CN106367530A - Primer group for rapidly identifying four rat parvovirus strains and detection method - Google Patents
Primer group for rapidly identifying four rat parvovirus strains and detection method Download PDFInfo
- Publication number
- CN106367530A CN106367530A CN201610767538.4A CN201610767538A CN106367530A CN 106367530 A CN106367530 A CN 106367530A CN 201610767538 A CN201610767538 A CN 201610767538A CN 106367530 A CN106367530 A CN 106367530A
- Authority
- CN
- China
- Prior art keywords
- strain
- primer
- krv
- rmv
- primer pair
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer group for rapidly identifying four rat parvovirus strains and a detection method. The primer group comprises a primer pair 1 and a primer pair 2, wherein the primer pair 1 is designed aiming at a conservative area of a nucleotide sequence of the RPV strain, and the primer pair 2 is designed aiming at conservative areas of nucleotide sequences of rat parvovirus H-1, KRV and RMV strains. The detection method is easy to operate, the four rat parvovirus strains including H1, KRV and RMV are distinguished through twice of PCR-HRM, and only a fluorescent saturable dye needs to be added before the PCR reaction; the detection speed is high, the high flux is realized, and the time needed by parting is greatly shortened; the cost is low, and a specific fluorescence labeling probe is not needed; the accuracy is high, the specificity is good, the repeatability is good, the accurate, rapid and high-flux analysis can be realized, and the primer group can be popularized and applied in clinical practice.
Description
Technical field
The invention belongs to field of molecular detection is and in particular to the drawing of four kinds of rat parvovirus strains of a kind of quick discriminating
Thing group and detection method.
Background technology
Rat parvovirus is one of susceptible virus common to experimental rat, kind of Mus group's breeding potential can be caused to decline, also
Tumour transplatation thing and cell line can be polluted severe jamming is produced to experimentation, be spf level latent rat virus in laboratory animal GB
Essential items for inspection.
Four kinds of rat parvovirus strains that rat can infect are h-1, krv, rmv and rpv respectively, these viruses of natural infection
Strain situation is common and usual no obvious clinical symptoms.The ability of the persistent infection of tiny strain adds support strong to environment
Drag makes rat parvovirus have wide influence to act in cell line and tumor experiment.
Serological method is the common method of parvovirus infections in current diagnosis experimental rat, advises in laboratory animal GB
Fixed serological method includes elisa (elisa), immuno-enzymatic test (iea), immunofluorescence test (ifa) and
Hemagglutination inhibition test (hia), elisa or ifa is commonly used as large-scale examination, and hia is generally used to do confirmatory test.Detection is big
The molecular detecting method of Mus parvovirus is also fewer at present, has the pcr method detecting four kinds of rat parvoviruses respectively, detection
Two re-detection methods of h1 and krv, there is presently no comparison comprehensively but the method simply detecting four kinds of rat parvoviruses.
Content of the invention
It is an object of the invention to provide a kind of primer sets of four kinds of rat parvovirus strains of quick discriminating and detection method.
The technical solution used in the present invention is:
A kind of double pcr primer sets of quick discriminating rat parvovirus h-1, krv, rmv and rpv strain, it includes primer
To 1 and primer pair 2, primer pair 1 is to be for rat parvovirus for the conservative region of rpv strain nucleotide sequence, primer pair 2
The conservative region design of h-1, krv and rmv strain nucleotide sequence.
As preferred, the sequence of described primer pair 1 is as follows:
p1:5’-atgtgccgtgggtgagtc-3’(seq id no.1)；
p2:5’-cgagaagttgtgatctggtgtat-3’(seq id no.2)；
The sequence of described primer pair 2 is as follows:
p3:5’-taactgcaccatttgtttgt-3’(seq id no.3)；
p4:5’-gttggttggttagtatgtgttg-3’(seq id no.4).
A kind of hrm detection kit of quick discriminating rat parvovirus h-1, krv, rmv and rpv strain, it contains above
Described primer sets.
A kind of hrm detection method of quick discriminating rat parvovirus h-1, krv, rmv and rpv strain, comprises the following steps:
1) extract viral nucleic acid from sample；
2) with viral nucleic acid as template, carry out amplified reaction using the primer pair 1 described in claim 1 or 2 and obtain amplification
Product, high-resolution melting curve analysis, if melting curve is single peak type, it is judged as rpv strain；
3) carry out amplified reaction using the primer pair 2 described in claim 1 or 2 and obtain amplified production, high-resolution melts
Tracing analysiss, if melting curve is judged as rmv strain for bimodal pattern, if melting curve is single peak type, melting tm than relatively low is
H-1 strain, what melting tm was higher is krv strain.
Step 2) in amplification reaction system as follows:
Step 2 and 3) in pcr amplified reaction program as follows: 94 DEG C of denaturations 3min；94 DEG C of degeneration 30s, 55 DEG C of annealing
30s, 72 DEG C of extension 30s；Circulation 35 times；72 DEG C extend 5min eventually.
As preferred, step 2) in hrm analytical tool melting temperature to set be to heat up 0.3 DEG C of speed from 78 with every step
DEG C to 90 DEG C of collections carrying out fluorescence signal.
As preferred, step 3) in hrm analytical tool melting temperature to set be to heat up 0.3 DEG C of speed from 78 with every step
DEG C to 90 DEG C of collections carrying out fluorescence signal.
As preferred, step 2) in hrm analysis process, in the range of 78-90 DEG C of melting temperature, if melting curve is single
Peak type is then judged as rpv strain.
As preferred, step 3) in hrm analysis process, in the range of 78-90 DEG C of melting temperature, if melting curve is double
Peak type is judged as rmv strain, if melting curve is single peak type, melt tm than relatively low be h-1 strain, melt tm higher be krv
Strain.
The invention has the beneficial effects as follows:
1) present invention establishes a kind of four kinds of rat parvovirus strains (h-1, krv, rmv and rpv) of quick discriminating first
Pcr-hrm detection method and primer, realizing 4 kinds of rat parvovirus strains (h1, krv, rmv and rpv strain) differentiations of differentiation only needs pcr
Fluorescence saturable dye is added to carry out conventional pcr reaction in system；Detection speed is fast,；Expense low it is not necessary to specific probe, glimmering
Light saturable dye consumption is few；Simply, quickly realize high throughput analysis can be suitable for rat parvovirus examination.
2) 4 kinds of rat parvovirus strains (h-1, krv, rmv and rpv) are all had well by the pcr-hrm primer of the present invention
Amplification property, pcr amplification efficiency is high, and sensitivity is high.
3) the pcr-hrm primer specificity of the present invention is good, can specific amplification rat parvovirus dna and do not expand big
Common other of Mus are viral and bacteria pathogenies are it is ensured that the reliability of this method.
Brief description
Fig. 1 is rat parvovirus rpv strain pcr amplified production gel electrophoresis figure；
Fig. 2 is rat parvovirus strain rpv strain standard sample hrm standardization melting curve；
Fig. 3 is rat parvovirus strain rpv strain standard sample hrm peak type melting curve；
Fig. 4 is rat parvovirus rpv strain clinical sample hrm standardization melting curve；
Fig. 5 is rat parvovirus strain rpv strain clinical sample hrm peak type melting curve；
Fig. 6 is the pcr amplified production gel electrophoresis figure of rat parvovirus strain (h1, krv and rmv strain)；
Fig. 7 is rat parvovirus strain strain (h-1, krv and rmv strain) standard sample hrm standardization melting curve；
Fig. 8 is rat parvovirus strain (h-1, krv and rmv strain) standard sample hrm peak type melting curve；
Fig. 9 is rat parvovirus strain (h-1, krv and rmv strain) clinical sample hrm standardization melting curve；
Figure 10 is rat parvovirus strain (h-1, krv and rmv strain) clinical sample hrm peak type melting curve.
Specific embodiment
With reference to specific embodiment, the invention will be further described, but is not limited thereto.
The design of embodiment 1 specific primer
Present invention design can detect the primer of rat parvovirus strain (h1, krv, rmv and rpv) simultaneously；And to set
The primer of meter does substantial amounts of experiment screening, filters out the strong primer of a group-specific, its nucleotide sequence is as follows:
p1:atgtgccgtgggtgagtc(seq id no.1)；
p2:cgagaagttgtgatctggtgtat(seq id no.2)；
p3:taactgcaccatttgtttgt(seq id no.3)；
p4:gttggttggttagtatgtgttg(seq id no.4).
Primer pair p1 and a length of 412bp of fragment of p2 amplification, a length of 325bp of fragment of primer pair p3 and p4 amplification.
The preparation of embodiment 2 standard sample and pcr-hrm analysis
1) extraction of rat parvovirus dna:
Rat parvovirus dna in sample is extracted using Tiangeng dna extracts kit, sample tissue can be that tissue is dirty
Device, feces or cell culture.
2) preparation of positive criteria sample:
In order to verify the inventive method feasibility and reliability, build standard positive sample, for clinical sample afterwards simultaneously
Product examine is surveyed provides hrm positive control, and the present invention need to preferentially prepare the positive criteria of rat parvovirus h1, krv, rmv and rpv strain
Sample.The preparation process of standard sample is as follows: learning from else's experience respectively sequencing is defined as correct plasmid dna as template, with p1 and
P2 (or p3 and p4) carries out pcr amplification for upstream and downstream primer under added with fluorescence saturable dye, and its pre- amplification reaction system is:
Pcr amplified reaction program is: 94 DEG C of denaturations 3min；94 DEG C of degeneration 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 30s；
Circulation 35 times；72 DEG C extend 5min eventually；It is to heat up 0.3 DEG C of speed from 78 DEG C with every step that hrm analytical tool melting temperature sets
To 90 DEG C of collections carrying out fluorescence signal.
3) positive criteria sample pcr-hrm interpretation of result
Hrm analysis process is carried out in rotor-gene q analyser, and this instrument can complete pcr-hrm analysis overall process,
Pcr amplification can also be completed on common pcr instrument be directly transferred in rotor-gene q complete to melt divide by pcr product again
Analysis.Due to uncapping, thus ensure that pcr product is not contaminated.Rat parvovirus h1, krv, rmv and rpv strain standard sample
Product hrm result is as shown in the figure.
Fig. 2,7 be plasmid standard pcr amplified production standardization melting curve figure, Fig. 3,8 be peak type melting curve figure, with
The melting curve that rpv plasmid standard expands under primer pair p1/p2 for template is single peak type, and under primer pair p3/p4, rmv is
The pcr amplified production of bimodal pattern and h-1 and krv plasmid standard is single peak type.
The pcr-hrm detection of embodiment 3 clinical sample
1) extract viral dna: method from sample with dna extracting method in embodiment 2；
2) with the dna of extraction as template, carry out pcr-hrm amplification, detect rpv strain p1/p2 primer pair, detect h1, krv
With rmv strain p3/p4 primer pair, amplification reaction system is:
Pcr amplified reaction program is: 94 DEG C of denaturations 3min；94 DEG C of degeneration 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 30s；
Circulation 35 times；72 DEG C extend 5min eventually；
3) hrm analysis is carried out to amplified production, determine rat tiny strain type
It is to carry out fluorescence letter from 78 DEG C to 90 DEG C with heat up 0.3 DEG C of speed of every step that hrm analytical tool melting temperature sets
Number collection.
4) gel electrophoresis analysis pcr amplified production
Pcr product point sample carries out electrophoresis in 2% agarose gel, observes amplified band under uviol lamp.With p1/p2 for drawing
During thing amplification, rpv is the purpose fragment size of template amplification is 412bp, and other tiny strains and non-parvovirus template no expand
Fragment；When being expanded with p3/p4, the amplified fragments size of h1, krv strain and rmv strain is 412bp, other tiny strains and non-tiny disease
Malicious template no amplified fragments.
The present invention detects to 26 parts of clinical samples, testing result such as Fig. 4,5,9 and 10.
Fig. 4,5 be respectively 7 parts of rpv samples of detection pcr amplification standard melting curve and peak type melting curve, sample amplification
Melting curve is single peak type, and its tm value is 85.58 ± 0.08 DEG C.
Fig. 9,10 be the detection pcr amplified production standardization melting curve figure of h-1, krv and rmv sample and peak type melt bent
Line chart.By the analysis to figure, find that wherein having 7 parts of sample melting curves to have two to melt interval is that peak type curve has two
Melting peakss, it is judged as rat parvovirus rmv strain (tm1:83.2 ± 0.10 DEG C, tm2:86.05 ± 0.07 DEG C, △ tm:2.85
±0.12℃)；It is peak type curve only one of which melting peakss that other 12 parts of sample melting curve only one of which melt interval, wherein 6
Strain melt tm than relatively low be h-1 strain (tm:84.21 ± 0.06 DEG C), another 6 plants melt tm higher be krv strain (tm:85.29
± 0.06 DEG C), positive h-1 strain sample and krv strain sample melting curve are all single peak types, but no mutually hand in 99% confidence interval
Fork, illustrates that two kinds of strain tm value difference heteropoles are notable, can make a distinction.
Changed because actually detected middle melting curve tm affects some by many factors, including nucleic acid fragment this
Body, reaction reagent salt ionic concentration and the faint change of saturated fluorescence dyestuff concentration, therefore actually detected need to define a wide tm
Scope.
In addition, this 26 parts of samples are expanded with the primer for vp2 gene and are sequenced, sequencing result and side of the present invention
The result of method detection is completely the same, illustrates that the accuracy of the inventive method is high, up to 100%.
Embodiment 4 specific test
Choose a kind of parvovirus and several antibacterial carries out specific detection, the pathogen of selection has minute parvovirus of mice mvm
Strain, helicobacter hepaticus (h.hepaticus), Salmonella typhimurium (s.typhimurium) and staphylococcuses (s.aureus).Will
The tiny sample of nucleic acid of non-rat and positive criteria product are loaded system according to identical and pcr reaction condition is reacted, and analyzes pcr
Product melting curve result.
Specific test gel electrophoresis figure result is as a shown in Figure 6.Fig. 1,6 show except positive criteria product compare in addition to, its
In his non-rat parvovirus cause of disease electrophoretogram, purpose band does not occur.The experiment failing to expand of non-rat parvovirus cause of disease
According to the specificity that ensure that primer involved in the present invention, also ensure that the reliability of the inventive method further.
Above-described embodiment is the present invention preferably embodiment, but embodiments of the present invention are not subject to above-described embodiment
Limit, other any spirit without departing from the present invention and the change made under principle, modification, replacement, combine, simplify,
All should be equivalent substitute mode, be included within protection scope of the present invention.
<110>Experimental Animals Supervising Station, Guangdong Prov.
<120>a kind of primer sets of four kinds of rat parvovirus strains of quick discriminating and detection method
<130>
<160> 4
<170> patentin version 3.5
<210> 1
<211> 18
<212> dna
<213>artificial sequence
<400> 1
atgtgccgtg ggtgagtc 18
<210> 2
<211> 23
<212> dna
<213>artificial sequence
<400> 2
cgagaagttg tgatctggtg tat 23
<210> 3
<211> 20
<212> dna
<213>artificial sequence
<400> 3
taactgcacc atttgtttgt 20
<210> 4
<211> 22
<212> dna
<213>artificial sequence
<400> 4
gttggttggt tagtatgtgt tg 22
Claims (10)
1. a kind of double pcr primer sets of quick discriminating rat parvovirus h-1, krv, rmv and rpv strain, it includes primer pair 1
With primer pair 2, primer pair 1 is to be for rat parvovirus h- for the conservative region of rpv strain nucleotide sequence, primer pair 2
1st, the conservative region of krv and rmv strain nucleotide sequence designs.
2. the double pcr primer of quick discriminating rat parvovirus h-1, krv, rmv and rpv strain according to claim 1
Group is it is characterised in that the sequence of described primer pair 1 is as follows:
p1: 5’-atgtgccgtgggtgagtc-3’；
p2: 5’-cgagaagttgtgatctggtgtat-3’；
The sequence of described primer pair 2 is as follows:
p3 :5’-taactgcaccatttgtttgt-3’；
p4: 5’-gttggttggttagtatgtgttg-3’.
3. a kind of hrm detection kit of quick discriminating rat parvovirus h-1, krv, rmv and rpv strain it is characterised in that: institute
State test kit and contain the primer sets described in claim 1 or 2.
4. a kind of hrm detection method of quick discriminating rat parvovirus h-1, krv, rmv and rpv strain is it is characterised in that include
Following steps:
1) extract viral nucleic acid from sample；
2) with viral nucleic acid as template, carry out amplified reaction using the primer pair 1 described in claim 1 or 2 and obtain amplified production,
High-resolution melting curve analysis, if melting curve is single peak type, are judged as rpv strain；
3) carry out amplified reaction using the primer pair 2 described in claim 1 or 2 and obtain amplified production, high-resolution melting curve
Analysis, if melting curve is judged as rmv strain for bimodal pattern, if melting curve is single peak type, melting tm than relatively low be h-1
Strain, what melting tm was higher is krv strain.
5. detection method according to claim 4 is it is characterised in that step 2) in amplification reaction system as follows:
premix ex-taq 10µl
Primer p1 0.5 l
Primer p2 0.5 l
Lc green dyestuff 1 l
Template 1 l
ddh2o 7µl
Cumulative volume 20 l；
premix ex-taq 10µl
Primer p3 0.5 l
Primer p4 0.5 l
Lc green dyestuff 1 l
Template 1 l
ddh2o 7µl
Cumulative volume 20 l.
6. detection method according to claim 4 is it is characterised in that step 2 and 3) in pcr amplified reaction program as follows:
94 DEG C of denaturation 3 min；94 DEG C of degeneration 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 30s；Circulation 35 times；72 DEG C extend eventually
5min.
7. detection method according to claim 4 is it is characterised in that step 2) in hrm analytical tool melting temperature set
It is that the collection of fluorescence signal is carried out with heat up 0.3 DEG C of speed of every step from 78 DEG C to 90 DEG C.
8. detection method according to claim 4 it is characterised in that in step 3) hrm analytical tool melting temperature set
It is that the collection of fluorescence signal is carried out with heat up 0.3 DEG C of speed of every step from 78 DEG C to 90 DEG C.
9. method according to claim 4 it is characterised in that: step 2) in hrm analysis process, 78-90 DEG C melt temperature
In the range of degree, if melting curve is single peak type, it is judged as rpv strain.
10. the method according to claim 3 it is characterised in that: in step 3) hrm analysis process, 78-90 DEG C melt
In temperature range, if melting curve is judged as rmv strain for bimodal pattern, if melting curve is single peak type, melting tm than relatively low is
H-1 strain, what melting tm was higher is krv strain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610767538.4A CN106367530B (en) | 2016-08-30 | 2016-08-30 | A kind of primer sets and detection method of four kinds of rat parvovirus strains of quick discriminating |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610767538.4A CN106367530B (en) | 2016-08-30 | 2016-08-30 | A kind of primer sets and detection method of four kinds of rat parvovirus strains of quick discriminating |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106367530A true CN106367530A (en) | 2017-02-01 |
| CN106367530B CN106367530B (en) | 2018-08-07 |
Family
ID=57902533
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610767538.4A Active CN106367530B (en) | 2016-08-30 | 2016-08-30 | A kind of primer sets and detection method of four kinds of rat parvovirus strains of quick discriminating |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106367530B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106893786A (en) * | 2017-03-22 | 2017-06-27 | 中国农业科学院上海兽医研究所 | Differentiate primer pair, probe, kit and the method for detection rat piconavirus and rat parvovirus |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105349700A (en) * | 2015-11-27 | 2016-02-24 | 广东省实验动物监测所 | HRM detection method and primer for fasting identifying parvovirus MVM strains and MPV strains of mice |
| CN105506187A (en) * | 2016-02-19 | 2016-04-20 | 苏州药明康德检测检验有限责任公司 | Quantitative PCR detection method of minute virus of mice and primers and probe of quantitative PCR detection method |
-
2016
- 2016-08-30 CN CN201610767538.4A patent/CN106367530B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105349700A (en) * | 2015-11-27 | 2016-02-24 | 广东省实验动物监测所 | HRM detection method and primer for fasting identifying parvovirus MVM strains and MPV strains of mice |
| CN105506187A (en) * | 2016-02-19 | 2016-04-20 | 苏州药明康德检测检验有限责任公司 | Quantitative PCR detection method of minute virus of mice and primers and probe of quantitative PCR detection method |
Non-Patent Citations (3)
| Title |
|---|
| WAN CH ET AL.: "Detection of rat parvovirus type 1 and rat minute virus type 1 by polymerase chain reaction", 《LABORATORY ANIMALS》 * |
| WAN CH ET AL.: "Molecular characterization of three newly recognized rat parvoviruses", 《JOURNAL OF GENERAL VIROLOGY》 * |
| 李晓波等: "大鼠细小病毒H-1株和KRV株双重PCR检测方法的建立及应用", 《中国比较医学杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106893786A (en) * | 2017-03-22 | 2017-06-27 | 中国农业科学院上海兽医研究所 | Differentiate primer pair, probe, kit and the method for detection rat piconavirus and rat parvovirus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106367530B (en) | 2018-08-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Rapid and sensitive detection of Zika virus by reverse transcription loop-mediated isothermal amplification | |
| CN106319092B (en) | A kind of quick discriminating Porcine epidemic diarrhea virus classics strain and HRM detection primers, kit and the method for variant | |
| CN106929607A (en) | A kind of primer pair for detecting the type of pig circular ring virus 3 virus, method and kit | |
| CN107630109A (en) | A kind of fluorescence quantification PCR primer and kit for detecting Novel pig acute diarrhea syndrome coronavirus | |
| CN102965451B (en) | Group A rotavirus real-time isothermal amplification detection kit, primers and probe thereof | |
| CN104195268A (en) | Reagent box for detecting aftosa A type, O type and Asia 1 type viruses and preparing method thereof | |
| CN111394515B (en) | LAMP primer group, fluorescence visualization rapid kit and method for detecting canine parvovirus | |
| Luigi et al. | Development of quantitative real-time RT-PCR for the detection and quantification of Peach latent mosaic viroid | |
| CN106995841A (en) | A kind of genetically engineered soybean detection multiple PCR reagent kit and detection method | |
| CN105624329A (en) | Real-time fluorescence nucleic acid isothermal amplification detection kit for human herpesvirus 1 | |
| CN109536642A (en) | A kind of universal pig fourth type coronavirus RT-Nested PCR detection method | |
| CN114015815B (en) | Microdroplet digital PCR kit for swine atypical pestivirus and detection method thereof | |
| Gou et al. | The colorimetric isothermal multiple-self-matching-initiated amplification using cresol red for rapid and sensitive detection of porcine circovirus 3 | |
| CN105154584B (en) | A kind of the HRM non-marked detecting probe method and its primer and probe of quick differentiation PRRSV classical strains and variation strain | |
| CN105349700B (en) | A kind of MVM plants of quick discriminating minute parvovirus of mice and MPV plants of HRM detection methods and primer | |
| CN106048097A (en) | Specific primers and method for real-time fluorescent quantitative PCR detection of tomato chlorosis virus | |
| CN108359743A (en) | A kind of HRM primer group for differentiating FPV and CPV, the kit containing the primer sets and its application | |
| CN106868218B (en) | Multiple PCR kit for rapid diagnosis of viral encephalitis | |
| CN105603081B (en) | Non-diagnosis-purpose qualitative and quantitative detection method for intestinal microorganisms | |
| CN106367530A (en) | Primer group for rapidly identifying four rat parvovirus strains and detection method | |
| CN104862423B (en) | The visualization genetic chip and kit of porcine pseudorabies virus, pig parvoviral and porcine circovirus 2 type | |
| CN108034765A (en) | Primer and probe, the method for quick detection Porcine epidemic diarrhea virus genotype | |
| Kamusoko et al. | Purification and amplification of DNA from cellulolytic bacteria: Application for biogas production from crop residues | |
| CN106521038B (en) | A kind of real-time fluorescence quantitative PCR detection methods of highly sensitive BHV 2 and kit | |
| CN105331741B (en) | A kind of the HRM detection method and primer of quick identification mouse encephalomyelitis virus and rat Taylor's virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |