CN106367524A - Transgenic maize T25 detection method based on loop-mediated isothermal amplification extinction technology - Google Patents
Transgenic maize T25 detection method based on loop-mediated isothermal amplification extinction technology Download PDFInfo
- Publication number
- CN106367524A CN106367524A CN201610941424.7A CN201610941424A CN106367524A CN 106367524 A CN106367524 A CN 106367524A CN 201610941424 A CN201610941424 A CN 201610941424A CN 106367524 A CN106367524 A CN 106367524A
- Authority
- CN
- China
- Prior art keywords
- primer
- mediated isothermal
- isothermal amplification
- detection
- transgenic corns
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of molecular biology and biological detection, and particularly discloses a transgenic maize T25 detection method based on a loop-mediated isothermal amplification extinction technology. Four specific primers are designed for six areas of pat genes of the transgenic maize T25, the primer sequences outside upstream and downstream parts are as shown in SEQ ID NO.1-2, and primer sequences inside the upstream and downstream parts are as shown in SEQ ID NO.3-4. By means of the loop-mediated isothermal amplification extinction technology, the primers are used for conducting amplification on DNA of samples, whether an amplified product exists or not is judged through changes of reaction colors or light absorption values, and therefore the transgenic maize T25 is detected. The method has the advantages of being high in sensitivity and specificity, easy to implement, capable of determining results with naked eyes and the like, and an efficient and rapid detection method is provided for the transgenic maize T25 detection.
Description
Technical field
The present invention relates to molecular biology and technical field of biological, specifically, it is related to expand based on ring mediated isothermal
Increase transgenic corns t25 detection method and the detection kit of delustring technology.
Background technology
Transgenic corns t25 is the anti-grass fourth phosphine that aventis cropscience (formerly agrevo) company produces
Corn strain.Careless fourth phosphine (phosphino thricin) is organic phosphates herbicide, is non-selective, broad-spectrum herbicide basta
Active component.Pat (phosphinothricin acetyltransferase gene) is derived from bacillus bacillus
Amyloliquefaciens grass fourth phosphinothricin acetyl transferase gene, it can make free acetylated in careless fourth phosphine and inactivate.
Loop-mediated isothermal amplification technique (loop-mediated isothermal amplification method,
Lamp it is) a kind of new constant temperature nucleic acid amplification method that notomi is equal to invention in 2000, be characterized in 6 for target gene
4-6 bar specific primer is designed in individual region, using a kind of dna polymerase (bst dna with strand-displacement activity
Polymerase (60-65 DEG C) reaction, can complete nucleic acid amplification reaction, purpose fragment is permissible in 1h) under isothermal conditions
Amplification 109Times.The method has high specificity, sensitivity is high, amplification efficiency is high, save time, simple operation and other advantages, in nucleic acid inspection
Survey aspect has a clear superiority.The product detection method of ring mediated isothermal detection technique mainly has nephelometry, dye method, electricity at present
Swimming method and nucleic acid test strip, but these methods all easily cause cross-contamination.
Content of the invention
In order to solve problems of the prior art, the present invention establishes a kind of inspection being directed to transgenic corns t25
Survey method, it is an object of the present invention to provide a set of loop-mediated isothermal amplification technique quick detection primer；The present invention's
Second purpose is to establish loop-mediated isothermal amplification detection method；Achieve the 3rd mesh of the present invention according to detection method
, there is provided using the test kit of above-mentioned detection primer；The test kit of the present invention and detection method have easy, sensitive, fast
A kind of the features such as speed, specificity are good, there is provided the detection method of the detection transgenic corns t25 that amplification efficiency is high, accuracy is high.
First purpose of the present invention provides a kind of ring mediated isothermal amplification delustring technology for detection transgenic corns t25 method
4 detection primers, sequence is respectively as follows:
Upstream outer primer, t25-f3:ctgggagggagggagggggaacgactcaatgacaaga (seq id no.1)；
Downstream outer primer, t25-b3:ctgggagggagggagggagaggcatcttcaacgatg (seq id no.2)；
Upstream inner primer, t25-fip:
tgtcgtttcccgccttcagtttctgggagggagggagggatcttcgtcaacatggtgg(seq id
no.3)；
Downstream inner primer, t25-bip:
ttgcccagctatctgtcactttctgggagggagggaggggcaatgatggcatttgtagg.(seq id
no.4)
Ribozyme be a kind of have class peroxidase activity, rich in guanine single-stranded dna molecule, under given conditions
G4 weight structure can be folded into, in h2o2In the presence of can be catalyzed colorless substrate 2,2 '-azine group-bis--(3- ethyl dihydro thiophene
Oxazoline -6- sulfonic acid) dianion (abts2-) it is oxidized to bluish-green color substance abts-Free radical.When there is single-stranded dna molecule
Complementary strand when, this species Peroxidase activity reduces and even disappears.Compromise colour developing/delustring technology is attached to ring mediation
On isothermal amplification technique, using primer colour developing, the means of product delustring, carry out the presence of verifying purpose fragment.
The present invention pass through dexterously design primer, make primer both can efficient amplification transgenic corns t25 pat gene, and
Above-mentioned functions can be realized as the single-stranded dna molecule with class peroxidase activity.
Second aspect, the invention provides a kind of side of the detection transgenic corns t25 that amplification efficiency is high, accuracy is high
Method, is expanded with the dna of aforementioned primer pair sample using ring mediated isothermal amplification delustring technology, by having detected whether expansion
Increase production thing to judge whether containing pat gene, thus judging whether testing sample has transgenic corns t25.
The method of the detection transgenic corns t25 that the present invention provides comprises the following steps:
(1) testing sample genomic templates are extracted；
(2) chromogenic reaction: hemin working solution is mixed with primer described in seq id no.1-4 of the present invention, adds abts and show
Color liquid and h2o2After obtain chromogenic reaction mixed liquor, at once record color or 419nm at mensure light absorption value；
(3) ring mediated isothermal amplification delustring reaction: add sample gene group template in chromogenic reaction mixed liquor, 60～
65 DEG C carry out ring mediated isothermal amplification delustring and react 40～60min；
(4) product detection: visually confirm reaction color, or measure light absorption value at 419nm, by the knot with step (2)
Fruit is compared, and determines whether amplified production, when color is changed into light or colourless from blueness or works as od419nmValue diminishes, and explanation has
Purpose product, testing sample is that transgenic corns t25 is positive.
In step (2), by the upstream outer primer of 40～60 μm of hemin working solution and 1.25 μm and downstream outer primer and
10 μm of upstream inner primer and the mixing of downstream inner primer, are incubated 20～30min under the conditions of 35～45 DEG C, add 30～40mm's
Abts nitrite ion and the h of 50～60mm2o2After obtain chromogenic reaction mixed liquor.
Wherein, step (3) is to add 1.4～2.0mm dntp, 3～8mm mgso in chromogenic reaction mixed liquor4、0.6
～0.8m glycine betaine, 3.6～10.0u bst dna polymerase Large fragment, 1 × thermopol buffer, 2 μ l sample gene groups
Template, then carry out ring mediated isothermal amplification delustring reaction.
Described hemin working solution is dissolved in working solution by hemin and prepares, and this working solution contains 10mmnah2po4、100mm
kcl、2mm mgcl2And 0.003%triton x-100.
Carry out chromogenic reaction under the conditions of this color development system, ensure that primer is farthest folded into g4 structure, with
Hemin fully combines, and has given play to the maximum activity of class peroxidase it is ensured that colour developing degree is optimal；In this amplification system condition
Under expanded, ensure that the amplification efficiency of primer is unaffected, realize rapid amplifying at short notice it is ensured that as many as possible
Ribozyme primer form double-stranded products, thus losing class peroxidase activity so that reaction system delustring.
The third aspect, the present invention provides a kind of test kit of detection transgenic corns t25, containing sequence such as seq id
Primer shown in no.1-4.
Further, the test kit of the present invention also contain working solution, hemin, abts powder, dmso buffer, 30%
h2o2, and 1 × thermopol buffer, dntp, mgso4, glycine betaine composition reactant liquor and bst dna polymerase；Described
Working solution contains 10mm nah2po4、100mm kcl、2mm mgcl2And 0.003%triton x-100.
Preferably, reactant liquor is 1 × thermopol buffer, the 1.4-2.0mm by volume ratio for 5:8:1:10
dntp、3-8mm mgso4, 0.6-0.8m glycine betaine composition.
In described test kit, described primer, presented in primer mixed liquor, contains in described primer mixed liquor
1.25 μm of upstream outer primer t25-f3 and downstream outer primer t25-b3, the upstream inner primer t25-fip containing 10 μm and downstream
Inner primer t25-bip.
Bst dna polymerase lyophilizing is in pcr pipe inner bottom part.Wherein mixed liquor, working solution, abts powder, dmso buffer,
30%h2o2Can room temperature preserve, reactant liquor needs 4 DEG C of preservations, bst dna polymerase needs -20 DEG C of preservations.
The invention provides application in detection transgenic corns for the mentioned reagent box.
The beneficial effects of the present invention is:
1st, react quick, generally substantial amounts of amplified production can be had to produce in 15～30min, in order to ensure to detect
Accuracy, a length of 40min of choice reaction time of the present invention, can be by template amplification 10 within this time9Times, the method operation letter
Just, it is suitable to the quick detection of nucleic acid molecules.
2nd, specificity is good, 6 region design primers to target gene for this technology, and primer has higher specificity.
3rd, sensitivity is high, and this technology response speed is fast, can reach good Detection results for trace genes of interest, spirit
Sensitivity high one to two orders of magnitude than pcr method, this technology is that the supervisory detection of transgenic product provides technical support.
4th, simple to operate, it is suitable to basic unit and use.The present invention devises the test kit of detection transgenic corns t25, operation letter
Single it is not necessary to professional operates, result is easy to observe, and is very suitable for basic unit's detection and uses.
Brief description
Fig. 1 is ring mediated isothermal delustring amplified reaction electrophoresis result in the embodiment of the present invention 5；Wherein, swimming lane 1 is negative expansion
Increase, swimming lane 2 is positive amplification, m is d2000 maker.
Specific embodiment
Below in conjunction with embodiment, the preferred embodiment of the present invention is described in detail.It will be appreciated that it is following real
Applying providing merely to playing descriptive purpose of example, being not used to the scope of the present invention is limited.The skill of this area
Art personnel, in the case of without departing substantially from spirit of the invention and spirit, can carry out various modifications and replace to the present invention.
Experimental technique used in following embodiments if no special instructions, is conventional method.
Material used, reagent etc. in following embodiments, if no special instructions, all commercially obtain.
The design of embodiment 1 primer and determination
Primer Photographing On-line software lamp primer designing is mediated by Japanese Rong Yan Co., Ltd. ring
software primerexplorer v4.0(http://primerexplorer.jp/elamp4.0.0/index.html)
Pat gene order for transgenic corns t25 designs primer, makes the pat gene of primer both amplifiable transgenic corns t25,
But also as have class peroxidase activity, rich in guanine single-stranded dna molecule so as to can roll under given conditions
Build up g4 weight structure, in h2o2In the presence of can be catalyzed colorless substrate 2,2 '-azine group-bis--(3- ethyl thiazoline quinoline -6-
Sulfonic acid) dianion (abts2-) it is oxidized to bluish-green color substance abts-Free radical.When the complementary strand that there is single-stranded dna molecule
When, class Peroxidase activity reduces even disappearance.Compromise colour developing/delustring technology is attached to loop-mediated isothermal amplification technique
On, using primer colour developing, the means of product delustring, carry out the presence of verifying purpose fragment.Primer is by the limited public affairs of Shanghai Invitrogen
Department's synthesis, primer is diluted to 10 μm of ol/l.
Through repeated screening research, the poor primer combination of exclusion effect, the drawing of optimum detection effect of present invention design
Thing is:
Upstream outer primer, t25-f3:ctgggagggagggagggggaacgactcaatgacaaga (seq id no.1)；
Downstream outer primer, t25-b3:ctgggagggagggagggagaggcatcttcaacgatg (seq id no.2)；
Upstream inner primer, t25-fip:
tgtcgtttcccgccttcagtttctgggagggagggagggatcttcgtcaacatggtgg(seq id
no.3)；
Downstream inner primer, t25-bip:
ttgcccagctatctgtcactttctgggagggagggaggggcaatgatggcatttgtagg.(seq id
no.4)
Compared with common lamp primer, the inner primer of the present invention by two primers and dnazyme Sequence composition, according to
Design of primers principle, adds after dnazyme sequence the sequence length of side between f1c and f2, then require between f1c and f2 original series not
More than 35bp, between b1 and b2c, original series are less than 35bp in the same manner, and otherwise, inner primer then cannot be folded into dumbbell shaped knot
Structure.
The foundation of embodiment 2 transgenic corns t25 detection method
(1) weigh 100mg transgenic corns t25 powder, extract genome with ctab method；
(2) the optimal primer from embodiment 1 screening is tested, and primer is synthesized by Shanghai Invitrogen company limited,
Primer is diluted to 10 μm of ol/l；
(3) factor (hemins, incubation temperature, time, abts, h to impact chromogenic reaction2o2) be optimized, determine
Optimum colour developing/delustring reaction system: 50 μm of hemin working solutions, 1.25 μm of outer primer t25-f3 and t25-b3 of interpolation, 10 μm
Inner primer t25-fip and t25-bip, 40 DEG C of incubation 30min, then add 36mm abts nitrite ion, 60mm h2o2, sentence immediately
Determine color, measure od419；
(4) lamp amplification reaction system: add 1.6mm dntp, 6mm mgso in the reactant liquor of (3)4, 0.8m Radix Betae
Alkali, 8.0u bst dna polymerase, 1 × thermopol buffer.Amplified reaction program: 65 DEG C of reaction 40min；
(5) interpretation of result: after amplification, color is shoaled by blueness or colourless, or od419Value diminishes, and illustrates containing purpose product.
Embodiment 3 ring mediated isothermal amplification delustring reaction system and the optimization of reaction condition
Optimal for ensureing color development system, the present invention is optimized to following each reaction factors.
1. the optimization of developing time
40 μm of hemin working solutions, add 1.25 μm of outer primer t25-f3 and t25-b3,10 μm of inner primer t25-fip and
T25-bip, 35 DEG C of incubation 30min, then add 30mm abts nitrite ion, 60mm h2o2.Measured using ultraviolet spectrophotometer
Gained reaction mixture is in the od of 0s, 30s, 1min, 2min, 5min, 10min, 30min419nmValue.Negative control is without drawing
Thing, uses ddh2O substitutes.According to table 1 result, prolongation over time, positive and negative colour developing all can dramatically increase, and leads to
Cross positive and negative ratio to find, time of measuring is more early better, the present invention measures od value immediately using after colour developing.
Colour developing result under the different developing time of table 1
2. the optimization of incubation temperature and time
Positive reaction (+): 40 μm of hemin working solutions, add 1.25 μm of outer primer t25-f3 and t25-b3, draw in 10 μm
Thing t25-fip and t25-bip, 35-45 DEG C of incubation 20-30min, then add 30mm abts nitrite ion, 60mm h2o2, utilize
Ultraviolet spectrophotometer measures the od of gained reaction mixture immediately419nmValue.Negative control (-) without primer, use ddh2O replaces
Generation.According to table 2 result, prolongation over time, positive and negative colour developing all can be gradually increased, by positive and negative
Ratio find, less, the incubation conditions that the present invention adopts are 40 DEG C to anaphase difference, 30min.
The different incubation temperature of table 2 and the colour developing result (od under the time419nmValue)
3. the optimization of concentration
40-60 μm of hemin working solution, adds 1.25 μm of outer primer t25-f3 and t25-b3,10 μm of inner primer t25-fip
And t25-bip, 40 DEG C of incubation 30min, then add 30-50mm abts nitrite ion, 60mm h2o2, using uv-spectrophotometric
Meter measures the od of gained reaction mixture immediately419nmValue.Negative control, without primer, uses ddh2O substitutes.According to table 3 result
Understand, with the increase of hemin concentration, positive (+) colour developing all can be gradually increased, this is because the amount being combined with ribozyme is increased
, with the increase of abts concentration, positive colour developing is gradually increased, but negative (-) colour developing also can be gradually increased, this be by
Color in chromogenic substrate itself increased, and the increase of background value causes positive and negative ratio to decline, and the present invention adopts
Have ready conditions most as 50 μm of hemin, abts 36mm.
The different hemin working solution of table 3 and the colour developing result (od of abts nitrite ion419nmValue)
The specificity of transgenic corns t25 and sensitivity in embodiment 4 test kit detection sample
(1) sample gene group template preparation: claim 100mg pulverized specimen, extract genome with ctab method, sample comprises:
Transgenic corns t25, transgenic corns mir604, transgenic corns bt176, non-transgenic corn, genetically engineered soybean gts-40-
3-2, transgenic paddy rice tt51-1 and transgene rape gt73.By the concentration of transgenic corns t25 genome during sensitivity checking
It is adjusted to 105Pg/ μ l, then by 10 times of doubling dilutions of genome of this concentration be 104, 103, 102, 10,1pg/ μ l, it is prepared into
The standard dna template of serial tonsure concentration.
(2) chromogenic reaction: prepare 50 μm of hemin working solutions, 36mm abts nitrite ion and 60mm h2o2, containing
Prepare reaction system in the pcr pipe of bst dna polymerase lyophilized powder, add primer mixture 9 μ l, hemin reactant liquor 90 μ l, 40
DEG C incubation 30min, add abts nitrite ion 29 μ l and 1 μ l h2o2, judge color immediately, measure od419.
(3) ring mediated isothermal amplification delustring reaction: in above-mentioned mixed liquor, interpolation reactant liquor 12 μ l, dna template 2 μ l, 65 DEG C
React 40min in water-bath, judge color, measure od419.
(4) interpretation of result: the od before and after reaction419Value see table it is stipulated that od before reacting419For a, od after reaction419For b.Aobvious
Colour response liquid is in initially blueness, and after amplification, the reactant liquor containing sample gene group is close to colourless, od419Reduce, negative control is
Still it is in blueness without genomic templates reactant liquor, od419Remain unchanged, thus judge to contain transgenic corns t25 composition.
The specificity of transgenic corns t25 and sensitivity in table 4 test kit detection sample
As shown in Table 4, only transgenic corns t25 there occurs that delustring is reacted, the od of remaining comparison419Substantially it is consistent,
Prove that this detection method has preferable specificity.In sensitivity test, positive od after amplification419nmValue is with genome concentration
Increase and reduce, negative control od419nmValue is basically identical with former od value, thus judges that the lowest detection of this method is limited to 10pg.
Transgenic corns t25 composition in the test kit detection sample containing primer of the present invention for the embodiment 5
(1) extraction of genomic templates: claim 100mg testing sample, extract genome with ctab method.
(2) chromogenic reaction: prepare 50 μm of hemin working solutions, 36mm abts nitrite ion and 60mm h2o2, containing
Prepare reaction system in the pcr pipe of bst dna polymerase lyophilized powder, add primer mixture 9 μ l, hemin reactant liquor 90 μ l, 40
DEG C incubation 30min, add abts nitrite ion 29 μ l and 1 μ l h2o2, judge color immediately, measure od419.
(3) ring mediated isothermal amplification delustring reaction: in above-mentioned mixed liquor, interpolation reactant liquor 12 μ l, dna template 2 μ l, 65 DEG C
React 40min in water-bath, judge color, measure od419.
(4) interpretation of result: in step (2), chromogenic reaction liquid is in blueness, od419For 0.69571, after amplification, reactant liquor is close
Colourless, od419For 0.09542, negative control reactant liquor is in blueness, od419For 0.66288, after amplification, reactant liquor remains blue,
od419For 0.65713, difference is little.Through above-mentioned ring mediated isothermal delustring amplification, the amplified production obtaining carries out agarose and coagulates
Gel electrophoresis, result is as shown in figure 1, show the stepped product band of typical lamp.This result shows that test kit of the present invention can
It is directly used in the detection of transgenic corns t25.
Although, above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements without departing from theon the basis of the spirit of the present invention, belong to the scope of protection of present invention.
sequence listing
<110>China Agricultural University
<120>the transgenic corns t25 detection method based on ring mediated isothermal amplification delustring technology
<130> khp161116353.3
<160> 4
<170> patentin version 3.5
<210> 1
<211> 37
<212> dna
<213>artificial sequence
<400> 1
ctgggaggga gggaggggga acgactcaat gacaaga 37
<210> 2
<211> 36
<212> dna
<213>artificial sequence
<400> 2
ctgggaggga gggagggaga ggcatcttca acgatg 36
<210> 3
<211> 58
<212> dna
<213>artificial sequence
<400> 3
tgtcgtttcc cgccttcagt ttctgggagg gagggaggga tcttcgtcaa catggtgg 58
<210> 4
<211> 59
<212> dna
<213>artificial sequence
<400> 4
ttgcccagct atctgtcact ttctgggagg gagggagggg caatgatggc atttgtagg 59
Claims (10)
1. the primer of the detection transgenic corns t25 based on ring mediated isothermal amplification delustring technology is it is characterised in that described primer
Including upstream outer primer, downstream outer primer, upstream inner primer and downstream inner primer, its sequence is respectively as seq id no.1-4 institute
Show.
2. application in detection transgenic corns t25 for the primer described in claim 1.
3. a kind of method of detection transgenic corns t25 is it is characterised in that using ring mediated isothermal amplification delustring technology right
The dna requiring the primer pair sample described in 1 is expanded, and determines whether that amplification is produced by the change of reaction color or light absorption value
Thing, thus detect transgenic corns t25.
4. method according to claim 2 is it is characterised in that comprise the steps:
(1) testing sample genomic templates are extracted；
(2) chromogenic reaction: hemin working solution is mixed with primer described in claim 1, adds abts nitrite ion and h2o2Afterwards
To chromogenic reaction mixed liquor, record color at once or measure light absorption value at 419nm；
(3) ring mediated isothermal amplification delustring reaction: add sample gene group template in chromogenic reaction mixed liquor, at 60～65 DEG C
Carry out ring mediated isothermal amplification delustring and react 40～60min；
(4) product detection: visually confirm reaction color, or measure light absorption value at 419nm, by the result ratio with step (2)
Relatively, determine whether amplified production, when color is changed into light or colourless or od from blueness419nmValue diminishes, and purposeful product is described
Thing, testing sample is that transgenic corns t25 is positive.
5. method according to claim 4 is it is characterised in that in step (2), by 40～60 μm of hemin working solution with
The upstream inner primer of 1.25 μm of upstream outer primer and downstream outer primer and 10 μm and the mixing of downstream inner primer, at 35～45 DEG C
Under the conditions of be incubated 20～30min, add the abts nitrite ion of 30～40mm and the h of 50～60mm2o2After obtain chromogenic reaction mixing
Liquid.
6. method according to claim 4 it is characterised in that step (3) be in chromogenic reaction mixed liquor add 1.4～
2.0mm dntp, 3～8mm mgso4, 0.6～0.8m glycine betaine, 3.6～10.0u bst dna polymerase Large fragment, 1 ×
Thermopol buffer, 2 μ l sample gene group templates, then carry out ring mediated isothermal amplification delustring reaction.
7. method according to claim 4 is it is characterised in that described hemin working solution is dissolved in working solution by hemin and joins
System, this working solution contains 10mm nah2po4、100mm kcl、2mm mgcl2And 0.003%triton x-100.
8. a kind of test kit of detection transgenic corns t25 is it is characterised in that containing the primer described in claim 1.
9. test kit as claimed in claim 8 is it is characterised in that also contain working solution, hemin, abts powder, dmso buffering
Liquid, 30%h2o2, and 1 × thermopol buffer, dntp, mgso4, glycine betaine composition reactant liquor and bst dna polymerization
Enzyme；Described working solution contains 10mm nah2po4、100mm kcl、2mm mgcl2And 0.003%triton x-100.
10. application in detection transgenic corns for the test kit described in claim 8 or 9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610941424.7A CN106367524A (en) | 2016-10-25 | 2016-10-25 | Transgenic maize T25 detection method based on loop-mediated isothermal amplification extinction technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610941424.7A CN106367524A (en) | 2016-10-25 | 2016-10-25 | Transgenic maize T25 detection method based on loop-mediated isothermal amplification extinction technology |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106367524A true CN106367524A (en) | 2017-02-01 |
Family
ID=57893124
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610941424.7A Pending CN106367524A (en) | 2016-10-25 | 2016-10-25 | Transgenic maize T25 detection method based on loop-mediated isothermal amplification extinction technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106367524A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755545A (en) * | 2017-03-11 | 2017-05-31 | 吉林省农业科学院 | The LAMP detection primer group of pat gene, kit and detection method in genetically modified crops |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101985661A (en) * | 2010-12-08 | 2011-03-16 | 北京农业生物技术研究中心 | Method for quickly detecting transgenic corn by using LAMP method |
-
2016
- 2016-10-25 CN CN201610941424.7A patent/CN106367524A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101985661A (en) * | 2010-12-08 | 2011-03-16 | 北京农业生物技术研究中心 | Method for quickly detecting transgenic corn by using LAMP method |
Non-Patent Citations (3)
| Title |
|---|
| FU RONGZHAN等: "《DNAzyme Molecular Beacon Probes for Target-Induced Signal-Amplifying Colorimetric Detection of Nucleic Acids》", 《ANALYTICAL CHEMISTRY》 * |
| YANG LI等: "《A novel colorimetric PCR-based biosensor for detection and quantification of hepatitis B virus》", 《ANALYTICA CHIMICA ACTA》 * |
| 汤薇等: "《利用模拟酶催化显色和等温核酸扩增反应检测特定序列DNA》", 《分析化学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755545A (en) * | 2017-03-11 | 2017-05-31 | 吉林省农业科学院 | The LAMP detection primer group of pat gene, kit and detection method in genetically modified crops |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Cheng et al. | On-site detection of stacked genetically modified soybean based on event-specific TM-LAMP and a DNAzyme-lateral flow biosensor | |
| Yang et al. | Event-specific quantitative detection of nine genetically modified maizes using one novel standard reference molecule | |
| CN111705158A (en) | LFD-RPA visual detection primer group for detecting sweet potato black spot pathogen and detection method | |
| CN106995841A (en) | A kind of genetically engineered soybean detection multiple PCR reagent kit and detection method | |
| Yu et al. | Development and evaluation of a novel loop mediated isothermal amplification coupled with TaqMan probe assay for detection of genetically modified organism with NOS terminator | |
| CN109337959A (en) | A kind of RPA detection primer of transgenic corns MON810 and probe combinations, kit and detection method | |
| KR101154775B1 (en) | Method of detecting and quantifying wheat endogenous dna sequence | |
| CN106399540A (en) | Corn detection method based on loop-mediated isothermal amplification extinction technology | |
| CN106367524A (en) | Transgenic maize T25 detection method based on loop-mediated isothermal amplification extinction technology | |
| Narushima et al. | Rapid DNA template preparation directly from a rice sample without purification for loop-mediated isothermal amplification (LAMP) of rice genes | |
| CN109136338A (en) | A kind of primer, probe and kit and method detecting genetically engineered soybean MON89788 | |
| CN102559854B (en) | Standard plasmid molecular used for detecting transgenic soybean, corn and cotton and construction of the standard plasmid molecular | |
| CN102134603B (en) | Primer, probe, test kit and method for testing genetically modified rice or products thereof | |
| Li et al. | Developing a matrix reference material for screening of transgenic rice | |
| CN104212880B (en) | The fast check reagent box of genetically modified corn MON 863 gene and detection method based on LAMP | |
| CN109735605A (en) | Transgenic corns MON89034 strain immue quantitative detection reagent box and digital pcr detection method | |
| CN106367525A (en) | Transgenic maize MON810 detection method based on loop-mediated isothermal amplification extinction technology | |
| CN106399544A (en) | Genetically modified corn MIR604 detection method based on loop-mediated isothermal amplification extinction technology | |
| CN115992284A (en) | Kit and method for rapidly detecting transgenic product based on RPA-CRISPR-Cas12a system | |
| CN106381336A (en) | Transgenic corn TC1507 detection method based on loop-mediated isothermal amplification light extinction technology | |
| Xiujie et al. | Comparison of five endogenous reference genes for specific PCR detection and quantification of rice | |
| CN106319077A (en) | Transgenic soybean MON89788 detection primer based on loop-mediated isothermal amplification extinction technology, detection method and kit | |
| CN110564822B (en) | LAMP technology-based transgenic corn Bt 176-related gene detection method and kit | |
| Yi et al. | Estimating the copy number of transgenes in transformed cotton by real-time quantitative PCR | |
| CN106319076A (en) | Transgenic soybean GTS40-3-2 detection primer based on loop-mediated isothermal amplification extinction technology, detection method and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170201 |