immunoloregulation function.Interleukin is in transmission letter
Breath, activation and regulation immunocyte, mediate T, B cell activation, propagation and break up and play an important role in inflammatory reaction.
Interleukin 12 (hereinafter referred to as IL-12), is produced by antigen presenting cell and B cell, is a kind of heterodimeric
The Pro-inflammatory mediator of body form, and it is secreted into extracellular in this form.IL-12 can induce IFN-γ to produce, in vivo
In immunne response, particularly in antibacterial or parasitic infection, it is also that IFN-γ generation institute is required.IL-12 be by p35 and
The heterodimer of two chain compositions of p40 (IL-12 β), two subunits pass through disulfide bond together, and this structure is in mesh
In the IL having been found that, institute is rare.Under normal circumstances, the amount of p40, far beyond p70, has observed that p40 homodimer in Mus
Produce, be that p40 homodimer does not have biologic activity by the cell secretion transfecting, but it can combine with IL-12R β, with
P70 unexpectedly striving property contention IL-12 receptor (IL-12R) and its biological action of antagonism.Individually p35 does not have biologic activity, but
But it is the rate-limiting factor of synthesis p70.
In recent years, people have new understanding, IL-12 to the biological pathway of IL-12 and the application prospect of clinical treatment
Research receive the concern of more and more people.Chen Weifeng (Progress in Biochemistry and Biophysics 1998；25：254-258), Liu
Manganese etc. is expressed by the way of cotransfection in Chinese hamster ovary celI, bright (the Hunan Medical University's journal 2003 in sheep east；28：338-342) profit
Control double subunits of expression IL-12 with double-promoter, and Chen Shishu (Chinese biological chemistry and molecular biosciences journal, 1999；15：
48-53) then adopt IRES to connect the double subunit of mice IL-12, express in COS cell.But, above-mentioned various expression are due to transfection
The inhomogeneity of efficiency, integration efficiency etc., lead to expression efficiency to differ, double subunit expression level difference, double subunit mutually not
Join, greatly limit the application of IL-12.
Chinese patent CN1244696C discloses a kind of high-efficiency expression method of interleukin 12, described high efficient expression
Method is respectively the P40 subunit coding region cDNA of IL-12 to be inserted pcD-NA3 carrier for expression of eukaryon, and the P35 of IL-12 is sub-
Unit encoding area cDNA inserts pcEE14 eucaryon efficient expression vector, builds two kinds of eukaryotic cell recombiant plasmid, cotransfection respectively
Host cell, screening, amplification, obtain final product.The method utilizes the unbalanced characteristic of the natural expression of IL-12P40 and P35, using two kinds
The different carrier of expression efficiency, so that the expression of two chains is tried one's best balance.But, the people source recombinant interleukin 12 of the method
Expression efficiency low, hinder the conversion to industry for the rhIL-12 scientific achievement.
Content of the invention
The deficiency existing for the expression vector solving recombinant interleukin 12 in prior art, the purpose of the present invention exists
In a kind of expression vector of recombinant human interleukin 12 of offer.The expression of the recombinant human interleukin 12 that the present invention provides carries
Body has expression efficiency height, the advantage that activity is high and expression time is lasting.
The invention provides a kind of expression vector of recombinant human interleukin 12, described expression vector comprises engineer
The P35 subunit of human interleukin 12 and P40 subunit nucleotide coding sequence；Described P35 subunit and P40 subunit respectively by
The CMV promoter respectively coming with SV40 enhancer element controls；There is expression between the coded sequence of described P35 subunit and promoter
The Intron element of potentiation.
Further, the nucleotide coding sequence of the P35 subunit of the human interleukin 12 of described engineer：
atgtggccaccaggatcagcatcacaaccaccaccatcaccagcagcagcaacaggactgcatccagcagcaagacc
agtgtcactgcagtgtagactgagcatgtgtccagcaagatcactgttgcttgtcgcaacactcgtgctgcttgatc
atctgtctcttgcaagaaatcttccagtcgcaacaccagatccaggaatgttcccatgtctgcatcacagtcagaat
ctgttgagagcagtgagcaacatgttgcagaaagcaagacagacacttgagttctatccatgcacatctgaagagat
tgatcatgaagacatcaccaaagacaagacatctacagttgaagcatgtctgccactcgaactgaccaagaacgaga
gttgtctgaacagcagagagacatcattcatcacaaacggatcatgtcttgcaagtagaaagacatcattcatgatg
gcattgtgtctgagtagcatctacgaagatctgaagatgtatcaggtcgagttcaagacaatgaatgcaaagctgtt
gatggatccaaagagacagatcttccttgaccagaacatgcttgcagtgattgatgaactgatgcaagcactgaact
tcaacagtgagacagtgccacagaagagcagtcttgaagaaccagacttctacaagacaaagatcaagctgtgcatt
ctgttgcatgcattcagaatcagagcagtgacaatcgacagagtgatgagctatctgaatgcatcttaa
(SEQIDNO.1).
Further, the nucleotide coding sequence of the P40 subunit of the human interleukin 12 of described engineer：
atgtgtcatcagcaacttgtgatcagctggttcagtcttgtgtttcttgcaagtccacttgttgcaatctgggaact
gaagaaggatgtgtatgtcgttgaacttgactggtatccagatgcaccaggtgagatggttgtgctgacatgtgaca
caccagaagaagatggtatcacatggacacttgatcagagcagtgaagtgcttggtagtggtaagacactgacaatt
caagtgaaagagtttggtgatgcaggacagtacacatgtcacaaaggtggtgaagtgctgagtcatagcttgttgtt
gttgcacaagaaagaagatggaatctggagtacagacatcctgaaagatcagaaagagccaaagaacaagacattcc
tgagatgtgaagcaaagaactacagtggtagattcacatgttggtggttgacaacaatcagtacagacttgacattc
agtgtgaagagcagtagaggtagtagtgatccacaaggtgtgacatgtggtgcagcaacattgagtgcagagagagt
tagaggtgacaacaaagagtacgagtacagtgttgagtgtcaagaagacagtgcatgtccagcagcagaagagagtc
ttccaatcgaagtgatggttgatgcagtgcacaagttgaagtacgagaactacacaagcagtttcttcattagagac
atcatcaaaccagatccaccaaagaatctgcagttgaaaccattgaagaacagcagacaagttgaagttagttggga
gtatccagacacatggagtacaccacatagttacttcagtctgacattctgtgtgcaagttcaaggaaagagtaaga
gagagaagaaagacagagtgttcacagacaagacaagtgcaacagtgatctgcagaaagaatgcaagtatcagtgtg
agagcacaagacagatactacagcagtagttggagtgaatgggcaagtgtgccatgtagttaa(SEQIDNO.2).
In addition, the nucleotide coding sequence of the P35 subunit of the interleukin 12 of described engineer and P40 subunit
Can compare for stating corresponding nucleotide coding sequence phase above, homology is not less than the P35 of 95% human interleukin 12
Engineer's nucleotide coding sequence of subunit and P40 subunit.
Further, the structure of the expression unit of described carrier is：SV40 enhancer-CMV promoter-P35 subunit-SV40
Enhancer-CMV promoter-P40 subunit.
Further, the expression unit structure of described carrier is following nucleotide sequence：SV40 Enhancer-pCMV-
Intron-p35-SV40Enhancer-pCMV-p35.
In addition, present invention also offers a kind of high efficient expression people's IL-12 eucaryotic cell strain, it is thin in CHO mammal
Prepare in born of the same parents system, described cell contains described expression vector, or described nucleotide sequence transfection.
The present invention obtain high efficient expression people's IL-12 eucaryotic cell strain specific practice be：The recombined human that the present invention is provided
The expression vector transformed host cell of interleukin 12, expression obtains the heterodimer of two chains of p35 and p40 composition, and two
Individual subunit passes through disulfide bond together, and this heterodimer has biologic activity；And obtain a kind of high efficient expression people IL-
12 eucaryotic cell strains.
Compared with prior art, the expression vector of the recombinant human interleukin 12 that the present invention provides has the advantage that：
The present invention adopts the P35 subunit of interleukin 12 of particular design and the nucleotide coding sequence of P40 subunit, prepares
The expression vector of recombinant human interleukin 12 has expression efficiency height, the advantage that activity is high and expression time is lasting, effectively
Promote the promotion and application of recombinant human interleukin 12.
Specific embodiment
Below by way of the description of specific embodiment, the invention will be further described, but this is not the limit to the present invention
System, according to the basic thought of the present invention, various modifications may be made or improves for those skilled in the art, but without departing from this
The basic thought of invention, all within the scope of the present invention.The group of the present invention is divided into the commercial components of routine, and is all food
Level component, has no toxic side effect to human body.
Embodiment 1, nucleotide coding sequence
The P35 subunit of table 1 human interleukin 12 and the nucleotide coding sequence of P40 subunit
Embodiment 2, the structure of the expression vector of recombinant human interleukin 12
Described expression vector comprises the P35 subunit of the human interleukin 12 of embodiment 1 engineer and the core of P40 subunit
Thuja acid coded sequence；Described P35 subunit and P40 subunit are controlled by the CMV promoter respectively coming with SV40 enhancer element respectively；
There is the Intron element of expression potentiation between the coded sequence of described P35 subunit and promoter；
The structure of the expression unit of described carrier is：SV40 enhancer-CMV promoter-P35 subunit-SV40 enhancer-
CMV promoter-P40 subunit；
The expression unit structure of described carrier is following nucleotide sequence：SV40Enhancer-pCMV-Intron-p35-
SV40 Enhancer-pCMV-p35；
Routinely the method for vector construction builds the expression vector of above-mentioned recombinant human interleukin 12.
Embodiment 3, the transfection of Chinese hamster ovary celI and screening
Extract plasmid transfection Chinese hamster ovary celI, Chinese hamster ovary celI with 1640 complete mediums (containing 10% calf serum), 37 DEG C, 5%
CO2, cultivates to cell about 90% degree of converging in 24 orifice plates, the Lipofection2000 using Invitrogen company is carried out carefully
Dysuria with lower abdominal colic dye (is illustrated to operate by test kit), with 1 after transfection 24h：10 digestion diluting cells, plus G418 screening.After screening about 3 weeks,
Positive colony gradually forms, and removes G418 and carries out monoclonal operation, is transferred in 24 orifice plates, carries out after monoclonal gradually expands
Pressurization screening.After cell amplification, collect cultured cells supernatant, carry out protein content and the biologic activity detection of rhIL-12.
Select upgrowth situation best, express most stable of clone, obtain high efficient expression people's IL-12 eucaryotic cell strain.
Embodiment 4, the purification experiment of IL-12
Embodiment 3 is obtained high efficient expression people's IL-12 eucaryotic cell strain and carries out cell culture, by the cell containing IL-12
Culture supernatant carries out ultrafiltration or dilution, cation exchange column on adjustment ionic intension, with buffer (20mMPBS,
1MNaCI, pH6.0) carry out stepwise elution, Fraction collection separation component；(NH by the 4M of component containing IL-124)2SO4(pH8.0) sink
Form sediment, go precipitation to take drainage column on supernatant, with buffer (20mMTris-Cl, 2M (NH4)2SO4, pH8.5) and carry out stepwise elution, point
Step collects separation component；IL-12 component will be contained and suitably dilute upper anion-exchange column after adjustment ionic strength, use buffer
(20mMTris-Cl, 1MNaCl, pH8.5) carries out stepwise elution, Fraction collection separation component；Molecular sieve in IL-12 component will be contained
Chromatographic column；Carry out eluting with buffer (120mMNaCl, 20mMPB, pH7.0), Fraction collection separation component, through SDS-PAGE,
The methods such as HPLC detection purity reaches more than 99%.
Embodiment 5, the activity assays of rhIL-12
RhIL-12 biological activity assay induces method using PBMCIFN- γ
(1) the NIBSC standard substance (dilution of the rhIL-12 of WHO international standard substance and embodiment 4 purification：Standard substance and through standard
The purification rhIL-12 of determination amount is diluted to following concentration with RMPI1640 basic culture solution：8ng/mL、4ng/mL、2ng/ml、
1ng/mL, 0.5ng/mL, 0.25ng/mL, 0.125ng/mL, 0.0625ng/mL are stand-by.
(2) separating peripheral blood mononuclear cells (PBMC)：Venous blood samples 5mL, anticoagulant heparin, Hank liquid equivalent mixes,
Take mlFicoll lymphocyte separation medium to be placed in 15mL graduated centrifuge tube, the blood of dilution is slowly superimposed on along tube wall and separates
On liquid, form clearly interface, put in horizontal centrifuge, 2000r/min is centrifuged 20min, directly suctions out single core with dropper thin
Born of the same parents are placed in another graduated centrifuge tube, add the Hank liquid of more than 4 times amount, fully mix, 1000r/min is centrifuged 10min, inclines
Remove supernatant, then washed twice with Hank liquid, prepare cell with the RMPI1640 basic culture solution containing 10% inactivated fetal bovine serum and hang
Liquid, counts cell, expects blue detection cell viability with platform it is desirable to cell viability simultaneously>More than 95%, every hole adds 100uL cell
Suspension and corresponding diluted concentration standard substance and purification rhIL-12 to 96 well culture plate, blank control group adds the training of RMPI1640 basis
Nutrient solution, positive controls add anti-human CD3, final concentration (0.2ug/mL), and each dilution factor does two multiple holes.At 37 DEG C, 5%CO2
Under conditions of cultivate 48 hours
(3) collect cell culture supernatant every hole 50ul, after centrifugal treating, ELISA is (by BD company kit specification behaviour
Make) measure IFN-γ content.
(4) result calculates：Measure each hole absorbance with MULTISKANMK3 microplate reader (Thermo company) 450nm,
Ascentsoftwareversion2.6 software curve quantitative Analysis IFN-γ content.With standard substance each dilution factor stimulated in vitro
PBMCsIFN- γ yield dilution factor corresponding with purification rhIL-12 IFN-γ yield contrasts.(t checks：P>0.05, two samples
Between there was no significant difference).Or with IFN-γ content, sample concentration is mapped, (i.e. IFN-γ contains the ED50 of each laboratory sample of calculating
Measure the sample concentration during half for Cmax), by formula：Testing sample potency=standard substance potency × (standard substance
The ED50 of ED50/ laboratory sample).It is 7.2 × more than 106IU/mg that the ratio of purified rhIL-12 is lived.
Claims (6)
1. a kind of expression vector of recombinant human interleukin 12 it is characterised in that
Described expression vector comprises the P35 subunit of the human interleukin 12 of engineer and the nucleotide coding sequence of P40 subunit
Row；Described P35 subunit and P40 subunit are controlled by the CMV promoter respectively coming with SV40 enhancer element respectively；Described P35 is sub-
There is the Intron element of expression potentiation between the coded sequence of base and promoter.
2. the expression vector of recombinant human interleukin 12 as claimed in claim 1 is it is characterised in that described engineer
The nucleotide coding sequence of the P35 subunit of human interleukin 12：
atgtggccaccaggatcagcatcacaaccaccaccatcaccagcagcagcaacaggactgcatccagcagcaa
gaccagtgtcactgcagtgtagactgagcatgtgtccagcaagatcactgttgcttgtcgcaacactcgtgctgctt
gatcatctgtctcttgcaagaaatcttccagtcgcaacaccagatccaggaatgttcccatgtctgcatcacagtca
gaatctgttgagagcagtgagcaacatgttgcagaaagcaagacagacacttgagttctatccatgcacatctgaag
agattgatcatgaagacatcaccaaagacaagacatctacagttgaagcatgtctgccactcgaactgaccaagaac
gagagttgtctgaacagcagagagacatcattcatcacaaacggatcatgtcttgcaagtagaaagacatcattcat
gatggcattgtgtctgagtagcatctacgaagatctgaagatgtatcaggtcgagttcaagacaatgaatgcaaagc
tgttgatggatccaaagagacagatcttccttgaccagaacatgcttgcagtgattgatgaactgatgcaagcactg
aacttcaacagtgagacagtgccacagaagagcagtcttgaagaaccagacttctacaagacaaagatcaagctgtg
cattctgttgcatgcattcagaatcagagcagtgacaatcgacagagtgatgagctatctgaatgcatcttaa.
3. the expression vector of recombinant human interleukin 12 as claimed in claim 1 is it is characterised in that described engineer
The nucleotide coding sequence of the P40 subunit of human interleukin 12：
atgtgtcatcagcaacttgtgatcagctggttcagtcttgtgtttcttgcaagtccacttgttgcaatctggg
aactgaagaaggatgtgtatgtcgttgaacttgactggtatccagatgcaccaggtgagatggttgtgctgacatgt
gacacaccagaagaagatggtatcacatggacacttgatcagagcagtgaagtgcttggtagtggtaagacactgac
aattcaagtgaaagagtttggtgatgcaggacagtacacatgtcacaaaggtggtgaagtgctgagtcatagcttgt
tgttgttgcacaagaaagaagatggaatctggagtacagacatcctgaaagatcagaaagagccaaagaacaagaca
ttcctgagatgtgaagcaaagaactacagtggtagattcacatgttggtggttgacaacaatcagtacagacttgac
attcagtgtgaagagcagtagaggtagtagtgatccacaaggtgtgacatgtggtgcagcaacattgagtgcagaga
gagttagaggtgacaacaaagagtacgagtacagtgttgagtgtcaagaagacagtgcatgtccagcagcagaagag
agtcttccaatcgaagtgatggttgatgcagtgcacaagttgaagtacgagaactacacaagcagtttcttcattag
agacatcatcaaaccagatccaccaaagaatctgcagttgaaaccattgaagaacagcagacaagttgaagttagtt
gggagtatccagacacatggagtacaccacatagttacttcagtctgacattctgtgtgcaagttcaaggaaagagt
aagagagagaagaaagacagagtgttcacagacaagacaagtgcaacagtgatctgcagaaagaatgcaagtatcag
tgtgagagcacaagacagatactacagcagtagttggagtgaatgggcaagtgtgccatgtagttaa.
4. the expression vector of recombinant human interleukin 12 as claimed in claim 1 is it is characterised in that the expression of described carrier
The structure of unit is：SV40 enhancer-CMV promoter-P35 subunit-SV40 enhancer-CMV promoter-P40 subunit.
5. the expression vector of recombinant human interleukin 12 as claimed in claim 1 is it is characterised in that the expression of described carrier
Cellular construction is following nucleotide sequence：SV40Enhancer-pCMV-Intron-p35-SV40Enhancer-pCMV-p35.
6. a kind of high efficient expression people's IL-12 eucaryotic cell strain is it is characterised in that be to prepare in CHO mammal cell line
Come, described cell contains the expression vector described in claim 1, or described cell has used the nucleic acid described in claim 5
Sequence transfects.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610781919.8A CN106381309A (en) | 2016-08-31 | 2016-08-31 | Expression vector of human recombinant interleukin-12 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610781919.8A CN106381309A (en) | 2016-08-31 | 2016-08-31 | Expression vector of human recombinant interleukin-12 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106381309A true CN106381309A (en) | 2017-02-08 |
Family
ID=57939444
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610781919.8A Pending CN106381309A (en) | 2016-08-31 | 2016-08-31 | Expression vector of human recombinant interleukin-12 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106381309A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1318644A (en) * | 2000-04-18 | 2001-10-24 | 西安医科大学 | Construction process of recombined human single-chain interleukin-12 |
| CN101200730A (en) * | 2007-07-02 | 2008-06-18 | 广州市恺泰生物科技有限公司 | IL-12 expression carrier as well as eukaryotic cell strain expressed thereby and uses thereof |
-
2016
- 2016-08-31 CN CN201610781919.8A patent/CN106381309A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1318644A (en) * | 2000-04-18 | 2001-10-24 | 西安医科大学 | Construction process of recombined human single-chain interleukin-12 |
| CN101200730A (en) * | 2007-07-02 | 2008-06-18 | 广州市恺泰生物科技有限公司 | IL-12 expression carrier as well as eukaryotic cell strain expressed thereby and uses thereof |
Non-Patent Citations (1)
| Title |
|---|
| 羊东晔等: "人白细胞介素12双亚基共表达载体的构建及表达", 《中国免疫学杂志》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ujiie et al. | Messenger RNA expression and synthesis of endothelin-1 along rat nephron segments. | |
| CN104508124B (en) | Mesodermal lineage progenitor cells | |
| SA94150015A (en) | lymphokine production and purification | |
| Luporini et al. | Chemical signaling in ciliates | |
| CN102659937B (en) | Preparation method and application of recombinant protein and monoclonal antibody thereof | |
| Kol et al. | Th17 pathway as a target for multipotent stromal cell therapy in dogs: implications for translational research | |
| CN105949316A (en) | Anti-EGFRvIII chimeric antigen receptor, encoding gene, recombinant expression vector, construction method of recombinant expression vector, and application | |
| CN101200730B (en) | IL-12 expression carrier as well as eukaryotic cell strain expressed thereby and uses thereof | |
| CN103710367B (en) | A kind of recombined human kallikrein 1 and encoding gene thereof and preparation method | |
| Phoksawat et al. | IL-17 and IFN-γ productions by CD4+ T cells and T cell subsets expressing NKG2D associated with the number of risk factors for cardiovascular diseases | |
| CN101033254A (en) | Method of purifying and combining human interleukins 12 | |
| CN107760650A (en) | A kind of Chinese hamster ovary celI of transformation and application thereof | |
| CN101245106B (en) | Anti-VRGF acceptor monoclone antibody, preparation method and application thereof | |
| CN107505468B (en) | It is a kind of for detecting the detection reagent and its application of Human interleukin-10 | |
| Jyonouchi et al. | Humoral factors in very young NZB mice that enhance the maturation of normal B cell precursors. Partial purification and characterization. | |
| CN106381309A (en) | Expression vector of human recombinant interleukin-12 | |
| CN106086073A (en) | A kind of expression of cytokine IL 7 | |
| Koch et al. | Interleukin 4 (IL) 4 up‐regulates gene and surface IL 1 receptor type I in murine T helper type 2 cells | |
| CN110028575A (en) | A kind of preparation method of micromolecular collagen | |
| CN114395041A (en) | Method for preparing anti-IL-12 and/or IL-23 monoclonal antibody | |
| CN108463730A (en) | Including the composition of recombinant human thyroid-stimulating hormone and the method for producing recombinant human thyroid-stimulating hormone | |
| CN1467292A (en) | Highly effective expressing method of interleukin-12 | |
| CN106636123B (en) | Method for constructing rhIL-12 expression system in CHO cell | |
| Gala | Prolactin production by the human anterior pituitary cultured in vitro | |
| CN109609539A (en) | A method of preparing ELABELA polypeptide from recombinant yeast pichia pastoris |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170208 |