CN106370868B - Spr sensor of detection Microcystin based on aptamer signal amplification strategy and its preparation method and application - Google Patents
Spr sensor of detection Microcystin based on aptamer signal amplification strategy and its preparation method and application Download PDFInfo
- Publication number
- CN106370868B CN106370868B CN201610846741.0A CN201610846741A CN106370868B CN 106370868 B CN106370868 B CN 106370868B CN 201610846741 A CN201610846741 A CN 201610846741A CN 106370868 B CN106370868 B CN 106370868B
- Authority
- CN
- China
- Prior art keywords
- dna probe
- noble metal
- glass
- chip
- microcystin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/551—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being inorganic
- G01N33/553—Metal or metal coated
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/405—Assays involving biological materials from specific organisms or of a specific nature from algae
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Cell Biology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Pathology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Inorganic Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
Abstract
The invention belongs to toxin detection technology field, discloses spr sensor of detection Microcystin based on aptamer signal amplification strategy and its preparation method and application.The spr sensor includes glass-chip, Microcystin aptamers, DNA probe 1, DNA probe 2 and noble metal nanometer material, and the detection of Microcystin can be carried out by determining spr signal change.Spr sensor preparation method of the present invention is simple, and detection speed is fast, selectivity is high, stability is good, the scope of application is wide, simple to operate, is easy to build field monitoring Portable detection instrument, and cost is far below large-scale analysis and detecting instrument.
Description
Technical field
The invention belongs to toxin detection technology field, and in particular to the detection based on aptamer signal amplification strategy is micro-
Surface plasma (SPR) sensor of capsule Algae toxins and its preparation method and application.
Background technology
Microcystin (MCs) is a kind of ring-type heptapeptide class hepatotoxin of harmful blue-green alga bloom release, has strong cause
Cancer acts on, and is the important environmental factor of the diseases such as induced hepatocellular carcinoma, enterogastritis.In view of toxicity and its harm of Microcystin, generation
Microcysin LR (MC-LR) has been classified as the noxious pollutant that control is needed in drinking water by boundary's health organization (WHO).Blue-green alga bloom
The Microcystin secondary pollution of initiation and its harm to health have attracted attention, it has also become the whole world is common
The environmental science problem faced.
Mainly there are Instrumental Analysis and sensor detection two currently for the analysis and detection technology of the Microcystin in water body
Major class, the former includes high resolution gas chromatography method (HPGC), high performance liquid chromatography (HPLC) and liquid chromatograph mass spectrography (LC-
MS) the methods of, have the advantages that detection sensitivity is high, the good, high specificity of selectivity, but before the expensive, sample of instrument detection
Complex disposal process, high is required to experiment condition and the degree of specialization of operating technology, detection time is longer, testing cost is high,
And equipment instrument is big, it is not easy to field monitoring and realizes the monitoring of sudden pollution accident, there is certain application limitation.
Sensor detecting method includes the methods of ELISA, radioimmunoassays, boiled shrimps with shell in salt water method and bioprobe, sensor detection
The pretreatment process of method relatively simplifies, and detection time is short, it is possible to achieve quick detection, and it is special to experiment condition and operation
Industry degree is less demanding, suitable for the field quick detection of batch samples.But used enzyme is expensive, volatile
Live, in addition current the problems such as this kind of sensor detecting method generally existing sensitivity is low, stability is poor, probe is expensive, because
And limit a wide range of of the technology and promote the use of.In recent years, molecular imprinting technology has specific recognition and knot to object
The ability of conjunction, its molecular engram colorimetric sensor built can realize quick detection Microcystin, but molecular engram film
Preparation process need to use the organic reagent for having pollution to environment.Existing for the above analysis method and technology itself not
Foot, seriously constrain understanding in time dynamic to Microcystins in Water pollution.Therefore, for China's water body low concentration, height
The pollution situation that toxicity, a variety of organic and inorganic pollution coexist, developing quick, easy, highly sensitive, high specificity and scene makes
Detection Microcystin sensor, for monitoring the implementation of Microcystins in Water pollution control measures, ensureing and drink water
Safety, alleviation water resource anxiety are significant.
The content of the invention
In view of this, an object of the present invention is to provide the detection micro-capsule based on aptamer signal amplification strategy
The spr sensor of Algae toxins；The second object of the present invention is to provide the method for preparing the spr sensor；The mesh of the present invention
Three in providing application of the spr sensor in Microcystin is detected；The fourth object of the present invention is to provide utilization
The method of described spr sensor detection capsule Algae toxins.
To achieve the above object, the present invention provides following technical scheme：
1st, the spr sensor of the detection Microcystin based on aptamer signal amplification strategy, the sensor bag
Include glass-chip, Microcystin aptamers, DNA probe 1, DNA probe 2 and noble metal nanometer material；The glass-chip
One layer of noble metal nano layer of area load, the DNA probe 1 pass through 5 ' terminal modified sulfydryls and the glass-chip area load
Noble metal nano layer pass through Covalent bonding together；The DNA probe 2 passes through 3 ' terminal modified sulfydryls and noble metal nanometer material knot
Close；5 ' ends of the DNA probe 1 and the complementary combination in 3 ' ends of the DNA probe 2；Described Microcystin aptamers one end with
3 ' ends of the DNA probe 1 are complementary to be combined, and the other end holds complementary combine with the 5 ' of the DNA probe 2.
Further, the DNA probe 1 is single stranded DNA of the base sequence as shown in SEQ ID No.1；The DNA probe 2
For single stranded DNA of the base sequence as shown in SEQ ID No.2；The Microcystin aptamers are base sequence such as SEQ ID
Single stranded DNA shown in No.3.
Further, the thickness of the noble metal nano layer is 10-20nm.
Further, the particle diameter of the noble metal nanometer material is 30-50nm.
Further, the noble metal includes gold, silver or copper.
2nd, the preparation method of spr sensor, comprises the following steps：
(1) glass-chip is prepared：Make surface be positively charged amino glass slide cleaning, be then immersed in citric acid stablize it is expensive
Noble metal nano is deposited on by electrostatic force on the slide after processing in metal nano solution, obtain glass-chip；
(2) DNA probe 1 modifies glass-chip：Glass-chip obtained by step (1) is immersed and contained in the solution of DNA probe 1, is made
The DNA probe 1 is combined by covalent bond with the noble metal nano layer of glass-chip area load；
(3) DNA probe 2 modifies noble metal nano particles：DNA probe 2 is added in noble metal nano solution, made described
DNA probe 2 is combined by covalent bond with noble metal nanometer material surface；
(4) prepared by spr sensor：The glass-chip immersion DNA probe 2 that DNA probe 1 in step (2) is modified is modified expensive
In metal nano solution, Microcystin aptamers are then added, obtain spr sensor.
Further, comprise the following steps：
(1) glass-chip is prepared：Slide first passes through ammoniacal liquor：Hydrogen peroxide：Ultra-pure water volume ratio is 1：1：1 mixing is molten
Liquid cleans 1h, is then placed in 10min in the ethanol solution of 10% aminopropyl trimethoxysilane in anhydrous conditions, then with ultrapure
Water cleans, and it is positively charged amino to make surface, and being finally immersed in 2h in the stable noble metal nano solution of citric acid makes noble metal receive
Rice grain pattern is crossed on the slide after electrostatic force is deposited on processing, obtains glass-chip；
(2) DNA probe 1 modifies glass-chip：Glass-chip obtained by step (1) is immersed and contains 1h in the solution of DNA probe 1,
The DNA probe 1 is set to be combined by covalent bond with the noble metal nano layer of glass-chip area load；
(3) DNA probe 2 modifies noble metal nano particles：DNA probe 2 is added into 1h in noble metal nano solution, made described
DNA probe 2 is combined by covalent bond with noble metal nanometer material surface, then carries out ultrafiltration, removes uncombined DNA probe 2；
(4) prepared by spr sensor：DNA probe 1 in step (2) is modified into glass-chip and immerses your gold DNA probe 2 modifies
Belong in nano-solution, then add Microcystin aptamers, obtain spr sensor.
3rd, application of the described spr sensor in Microcystin is detected.
4th, the method that capsule Algae toxins are detected using described spr sensor, it is characterised in that：The spr sensor is added
Enter in the solution containing Microcystin, measure spr signal change.
Principle in the present invention using spr sensor detection capsule Algae toxins is as follows：DNA probe 1 is with DNA probe 2 with micro-capsule
Algae toxins aptamers form Y type DNA diploids as bridge by base pair complementarity, so as to form one on glass-chip surface
The new noble metal nano layer of layer, obtains stronger and more rich spr signal, and object Microcystin is adapted to Microcystin
Body is specifically bound, and changes its structure, be allowed to lose cannot be formed on glass-chip surface after bridge beam action one layer it is new
Noble metal nano layer, and then spr sensor measure spr signal change carries out the detection of Microcystin.
The beneficial effects of the present invention are：Spr sensor of the present invention is based on aptamer signal amplification strategy
The detection of Microcystin is realized, utilizes the exclusive office of the surface plasma body resonant vibration and noble metal nano structure of noble metal film
Field surface plasmon resonance principles, reach quick, Sensitive Detection Microcystin purpose by determining spr signal change.
Spr sensor preparation method of the present invention is simple, and detection range is wide, selectivity is high, stability is good, simple to operate, the green nothing of reagent
Pollution, disclosure satisfy that the real-time analysis to optical signal, be easy to build field monitoring Portable detection instrument, and the glass of sensor
Chip may be reused, and cost is far below large-scale analysis and detecting instrument.
Brief description of the drawings
In order that the purpose of the present invention, technical scheme and beneficial effect are clearer, the present invention provides drawings described below：
Fig. 1 is the sensor mechanism schematic diagram of Microcystin sensor；
Fig. 2 is the schematic diagram of oligonucleotide used in microcysin LR measure；
Fig. 3 is test result figure of the Microcystin sensor to Microcystin.
Embodiment
The preferred embodiments of the present invention will be described in detail below.The experiment of unreceipted actual conditions in embodiment
Method, generally according to normal condition or according to the condition proposed by manufacturer.
Embodiment 1
The preparation method of the spr sensor of detection Microcystin based on aptamer signal amplification strategy, specifically
The step of preparation method, is as follows：
(1) glass-chip is prepared：Slide is first used into ammoniacal liquor：Hydrogen peroxide：Ultrapure water volume ratio is 1：1：1 mixed solution
1h is cleaned, is then placed in anhydrous conditions in the ethanol solution for the aminopropyl trimethoxysilane that volume fraction is 10%
10min, then cleaned with ultra-pure water, it is positively charged amino to make surface, is finally immersed in 2h in the stable gold nano solution of citric acid
Gold nano grain is deposited on by electrostatic force on the slide after processing, obtain glass-chip；
(2) DNA probe 1 modifies glass-chip：Glass-chip obtained by step (1) is immersed containing 0.03 μM of DNA probe 1
1h in solution, DNA probe 1 is combined by Au-S keys with the gold nano grain on glass-chip surface, cleaned with ultra-pure water, it is natural
Dry stand-by；Wherein DNA probe 1 is that 5 ' terminal modified sulfydryl DNA are single-stranded ,-the SH-ctgtgacggtaatt-3 ' of base sequence 5 '
(SEQ ID No.1)；
(3) DNA probe 2 modifies gold nano grain：DNA probe 2 is added into particle diameter as 1h in 30-50nm gold nano solutions,
DNA probe 2 is covalently bonded in gold nano-material surface by Au-S keys, then carry out ultrafiltration, remove uncombined DNA probe
2；Wherein DNA probe 2 is single-stranded for the DNA of 3 ' terminal modified sulfydryls ,-the SH-gacactggtatggt-5 ' of base sequence 3 ' (SEQ
ID No.2)；
(4) prepared by spr sensor：DNA probe 1 in step (2) is modified into glass-chip and immerses the modification Jenner of DNA probe 2
In rice solution, Microcystin aptamers are then added, obtain spr sensor；Wherein Microcystin aptamers are that DNA is single-stranded,
Base sequence is 5 '-ggcgccaaacaggaccatgacaattacccataccacctcattatgccccatctccg c-3'(SEQ
ID No.3)。
5 ' ends of DNA probe 1 and 3 ' ends of the DNA probe 2 are complementary, and Microcystin aptamers serve as a connection, its
One end and 3 ' ends of DNA probe 1 are complementary, and 5 ' ends of the other end and DNA probe 2 are complementary, and Y types are formed by base pair complementarity
DNA diploids, its structure as shown in figure 1, so as to which the gold nano grain for modifying DNA probe 2 introduces glass-chip top layer, due to
The gold nano grain on glass-chip top layer increases, and its caused spr signal will be stronger more rich.When object Microcystin with
After the specific binding of Microcystin aptamers, the structure of Microcystin aptamers changes therewith, causes its function served as bridge to lose
Lose, so as to which the gold nano grain modified by DNA probe 2 can not be introduced on glass-chip surface, and then change spr signal, pass through
This principle carries out the detection of Microcystin.
Obtained spr sensor forms structure as shown in Figure 2, including glass-chip, Microcystin aptamers, DNA
Probe 1, DNA probe 2 and gold nano-material；Wherein one layer of gold nano layer of the area load of glass-chip, the DNA probe 1 are logical
Cross 5 ' terminal modified sulfydryls and pass through Au-S key covalent bonds with glass-chip surface；The DNA probe 2 passes through 3 ' terminal modified mercaptos
Base is combined with gold nano-material to be combined with glass-chip surface again；5 ' ends of the DNA probe 1 and 3 ' ends of the DNA probe 2
Complementation combines；Described Microcystin aptamers one end and the complementary combination in 3 ' ends of the DNA probe 1, the other end and the DNA
5 ' ends of probe 2 are complementary to be combined.
In above-described embodiment, gold nano can be silver nanoparticle or copper nanometer, and the noble metal nano on glass-chip surface
Particle can be different from the modification noble metal nano particles of DNA probe 2, can also be identical.
Embodiment 2
Microcystin in the spr sensor detection water of detection Microcystin based on aptamer signal amplification strategy
The method of cellulose content, comprises the following steps：
(1) preparation of line sensor is entered according to the method and step that spr sensor is prepared in embodiment 1；
(2) sensor of step (1) is immersed into the PBS cushioning liquid containing 0 μM, 10 μM, 100 μM Microcystin respectively
In, spr signal change is then determined, as a result as shown in figure 3, as seen from the figure, sensor is not before being washed with water, though contain difference
The Microcystin of concentration, but because the noble metal nano particles that the DNA probe 2 of injection is modified rest on its surface, so three
Group response increases simultaneously, but it is water washed after, with the DNA probe of the increase glass-chip surface combination of Microcystins
The noble metal nano particles of 2 modifications are fewer, and corresponding SPR responses are also smaller.The micro-capsule of various concentrations can be determined based on this
Algae toxins.Meanwhile sensor is 9 through volume ratio:Repeat and utilize after 1 methanol-acetic acid mixed liquor cleaning.
Finally illustrate, preferred embodiment above is merely illustrative of the technical solution of the present invention and unrestricted, although logical
Cross above preferred embodiment the present invention is described in detail, it is to be understood by those skilled in the art that can be
Various changes are made to it in form and in details, without departing from claims of the present invention limited range.
Claims (9)
1. the spr sensor of the detection Microcystin based on aptamer signal amplification strategy, it is characterised in that the biography
Sensor includes glass-chip, Microcystin aptamers, DNA probe 1, DNA probe 2 and noble metal nanometer material；The glass
One layer of noble metal nano layer of area load of chip, the DNA probe 1 pass through 5 ' terminal modified sulfydryls and the glass-chip table
The noble metal nano layer of face load passes through Covalent bonding together；The DNA probe 2 passes through 3 ' terminal modified sulfydryls and noble metal nano
Material combines；5 ' ends of the DNA probe 1 and the complementary combination in 3 ' ends of the DNA probe 2；The Microcystin aptamers
5 ' ends of one end and the complementary combination in 3 ' ends of the DNA probe 1, the other end and the DNA probe 2 are complementary to be combined.
2. spr sensor as claimed in claim 1, it is characterised in that the DNA probe 1 is base sequence such as SEQ ID
Single stranded DNA shown in No.1；The DNA probe 2 is single stranded DNA of the base sequence as shown in SEQ ID No.2；The Microcystis aeruginosa
Toxin aptamers are single stranded DNA of the base sequence as shown in SEQ ID No.3.
3. spr sensor as claimed in claim 1, it is characterised in that the thickness of the noble metal nano layer is 10-20 nm.
4. spr sensor as claimed in claim 1, it is characterised in that the particle diameter of the noble metal nanometer material is 30-50
nm。
5. spr sensor as claimed in claim 1, it is characterised in that the noble metal includes gold, silver or copper.
6. the preparation method of the spr sensor described in any one of claim 1 ~ 5, it is characterised in that comprise the following steps：
（1）Prepare glass-chip：Make surface be positively charged amino glass slide cleaning, be then immersed in the stable noble metal of citric acid
Noble metal nanometer material is deposited on by electrostatic force on the slide after processing in nano material, obtain glass-chip；
（2）DNA probe 1 modifies glass-chip：By step（1）Gained glass-chip, which immerses, to be contained in the solution of DNA probe 1, is made described
DNA probe 1 is combined by covalent bond with the noble metal nano layer of glass-chip area load；
（3）DNA probe 2 modifies noble metal nanometer material：DNA probe 2 is added in noble metal nanometer material, visits the DNA
Pin 2 is combined by covalent bond with noble metal nanometer material surface；
（4）It is prepared by spr sensor：By step（2）The glass-chip that middle DNA probe 1 is modified, which immerses DNA probe 2, modifies noble metal
In nano material, Microcystin aptamers are then added, obtain spr sensor.
7. preparation method as claimed in claim 6, it is characterised in that comprise the following steps：
（1）Prepare glass-chip：Slide first passes through ammoniacal liquor：Hydrogen peroxide：Ultra-pure water volume ratio is 1：1：1 mixed solution is clear
1 h is washed, is then placed in 10 min in the ethanol solution of 10% aminopropyl trimethoxysilane in anhydrous conditions, then use ultra-pure water
Cleaning, it is positively charged amino to make surface, and being finally immersed in 2 h in the stable noble metal nanometer material of citric acid makes noble metal nano
Material is deposited on the slide after processing by electrostatic force, obtains glass-chip；
（2）DNA probe 1 modifies glass-chip：By step（1）Gained glass-chip, which immerses, contains 1 h in the solution of DNA probe 1, makes institute
DNA probe 1 is stated to be combined with the noble metal nano layer of glass-chip area load by covalent bond；
（3）DNA probe 2 modifies noble metal nanometer material：DNA probe 2 is added into 1 h in noble metal nanometer material, makes the DNA
Probe 2 is combined by covalent bond with noble metal nanometer material surface, then carries out ultrafiltration, removes uncombined DNA probe 2；
（4）It is prepared by spr sensor：By step（2）Middle DNA probe 1 is modified the glass-chip immersion modification noble metal of DNA probe 2 and received
In rice material, Microcystin aptamers are then added, obtain spr sensor.
8. application of the spr sensor in Microcystin is detected described in any one of claim 1 ~ 5.
9. utilize the method for the spr sensor detection Microcystin described in any one of claim 1 ~ 5, it is characterised in that：Will
The spr sensor is added in the solution containing Microcystin, measure spr signal change.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610846741.0A CN106370868B (en) | 2016-09-23 | 2016-09-23 | Spr sensor of detection Microcystin based on aptamer signal amplification strategy and its preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610846741.0A CN106370868B (en) | 2016-09-23 | 2016-09-23 | Spr sensor of detection Microcystin based on aptamer signal amplification strategy and its preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106370868A CN106370868A (en) | 2017-02-01 |
| CN106370868B true CN106370868B (en) | 2018-04-10 |
Family
ID=57897102
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610846741.0A Active CN106370868B (en) | 2016-09-23 | 2016-09-23 | Spr sensor of detection Microcystin based on aptamer signal amplification strategy and its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106370868B (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108344863A (en) * | 2018-02-08 | 2018-07-31 | 中国科学院重庆绿色智能技术研究院 | A kind of new method of the nano-pore detection Microcystin based on aptamers-nanogold sensing |
| CN109696430B (en) * | 2019-03-01 | 2021-07-27 | 长江师范学院 | Method for measuring concentration of microcystin |
| CN110734962B (en) * | 2019-11-06 | 2021-10-19 | 江苏开放大学（江苏城市职业学院） | Method for detecting food toxin based on aptamer |
| CN111298836B (en) * | 2020-03-06 | 2023-03-31 | 军事科学院军事医学研究院环境医学与作业医学研究所 | DNA hydrogel based on biological mimic enzyme signal amplification and application thereof |
| CN111505284B (en) * | 2020-04-23 | 2023-05-02 | 中国科学院重庆绿色智能技术研究院 | Test paper strip and sensor for detecting novel coronavirus SARS-CoV-2, and preparation and application thereof |
| CN112014453B (en) * | 2020-07-24 | 2023-01-31 | 南京师范大学 | Method for detecting microcystin based on annular allosteric DNA electrochemical reaction |
| CN112834757B (en) * | 2020-12-31 | 2023-02-28 | 中国科学院重庆绿色智能技术研究院 | C-reactive protein detection method based on composite solid-state nanopore monomolecular technology |
| CN114395558A (en) * | 2022-01-17 | 2022-04-26 | 南通大学 | Magnetic bead-DNA probe, MC-LR detection biosensor, preparation method and application |
| CN114561451B (en) * | 2022-02-23 | 2023-12-05 | 中国地质大学（武汉） | Precise modified nano pore canal membrane and preparation method and application thereof |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP5463621B2 (en) * | 2008-02-27 | 2014-04-09 | ソニー株式会社 | Target substance quantification method |
| CN102628802B (en) * | 2012-04-17 | 2013-12-18 | 王利兵 | Method for detecting biotoxins in foods based on surface plasma resonance technology |
| CN103940815A (en) * | 2014-05-05 | 2014-07-23 | 福州大学 | Nucleic acid colorimetric sensor with Y-shaped structure and application of sensor |
| CN104914151B (en) * | 2015-05-08 | 2017-10-13 | 首都师范大学 | It is a kind of to be used for the forming method and its electrochemical sensor of ampicillin and sulfadimethoxine electrochemical sensor self assembly passivation layer |
| CN105779597A (en) * | 2016-03-28 | 2016-07-20 | 大连理工大学 | Unimolecular recognition method based on split aptamer bi-metal nanoprobe |
-
2016
- 2016-09-23 CN CN201610846741.0A patent/CN106370868B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN106370868A (en) | 2017-02-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106370868B (en) | Spr sensor of detection Microcystin based on aptamer signal amplification strategy and its preparation method and application | |
| Yin et al. | Surface-imprinted SiO2@ Ag nanoparticles for the selective detection of BPA using surface enhanced Raman scattering | |
| Chan et al. | Ultrasensitive detection of E. coli O157: H7 with biofunctional magnetic bead concentration via nanoporous membrane based electrochemical immunosensor | |
| Yan et al. | Paper‐based electrochemiluminescent 3D immunodevice for lab‐on‐paper, specific, and sensitive point‐of‐care testing | |
| Malik et al. | Molecularly imprinted polymer for human viral pathogen detection | |
| CN104345082B (en) | Biological sensor, manufacturing method and detection method thereof | |
| CN105548538A (en) | IgM antibody combined detection device of Coxsackie virus A16 and enterovirus 71 and making method thereof | |
| US20210102900A1 (en) | Biosensor based on trititanium dicarbide two-dimensional metal carbide catalyzed luminol electrogenerated chemiluminescence probe and preparation method | |
| CN104237344A (en) | Electrochemical aptamer electrode for kanamycin detection and preparation method of electrochemical aptamer electrode | |
| CN104155357A (en) | Preparation method and application of three-dimensional cubic duct based mesoporous silica sensor | |
| Li et al. | Magnetic beads-based electrochemical immunosensor for detection of pseudorabies virus antibody in swine serum | |
| CN107723347A (en) | A kind of hypersensitive colorimetric sensing detection method for determining ochratoxin A | |
| Tang et al. | An electrochemical sensor based on iron (II, III)@ graphene oxide@ molecularly imprinted polymer nanoparticles for interleukin-8 detection in saliva | |
| Li et al. | An innovative electrochemical immunosensor based on nanobody heptamer and AuNPs@ ZIF-8 nanocomposites as support for the detection of alpha fetoprotein in serum | |
| CN109187506B (en) | Preparation method and application of electrochemiluminescence sensor based on molecularly imprinted polymer-ferroferric oxide | |
| Zhao et al. | A non-enzymatic electrochemical immunosensor for microcystin-LR rapid detection based on Ag@ MSN nanoparticles | |
| Zhang et al. | High selective and sensitive capillary electrophoresis-based electrochemical immunoassay enhanced by gold nanoparticles | |
| Tu et al. | Nanochannel-based sensor for the detection of lead ions in traditional Chinese medicine | |
| Ji et al. | Mesoporous hollow silica shells modified with functional diamine groups show high-performance absorption capacity and selective colorimetric response to copper ions in aqueous solutions | |
| Zhou et al. | Electrochemical magnetoimmunosensing approach for the sensitive detection of H9N2 avian influenza virus particles | |
| Azadbakht et al. | Engineering an aptamer-based recognition sensor for electrochemical opium alkaloid biosensing | |
| CN106872707A (en) | A kind of electrochemical immunosensor and its preparation and application for detecting zearalenone | |
| Ding et al. | Insights into surface ion-imprinted materials for heavy metal ion treatment: challenges and opportunities | |
| Chen et al. | Tyramine signal amplification on polystyrene microspheres for highly sensitive quantification of Aflatoxin B1 in peanut samples | |
| Talamini et al. | Direct Electrochemical Nano‐immunosensor for Microcystin‐LR in Seawater |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |