CN106337081A - Correlation of SNP site rs1054135 of FABP4 gene with triple-negative breast cancer prognosis - Google Patents

Correlation of SNP site rs1054135 of FABP4 gene with triple-negative breast cancer prognosis Download PDF

Info

Publication number
CN106337081A
CN106337081A CN201610072847.XA CN201610072847A CN106337081A CN 106337081 A CN106337081 A CN 106337081A CN 201610072847 A CN201610072847 A CN 201610072847A CN 106337081 A CN106337081 A CN 106337081A
Authority
CN
China
Prior art keywords
fabp4
prognosis
breast cancer
female
test kit
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201610072847.XA
Other languages
Chinese (zh)
Other versions
CN106337081B (en
Inventor
袁芃
王雯邈
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Cancer Hospital and Institute of CAMS and PUMC
Original Assignee
Cancer Hospital and Institute of CAMS and PUMC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cancer Hospital and Institute of CAMS and PUMC filed Critical Cancer Hospital and Institute of CAMS and PUMC
Priority to CN201610072847.XA priority Critical patent/CN106337081B/en
Publication of CN106337081A publication Critical patent/CN106337081A/en
Application granted granted Critical
Publication of CN106337081B publication Critical patent/CN106337081B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57415—Specifically defined cancers of breast
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/172—Haplotypes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Genetics & Genomics (AREA)
  • Cell Biology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to triple-negative breast cancer prognosis, especially relates to correlation of an SNP site with triple-negative breast cancer prognosis, and especially relates to correlation of an SNP site rs1054135 of FABP4 gene with triple-negative breast cancer prognosis. The invention concretely relates to an application of a nucleic acid affinity ligand of the SNP site rs1054135 of the FABP4 gene in the preparation of a kit used for the triple-negative breast cancer prognosis, and the kit used for triple-negative breast cancer prognosis and including the corresponding nucleic acid affinity ligand.

Description

The snp site rs1054135 of fabp4 gene and the phase of three female Prognosis in Breast Cancer Guan Xing
Technical field
The present invention relates to the prognosis of three female breast carcinoma (triple-negative breast cancer, tnbc), especially It is related to single nucleotide polymorphism (single-nucleotide polymorphisms, snp) site and three female Prognosis in Breast Cancer Dependency, the snp site rs1054135 particularly to fabp4 (FABP4) gene is pre- with three female breast carcinoma Dependency afterwards.
Background technology
Breast carcinoma is a kind of serious kinds of tumor threatening human health, its sickness rate in the range of world in recent years, dead Rate of dying all maintains sustained and rapid growth.2008, the whole world there are about 1,200,000 breast carcinoma new cases, 400,000 breast cancer deaths cases.At me State, all in obvious ascendant trend, its sickness rate has leapt to the 1st of female malignant to the M ＆ M of breast carcinoma. China's tumour registration area breast cancer incidence is 47.64/10 ten thousand within 2011, and population standardized rate is 25.26/10 ten thousand, increases speed Degree relatively rose 3 times before 5 years.In cities such as Shanghai, Beijing, Guangzhou, breast cancer incidence is maintained an equal level with western countries, becomes The maximum reason of harm WomanHealth.
The tumor of the height heterogeneity that breast carcinoma is well recognized as, shows that clinical stagess and histological type identical breast carcinoma are suffered from Person, biological behaviour and prognosis often have very big difference.Clinically according to SABC index -- estrogen receptor (er), progestogen The level of receptor (pr), epidermal growth factor acceptor 2 (her-2) and ki-67 by breast carcinoma be divided into tube chamber a type, tube chamber b type, Her2/neu type and three female.Wherein, three female breast carcinoma refer to that er, pr and her-2 are the hypotype of feminine gender, account for whole mammary gland The 15-20% of cancer patient.Previously research display three female breast carcinoma aggressive are strong, and prognosis is poor, and are heterogeneous the strongest by one Class hypotype, some patientss are easy to, in early stage, relapse and metastasis occur particularly in 3 years.With the development of molecule parting technology, Breast carcinoma is further divided into 5 kinds of hypotypes: tube chamber a type, tube chamber b type, her2/neu type, substrate according to the situation of inherent gene expression Cell template and normal breast template.
Using various breast carcinoma as holistic approach object, its conclusion is often subject to multiple Confounding Factor shadows to traditional research method Ring, repeatable poor.The treatment of breast carcinoma has been enter into the molecule parting epoch, the oncobiology characteristic between different typings and gene Spectrum significant difference, therefore, gene level is explored can be used for predicting the hereditary variation of three female breast cancer relapses transfers for Clinical significant.And identify that the related subgroup of three female breast carcinoma clinical prognosis will be helpful to setting of personalized therapy program Meter and enforcement.
The change (i.e. the differential expression of gene) of the structure of gene and expression has thousand with the biological behaviour of breast carcinoma The contact of ten thousand threads.Include estrogen receptor related gene, mammary gland cancer family tumor susceptibility gene (brca1, brca2), thin among these Born of the same parents' biological behaviour related gene (bcl-2, pcna, cycd1 etc.), proto-oncogene (ras, myc, muc1 etc.), cell proliferation phase Correlation gene (cdkn3, crip1, tpx2 etc.), cell adhesion related gene (fn1, lpxn, tspan1 etc.), participating in apoptosis Because of (pycard, bax, cxcr4) etc..Said gene is closely related with generation, growth, conversion and the transfer of breast tumor.For example, Find in the research of a contrast breast carcinoma and normal galactophore tissue's mrna level, crip1 in nearly 90% infiltrating carcinoma and cancer in situ Gene expression raises 8-10 times.And 21 bases of the difference expression gene composition picked out according to the genetic microarray analysis of breast carcinoma Because express spectra (oncotype dx) has proven to there is finger for patient's prediction chemotherapeutic efficacy of receptor positive and assessment risk of recurrence Lead meaning, and clinic is applied to by FDA (Food and Drug Adminstration) (fda) approval.
Microrna (mirna) is the upper highly conserved single-stranded rna of a class evolution, regulates and controls as a class post-transcriptional level Molecule, may play an important role in the expression imbalance of oncogene and/or antioncogene.Research shows, mirna take part in The processes such as immunosurveillance escape, infinite multiplication, the angiogenesis of tumor and neoplasm metastasis.Mirna by with target gene 3 ' utr (untranslated region) specific binding of mrna, causes Translational repression or the cutting degraded of target mrna, the table of controlling gene Reach, thus playing a significant role in the growth of cell, differentiation and apoptotic process.The therefore something lost of the 3 ' utr of the mrna of target gene The change of disease is different may to affect the regulating and controlling effect of mirna by the interaction of impact and mirna, and then affects the expression of gene, Thus it is related to the tumor prognosis of Different Individual.
The Human Genome Project (human genome project, hgp) achievement in research shows, the gene of Different Individual is all It is the same, but hereditary difference is had on dna sequence, wherein most importantly mononucleotide polymorphic (snp).Snp is pernicious swollen The effect that tumor is included in the genetic predisposition of breast carcinoma has been extensively studied, and the snp positioned at coding region may cause aminoacid sequence The change of row, thus affect the function of protein；And the snp being located at noncoding region is likely to close on turning of gene by regulation and control The function such as record, translate or shear and affect protein expression, exactly these functional snp constitute Different Individual or subgroup Tumor susceptibility and the genetic base to Radiotherapy chemotherapy Different therapeutical effect between body.Meanwhile, snp is a kind of convenient-to-running clinical inspection Mark is remembered；Therefore, if can examination to the snp related to Prognosis in Breast Cancer as prediction index, breast carcinoma individuation will be controlled Treat and produce great importance.
However, be often difficult to repeat based on the association study result of candidate gene approach in the past, and disease candidate gene or The selection of candidate region need to rely on the understanding to this target gene function, is not readily used for finding new tumor susceptibility gene or causes a disease Region.Perfect further with international Haplotype map plan, between adjacent mononucleotide is polymorphic linkage disequilibrium relation day Benefit is clear, and its result directly results in tumor geneticses research and enters the association analysiss (genome-wide in full-length genome category association study,gwas).Although gwas research brings amazing progress, spend huge, and great majority The tumor correlation snp having now found that is located at gene Desert Regions, and can only explain the sub-fraction in tumor prognosis individual variation, because This, find and disclose real " causing a disease " snp, make up " heritability of disappearance " (missing that gwas studies Heritability) particularly important to the tumor geneticses field including breast carcinoma.
With the development of high flux chip technology, the differential expression of nearly all cancer kind tumor tissues and normal structure at present Gene mapping complete, nextbio data base the most of tumors delivered expression modal data have been carried out collecting and Scoring, lists the difference intensity of gene expression, the wherein the most significant gene bag of breast carcinoma difference according to scoring height Include brca1, bach1, kras and rad51 etc., these genes have been reported in the developing mechanism of action of mammary gland carcinogenesis.As Brca1 is breast carcinoma and ovarian cancer specificity antioncogene, is first human mammary cancer susceptibility gene being identified. Brca1 is adjusting cellular processes, dna injury repairing, cell growth and the various biological such as apoptosis and transcription activating and suppression way Play a significant role in footpath.Numerous studies show that three female breast carcinoma are relevant with brca1 path.Bach1 belongs to cnc-bzip and turns A member of record inhibitive factor family, its albumen contains btb/poz domain, can be combined into heterodimer with mafk, thus pressing down The transcription of maf recognition component mediation processed.Research for many years shows, the target gene product of bach1 response to oxidative stress, Play a significant role in immunne response mechanism and cell cycle regulating.
Mirna is the important epigenetic regulation mechanism of impact gene expression, to the growth promoter of cell, apoptosis and propagation Deng generation material impact.Recent study finds, there are some features snp in mirna binding site, these polymorphic possibility By affecting the identification of mirna and target sequence, gradually change the cell function network that mirna is adjusted, and and then affect tumor Develop.Three female breast cancer relapses originate from tumor stem cell, and mirna plays important in the regulation and control to tumor stem cell Effect.In order to reduce Confounding Factor impact, improve science and the targeting of research, this research is intended collecting from the express spectra of tumor Pick out difference expression gene in data, inquire into the function sexual polymorphism of its mirna binding site work in tumor development With mechanism, and the synergy mechanism of these variations of systematic analysiss, to finding " predict " snp related to tumor prognosis, it is Three female patient with breast cancer's judging prognosis, screen high-risk risk of recurrence crowd, select individualized treatment scheme provide theoretical according to According to.
The present invention utilizes the information in multiple public databases, obtains 3 ' utr of gene of lacking of proper care in Han nationality's population breast carcinoma Snp, and with Chinese han population minimum gene frequency (minor allele frequency, maf) >=5% snp Site phase is integrated, and determines final target snp.Screen the snp site rs1054135 of fabp4 gene obtaining verified with three The relapse and metastasis of female breast carcinoma have high dependency, can be used as the effective clinical marker thing of three female breast carcinoma.This Outward, it has also been found that rs1054135 genotype can regulate and control fabp4 protein expression, thus affecting three female Prognosis in Breast Cancer. Correspondingly, fabp4 protein expression level or its combining with the snp site rs1054135 of fabp4 gene can be used for three female breasts Adenocarcinoma prognosis.
Content of the invention
Concrete technical scheme of the present invention is as follows:
In a first aspect, the invention provides the nucleic acid affinity ligand of the snp site rs1054135 of fabp4 gene is in preparation For the application in the test kit of three female Prognosis in Breast Cancer, wherein said test kit optionally includes auxiliary element, described auxiliary Composition is selected from pcr buffer, dntp, polymerase, ion, hybridization solution.
Second aspect, the invention provides for the test kit of three female Prognosis in Breast Cancer, it comprises for fabp4 gene Snp site rs1054135 nucleic acid affinity ligand, and optionally include auxiliary element, described auxiliary element is selected from pcr and buffers Liquid, dntp, polymerase, ion, hybridization solution.
In one embodiment, described nucleic acid affinity ligand is the snp site being specific to described fabp4 gene The primer of rs1054135 or probe.
In another embodiment, described primer sequence such as 5 '-acgttggatgggtttctgagatacacctac-3 ' Shown in (seq id no:22) and 5 '-acgttggatgcaaggtaaaaagggatatct-3 ' (seq id no:23).
In another embodiment, described probe have snp site rs1054135 with described fabp4 gene or its The sequence of neighbouring nucleotide complementary, sequence such as 5 '-ggatttccctaggtagga-3 ' (the seq id of preferably described probe No:234, shown in), preferably described probe is labeled.
In another embodiment, described prognosis comprises the following steps:
(1) nucleic acid from subject sample is made to contact with described nucleic acid affinity ligand；
(2) determine the genotype of rs1054135；And
(3) three female Prognosis in Breast Cancer of object are determined based on described genotype.
In another embodiment, rs1054135 is preferable for the object three female Prognosis in Breast Cancer of gg genotype, Rs1054135 is that the object three female Prognosis in Breast Cancer of aa or ag genotype is poor.
In another embodiment, the determination of the genotype of described rs1054135 is selected from following methods: direct Sequencing, Single base extension, allele-specific probe hybridization, allele-specific primerses extension, allele specific amplification, Allele-specific nucleotide incorporation, 5' nuclease digestion, molecular beacon measure, oligonucleotide connects mensure, size analysis And single strand conformation polymorphism.
In another embodiment, described sample is selected from cerebrospinal fluid, blood, serum, expectorant, saliva, mucosa scrapings, group Knit biopsy, tear secretions, seminal fluid and sweat.
The third aspect, the invention provides the binding partners of fabp4 albumen are used for three female Prognosis in Breast Cancer in preparation Test kit in application, wherein said test kit optionally includes other affinity ligands, detects dyestuff or carry out Protein Detection Other required reagent.
Fourth aspect, the invention provides for the test kit of three female Prognosis in Breast Cancer, it comprises for fabp4 albumen Binding partners, and optional include other affinity ligands, detect dyestuff or carry out other reagent needed for Protein Detection.
In one embodiment, described binding partners are the antibody being specific to described fabp4 albumen.
In another embodiment, described prognosis comprises the following steps:
(1) albumen from subject sample is made to contact with described binding partners；
(2) determine fabp4 protein expression level；And
(3) three female Prognosis in Breast Cancer of object are determined based on described fabp4 protein expression level.
In another embodiment, the relatively low object of fabp4 protein expression level three female Prognosis in Breast Cancer is preferable, The higher object of fabp4 protein expression level three female Prognosis in Breast Cancer is poor.
In another embodiment, described sample is selected from adipose cell, cerebrospinal fluid, blood, serum, expectorant, saliva, mucosa Scrapings, biopsy, tear secretions, seminal fluid and sweat.
5th aspect, the invention provides the nucleic acid affinity ligand of snp site rs1054135 of fabp4 gene and fabp4 The binding partners of albumen are used for the application in the test kit of three female Prognosis in Breast Cancer in preparation.
6th aspect, the invention provides for the test kit of three female Prognosis in Breast Cancer, it comprises for fabp4 gene The nucleic acid affinity ligand of snp site rs1054135 and for fabp4 albumen binding partners.
In one embodiment, described nucleic acid affinity ligand is the snp site being specific to described fabp4 gene The primer of rs1054135 or probe.
In another embodiment, described primer sequence such as 5 '-acgttggatgggtttctgagatacacctac-3 ' Shown in (seq id no:22) and 5 '-acgttggatgcaaggtaaaaagggatatct-3 ' (seq id no:23).
In another embodiment, described probe has the core with the snp site rs1054135 of described fabp4 gene The complementary sequence of thuja acid, sequence such as 5 '-ggatttccctaggtagga-3 ' (the seq id no:234) institute of preferably described probe Show, preferably described probe is labeled.
In another embodiment, the determination of the genotype of described rs1054135 is selected from following methods: direct Sequencing, Single base extension, allele-specific probe hybridization, allele-specific primerses extension, allele specific amplification, Allele-specific nucleotide incorporation, 5' nuclease digestion, molecular beacon measure, oligonucleotide connects mensure, size analysis And single strand conformation polymorphism.
In another embodiment, described sample is selected from cerebrospinal fluid, blood, serum, expectorant, saliva, mucosa scrapings, group Knit biopsy, tear secretions, seminal fluid and sweat.
In another embodiment, described binding partners are the antibody being specific to described fabp4 albumen.
In another embodiment, described prognosis comprises the following steps:
(1) nucleic acid from subject sample is made to contact with described nucleic acid affinity ligand；
(2) determine the genotype of rs1054135；.
(3) albumen from subject sample is made to contact with described binding partners；
(4) determine fabp4 protein expression level；And
(5) genotype based on described rs1054135 and described fabp4 protein expression level determine that three female of object are newborn Adenocarcinoma prognosis.
In another embodiment, rs1054135 is gg genotype, and the relatively low object of fabp4 protein expression level Preferably, rs1054135 is aa or ag genotype to three female Prognosis in Breast Cancer, and the higher object of fabp4 protein expression level three Female Prognosis in Breast Cancer is poor.
7th aspect, the invention provides for the method for three female Prognosis in Breast Cancer, comprising the following steps:
(1) make that the nucleic acid from subject sample is affine with the nucleic acid of the snp site rs1054135 for fabp4 gene to join Body contacts；
(2) determine the genotype of rs1054135；And
(3) three female Prognosis in Breast Cancer of object are determined based on described genotype.
In one embodiment, rs1054135 is preferable for the object three female Prognosis in Breast Cancer of gg genotype, Rs1054135 is that the object three female Prognosis in Breast Cancer of aa or ag genotype is poor.
Eighth aspect, the invention provides for the method for three female Prognosis in Breast Cancer, comprising the following steps:
(1) albumen from subject sample is made to contact with the binding partners of fabp4 albumen；
(2) determine fabp4 protein expression level；And
(3) three female Prognosis in Breast Cancer of object are determined based on described fabp4 protein expression level.
In one embodiment, the relatively low object of fabp4 protein expression level three female Prognosis in Breast Cancer is preferable, The higher object of fabp4 protein expression level three female Prognosis in Breast Cancer is poor.
9th aspect, the invention provides for the method for three female Prognosis in Breast Cancer, comprising the following steps:
(1) make that the nucleic acid from subject sample is affine with the nucleic acid of the snp site rs1054135 for fabp4 gene to join Body contacts；
(2) determine the genotype of rs1054135；.
(3) albumen from subject sample is made to contact with the binding partners of fabp4 albumen；
(4) determine fabp4 protein expression level；And
(5) genotype based on described rs1054135 and described fabp4 protein expression level determine that three female of object are newborn Adenocarcinoma prognosis.
In one embodiment, rs1054135 is gg genotype, and the relatively low object of fabp4 protein expression level three Preferably, rs1054135 is aa or ag genotype to female Prognosis in Breast Cancer, and the higher object of fabp4 protein expression level three is cloudy Type Prognosis in Breast Cancer is poor.
Tenth aspect, the invention provides the nucleic acid affinity ligand of the snp site rs1054135 for fabp4 gene, its For three female Prognosis in Breast Cancer.
11st aspect, the invention provides the binding partners of fabp4 albumen, it is used for three female Prognosis in Breast Cancer.
Research before finds, rs1047057 (tt) genotype of fgfr2 gene, the rs1054260 (tc of thsd4 gene Or tt) genotype is the protection factor that triple negative breast cancer occurs relapse and metastasis, and the rs7973450 (ga or gg) of kras gene Rs11819488 (ga the or gg) genotype of genotype and znf365 gene be triple negative breast cancer relapse and metastasis danger because Element.
The present invention adopts two separate phases analyses of more sample size, first passage discovery group and validation group sample, In combination with multiple check, have detected three female Prognosis in Breast Cancer and the mirna complementation bound site being positioned target gene 3 '-utr The dependency of the snp of point, greatly reduces the probability of false positive results.Because germline mutation is more more stable than somatic mutation, Germline mutation snp prognostic markers can provide the more reliable information of tumor metastasiss of easily swelling with regard to individuality, and is unlikely subject to swollen Heterogeneous impact in tumor.
On this basis, the first identified of the present invention snp site rs1054135 of fabp4 gene and three female breast carcinoma Risk of recurrence and DFS phase (disease free survival, dfs) related.The present invention is also found that first Two pairwise correlations between rs1054135, fabp4 expression and three female Prognosis in Breast Cancer threes, a allele energy of rs1054135 Enough raise the fabp4 expression in three female patient with breast cancers, and rs1054135 genotype and fabp4 protein expression are all cloudy with three Type Prognosis in Breast Cancer is related.Because fabp4 is the important medium of tumour growth nutrition supply, it is positioned the 3 '-utr's of fabp4 Rs1054135snp may be by post-transcriptional control fabp4 expression, the risk of recurrence of impact three female patient with breast cancers.
In addition, the immediate treatment selection that the importance of the present invention also resides in three female patient with breast cancers is less, and these Patient tends to there is more serious disease.The present invention not only confirms lipometabolic notable during three female breast cancer relapses Effect is it was found that the new snp and bmi being positioned in the 3 '-utr of fabp4 interacts, and shows and DFS phase Strong correlation.Therefore, for the patient with rs1054135-aa/ag genotype, strong preference low fat diet is intervened and body weight Management.Importantly, these results indicate that cut-out " fuel supply " may be the absence of tumor such as three female of therapeutic targets The method likely of breast carcinoma.
Brief description
Fig. 1. the relation between fabp4 snp rs1054135 and dfs in tnbc patient.By fabp4 rs1054135 The kaplan meier survival probability figure of genotype layering.A. discovery group (discovery cohort).B. validation group (validation cohort).C. overall sample.Random censorship include lost to follow-up, observe at the end of patient not yet occur recurrence turn The data moved.
Fig. 2. the kaplan meier survival probability figure being layered by bmi.A. discovery group (Hazard ratio (hazard ratio, Hr), 0.615；95% credibility interval (confidence interval, ci), 0.308 1.227).B. validation group (hr, 1.185；95%ci, 0.665 2.113).
Fig. 3. the tnbc patient bmi related to rs1054135 genotype.The bmi of different genotype patient does not have significance difference Different.A. discovery group.B. validation group.
Fig. 4 .rs1054135 is complementary to mirna and combines schematic diagram (quoted from network data base).
Fig. 5. the example of the SABC being dyeed in 400x magnitude (b) with fabp4 (a, 100x magnitude) and homologue. Iod counting is carried out using the 400x magnitude of these pictures by computer.
The scatterplot of Fig. 6 .fabp4 expression.A. carried out in the patient have different prognosis by graceful-Whitney u-test The group difference assessment of fabp4 expression.B. carried out and different rs1054135 genotype correlation by graceful-Whitney u-test The group difference assessment of fabp4 expression.
Specific embodiment
The present invention is not limited to concrete grammar as herein described, scheme, reagent etc., because these can change.This paper institute Term is only used for describing the purpose of specific embodiments rather than in order to limit the scope of the present invention.Unless otherwise defined, All technology used herein and scientific terminology are respectively provided with the identical implication being generally understood that with those skilled in the art.
Before describing the exemplary of the present invention in detail, fixed to understanding that the critically important term of the present invention provides Justice.
As used herein, " single nucleotide polymorphism " or " snp " refers to the single base positions in dna, in this single alkali The different allele of one colony or the nucleotide of replacement are existed on base location.Connect before this snp position is usual and be followed by institute State the highly conserved sequence (for example, being less than different sequences in 1/100 or 1/1000 member in population) of allele.Right In the allele in each snp position, individuality can be homozygosis or heterozygosis.The snp site of the present invention is in " rs- " mode Name, those skilled in the art can name according to rs- above, from suitable data base and related information system such as monokaryon Its definite position, nucleotide sequence is determined in nucleotide polymorphism data base (dbsnp) (it quotes addition herein).
As used herein, term " allele " refers to a series of a pair or the shape that the given locus in chromosome exist The gene of formula or non-genomic area.In normal diploid cell, there are two allele (each parents of any one gene One), it occupies identical relative position (locus) on homologous chromosome.In a colony, a kind of gene there may be More than two allele.Snps also has allele, i.e. characterize two (or more) nucleotide of described snp.
As used herein, term " minimum gene frequency " represents that the uncommon allele in given crowd is sent out Raw frequency.
As used herein, term " determining the nucleotide sequence in snp site " refers to any suitable method or technique.This Method can be mainly sequencing technologies or the technology combining based on complementary nucleic acid.Described determination nucleotide sequence can pass through example As direct Sequencing, Single base extension, allele-specific probe hybridization, allele-specific primerses extension, allele Specific amplification, allele-specific nucleotide incorporation, 5' nuclease digestion, molecular beacon mensure, oligonucleotide connect survey Calmly, size analysis, single strand conformation polymorphism, allele specific oligonucleotide (aso)-dot blot assay, iplex snp Genotyping, Dynamic allele specific hybrid (dash) genotyping, four primer arms pcr, free endonuclease Enzyme invades mensure, oligonucleotides ligase mensuration, pcr- single strand conformation polymorphism (sscp) analysis, the quantitative mensure of pcr in real time, base Analyze in the analysis of snp microarray, restriction fragment length polymorphism (rflp), targeting sequencing analysis and/or full base again Because group sequencing analysis to be carried out.
As used herein, term " the nucleic acid affinity ligand in snp site " refer to reference to snp site as defined above or The nucleic acid molecules of sequence near it.Preferably, the nucleic acid affinity ligand in described snp site can be in conjunction with fabp4 gene Rs1054135 site or its neighbouring sequence.Preferably, the nucleic acid affinity ligand in described snp site can in conjunction with 5 '- The sequence of tatctatggatttccctaggtagga [a/g] ataacaagtatgtaccattactgaa-3 ' (seq id no:1) Or its fragment, described fragment comprises snp site as defined above.In other embodiments of the present invention, the core in snp site Sour affinity ligand can also specifically combine and (comprise snp position as defined above with the sequence of seq id no:1 or its fragment Point) at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or 99.5% or 99.6%, 99.7%th, 99.8% or 99.9% identical dna sequence.
In other specific embodiments, the nucleic acid affinity ligand in described snp site can specifically be combined The short nucleic acid molecules of snp site as indicated above or its neighbouring sequence in seq id no:1, such as rna, dna, pna, can, Hna, lna or ana molecule or any other suitable nucleic acid well known by persons skilled in the art.
In other specific embodiments, described nucleic acid affinity ligand can comprise known to the skilled person any suitable The combination of function ingredients, such as label, fluorescent labeling, radioactive label, dyestuff, albumen or antibody or peptide or recognition site, can For another section of dna of pcr method, can be used as one section of dna of recognition site of Restriction Enzyme etc..Nucleic acid affinity ligand is acceptable There is provided in the form of being catalyzed rna, described catalysis rna specifically combines and cuts the sequence of the snp comprising the present invention.
The test kit of the present invention can extraly comprise detection institute other auxiliary elements required or available, for example, buffer Liquid, dntp, polymerase, ion, hybridization solution etc..The test kit of the present invention can also be included from the point of view of business and user position The material that may need, such as diluent, filler, pin, syringe；Carrier, packaging, container, list inclusions and/or use The bottle illustrating and/or pipe label, the description containing operation instruction.
In other embodiments, the invention still further relates to specifically combining in seq id no:1 as indicated above The oligonucleotide molecules of snp location proximate.These oligonucleotide can be designed as the form of pair of primers it is allowed to amplification is for example long Spend for 50bp, 75bp, 100bp, 150bp, 200bp, 250bp, 300bp, 400bp, 500bp, 750bp, 1000bp or more and Dna section including the polymorphic site of the snp of the present invention.
As used herein, " probe " refers to for detecting the complementary nucleic acid sequences in nucleic acid (" target " nucleic acid) of interest. In some test format, oligonucleotide probe is bound on solid support (passing through to be covalently attached), is fixed on solid Oligonucleotide probe array on supporter is used for detecting specific nucleotide sequence in target nucleic acid.
" probe " can derived from single-stranded or double-stranded nucleic acid that naturally occur or restructuring, or can be chemosynthesis 's.They can be used for the presence situation detecting same or analogous sequence.For implementing the nucleic probe of disclosed method Can be designed based on the gene order of protein known to coding.Those skilled in the art can use meter known in the art Calculation machine comparison method and sequence analysis method are based on known sequence and easily design such probe (such as " molecular Cloning:a laboratory manual ", the second edition, edited by sambrook, fritsch, ＆maniatis, cold spring harbor laboratory,1989；Ausubel, etc. short protocols in molecular Biology, third edition .1995).
The nucleic probe of the present invention includes rna and dna probe, and modified in sugar, phosphoric acid or even base portion Nucleic acid, as long as this probe keeps the ability of specific hybrid under conditions of being disclosed herein.Such probe is to use ability Technology known to domain and produce.
" probe " in the present invention is preferably dna fragment.In one embodiment, the probe of the present invention being capable of specificity Ground combines the snp site of the present invention.For example, described probe may be designed so that, thus it is only in conjunction with comprising snp site equipotential base Sequence because of nucleotide.For example, it is possible to passing through to change the concentration of salt in hybrid experiment, changing reaction temperature, add to reaction Other suitable compounds etc. to adjust the specificity of probe further.Thus it combines outside snp site, such as in seq id In the sequence of no:1, or its complementary series.
In other embodiments, the probe of the present invention can be Single base extension primer, its snp site with the present invention Neighbouring polynucleotide combines.By single base extension, the molecule after a base is extended according to single base sequence Amount difference judges genotype.
In other embodiments, the probe of the present invention (can be comprised as above with the sequence of seq id no:1 or its fragment The snp site of literary composition definition) and any fragment of described sequence or the complementary seriess at least 90% with these sequences, 91%, 92%th, 93%, 94%, 95%, 96%, 97%, 98% or 99% 99.5% or 99.6%, 99.7%, 99.8% or 99.9% is identical, and the sequence of wherein said seq id no:1 comprises snp site allelic nucleotide as described above.
The probe of the present invention can have any suitable length, such as 15,20,30,40,50,100,150,200, 300th, 500,1000 or the length more than 1000 nucleotide.It is preferred that length is no less than 10 nucleotide, and excellent Choosing is of length no more than about 80 nucleotide；In some embodiments, the length of probe is of about 20 to 60 nucleoside Acid；In other embodiments, the length of probe is of about 20 to 40 nucleotide.
Probe can also be suitable modification, for example, pass through to add labelling, such as fluorescent labeling, dyestuff, radioactive label etc.. , by the labelling technique of standard come the probe of the labelling present invention for example, can be put according to method known to those skilled in the art Penetrating property labelling, enzyme labelling, fluorescent labeling, biotin-avidin labelling, chemiluminescent labeling etc..After hybridization, it is possible to use The method known carrys out detection probe.
Term " binding partners " is herein used in its broadest sense, including natural and synthesis integrated structure Domain, including part and antibody or its binding fragment.Therefore, described binding partners can be a kind of antibody or its fragment (as fab, fv, single-stranded fv), a kind of peptide or a kind of peptide mimicses, peptide mimicses are a kind of molecule of similar peptide, and it can combine Described receptor, the labelling of the extracellular composition of described cell.
As used herein, term " antibody " to be used with the broadest meaning, especially covers monoclonal antibody and (includes total length Monoclonal antibody), polyclonal antibody, multi-specificity antibody (for example, bi-specific antibody) and antibody fragment.Can be by routine Method and/or genetic engineering prepare the useful antibody of the method according to the invention.For example, include combining according to the antibody of the present invention Those antibody of fabp4." antibody fragment " includes a part for full length antibody, is typically its antigen binding or variable region.Antibody The example of fragment includes fab, fab ', f (ab ') 2 and f γ fragment；Bivalent antibody；Linear antibodies；Single-chain antibody molecules；Biological special Heterogenetic antibody；And the multi-specificity antibody from antibody fragment formation.
The test kit of the present invention can also comprise other affinity ligands (such as two resist), detect dyestuff or carry out albumen inspection Survey other required reagent.This constituents and further details are well known by persons skilled in the art, and can basis The detection method that carried out and change.Described detection method can be the detection method for protein level known in the art, Such as, but not limited to western trace, SABC, immunofluorescence, elisa etc..
As used herein, term " expression is relatively low " or " expression is higher " represent with detectable lower or higher The protein of level translation.For example with there is not canceration normal fat cells as detection object, the expression of described fabp4 albumen There is significant difference between the different genotype of rs1054135, or between disease free survival group and recurrence group in level.
Such as " expression is relatively low " or " expression is higher " refer to the expression of fabp4 albumen in the sample of object Level is below or above a certain reference value, and this reference value is that those skilled in the art pass through routine techniquess means from special group, Meansigma methodss or the median with statistical significance for example obtaining in the preferable colony of triple negative breast cancer prognosis.
For example, fabp4 protein expression level of the present invention is relatively low refers to by the method measurement of SABC from right Fabp4 protein expression level in the sample of elephant is less than 0.1240 middle position iod, and fabp4 protein expression level is higher to be referred to lead to The fabp4 protein expression level crossing the method measurement of SABC is higher than 0.1240 middle position iod.
Additionally, described test kit can comprise description and/or can provide the information of the dependency of obtained result.
As used herein, term " prognosis " represents the prediction providing the process possible to three female breast carcinoma and result.It Both include judging disease specific consequence (such as rehabilitation, certain symptom, sign and complication etc. other abnormal appear or disappear and Dead), also include providing time cue, such as predict certain the time interior probability that certain final result occurs.Prognosis may include cancer Complication, transfer, the probability of diffusion, the possible result of cancer, the probability of recovery, total survival rate and/or general mortality rate. Preferably, prognosis is that patient recovers or has the recurrence/recurrent probability of cancer.Such as " prognosis is preferable " refers to that cancer is difficult to send out Raw relapse and metastasis, " prognosis is poor " refers to that cancer is more easy to relapse and metastasis.This information is useful not only for patient, for doctor The maximally effective course for the treatment of of raw determination is also useful.Determine that the probability of cancer return or the possible performance of transfer help doctor to determine whether More conservative or more radical Therapeutic Method should be taken.Prognosis is for for entering to the patient being predicted as to benefit from given therapeutic scheme Row selects and classifies.Prognosis can be additionally used in designing the appropriate therapies of three female breast cancer treatments, for example, pass through to show three female breasts Whether whether adenocarcinoma have developed to need the stage of interventional therapy to realize still in optimum stage or three female breast carcinoma.
As used herein, term " transfer " represent cancer or tumor from source organ diffuse to other organs in the patient/ Distal site.
As used herein, term " recurrence " refer to cancerous cell or symptom before through treatment and obtain the patient of cancer remission In reply.
As used herein, " sample " can be derived from any sample of any suitable part of subject's body.One In embodiment, sample can be from pure tissue or organ or cell type, such as adipose cell.Other in the present invention are real Apply in scheme, sample can derive from body fluid, for example, derive from cerebrospinal fluid, blood, serum, expectorant, saliva, mucosa scrapings, group Knit biopsy, tear secretions, seminal fluid and sweat etc..Particularly preferably adopt blood sample, it comprises the cell containing dna, for example non- The erythrocyte of maturation, erythrocyte precursor cell, leukocyte etc..The sample using in the context of the present invention should be preferably to face The acceptable mode of bed gathers, and is more preferably gathered in the way of retaining nucleic acid or albumen.In the detecting step of the present invention, finally As detection object is nucleic acid (preferably dna) or albumen.
As used herein, term " Hazard ratio " or " hr " refer to suppose that survival to time t and is directed to specific prognostic variable's value When time t event (such as apoplexy) probability.If hr is more than 1, the risk that object has event increases, if hr is little In 1, then object has the risk reduction of event.
As used herein, term " DFS phase " represents and starts to palindromia or because progression of disease is led from randomization Cause the time of death.Herein it is used in particular for pointing to year time of the death of three female breast cancer relapses or any reason Number.
For making technical scheme and advantage clearer, below in conjunction with accompanying drawing embodiment of the present invention is made into One step ground describes in detail.It should be understood that embodiment and figure should not be construed as restricted.Those skilled in the art can be clearly Envision the further modification of the principle listed herein.
Embodiment 1: object of study and clinical data
1. object of study
Cancer Hospital of Chinese Academy of Medical Sciences internal medicine is collected so far from 1998 and is just controlled breast carcinoma specimen and patient peripheral's blood Specimen, 13240, collect blood sample at present.This Research Review analyzes wherein whole three female breast cancer case (n= 430), exclusion suffer from second primary malignancy (n=4), disease free survival person's primary tumo(u)r make a definite diagnosis so far follow up time less than 3 years person (n= 80), blood sample amount deficiency person (n=23), the case finally including research amounts to 323, and by diagnosis date (2008 years January 1 is in front and back) it is divided into discovery group (n=161) and validation group (n=162).All patients are respectively provided with complete demography and clinic Pathological data.By stages according to 2002 tumor research joint committee of the U.S. (ajcc) stages for breast cancer standard (the 6th edition) carry out.
2. pathology and clinical data
All object of study all have the specimen being available for histopathology or cytodiagnosises, and swell through the Chinese Academy of Medical Sciences Tumor Hospital Pathological Department is held a consultation.Er, pr state is judged by the method for SABC, and negative standards are different before and after 2009: It was the tumor cell nuclei staining positive less than 10% before 2009；After 2009, negative standards are adjusted to less than 1%.Her-2 is cloudy The definition of property no expands for fluorescence in situ hybridization her-2 gene or immunohistochemical staining (-) or (+).As er, pr, her-2 are equal Feminine gender is defined as three female breast carcinoma.However, constantly evidence suggests, the relatively low tumor (1%-10%) of hr dyeing is being faced More similar hr negative tumours on bed pathology, rather than hr positive tumor.Therefore, there is the tumor quilt of relatively low and/or focal pr dyeing Include our research.Carry out SABC using anti-er and anti-pr antibody.In order to determine her2 state, miscellaneous by fluorescent in situ (fish) is handed over to carry out ihc or gene amplification.All patients are respectively provided with complete demography and clinical and pathological data.By stages according to 2002 Year U.S.'s tumor research joint committee (ajcc) stages for breast cancer standard (the 6th edition) is carried out.
3. follow-up of patients
All patients in the form of outpatient service or Effect of follow-up visit by telephone, the Preventive situation of itemized record patient tumors and life Deposit information.Last follow-up ended on April 1st, 2014.DFS phase (the disease free of relapse and metastasis patient Survival, dfs) computational methods are to recurrence or the image of metastasis and (or) to make a definite diagnosis a phase from primary tumo(u)r definitive pathological diagnosis.
4. patient characteristic
12 parts of samples are excluded outside the final analysis of discovery group because verification and measurement ratio is less than 90%.Discovery group and validation group Ensemble average follow up time is respectively 89.8 and 47.3 months.Table 1 illustrates the feature of study population.It is surprising that two groups Between the distribution of some Clinical symptoms have differences.But consistent, there are higher lymphatic metastasiss in recurrence group and send out Raw rate.
Feature before table 1. discovery group and validation group treatment
a. bilateral chi-square criterion
Embodiment 2. candidate gene and the selection in candidate snp site
The present invention fully integrates and utilizes existing bioinformatic database.First, using nextbio data base (www.nextbio.com), key word is " breast cancer ", filters out the gene of breast carcinoma imbalance, altogether 100, as candidate gene (being shown in Table 2).
Table 2. breast carcinoma difference expression gene and scoring
a.2013/12/16 version
- represent comprehensive existing result, can not qualitative expression be still to raise or decline completely.
Secondly, found using ensemble (http://www.ensembl.org/index.html) data base and be positioned at 3 ' utr of above-mentioned difference expression gene, the snp site possibly as mirna target gene, and in international human genome haplotype These snp sites are retrieved in the snp public database (http://hapmap.ncbi.nlm.nih.gov/) that figure plan provides, The snp (n=204) of maf >=5% in Chinese Han Population known to selection.
Finally, online database mirsnp towards the public (http://cmbi.bjmu.edu.cn/mirsnp) is used for Screening afterwards.Mirsnp is included in the set of the people snp in the mirna-mrna binding site of prediction, pre- by mirna target Method of determining and calculating miranda, has identified the snp that 414,510 impact mirna-mrna combine.The present invention only picks out known position In 3 ' utr, the snp site (n=140) that mirna-mrna combines may be affected.
When with primer needed for software (massarray typer 4.0) design gene type, exclusion is because of interference primer knot The 29 snp sites closed, remaining site carries out design of primers according to the principle beneficial to centralized detecting, the snp finally being detected Site totally 111 (being shown in Table 2).Used in the present embodiment, the non-limiting examples of probe are Single base extension primers, this area Technical staff is it is to be understood that any other is suitable for snp site is identified and the probe of gene type may be applicable to this Bright.
Table 2. candidate gene snp site and its pcr primer and Single base extension primer sequence
The correlation analysis of snp and tnbc prognosis in embodiment 3. gene type and discovery group
1. genome dna extracts
1.1 phenol-chloroform extraction methods:
A) all object of study all gather peripheric venous blood 2ml with vacuum anticoagulant blood-collecting pipe, frozen to be checked；
B) the frozen blood specimen collected is taken out and be placed in room temperature, after thawing, specimen is proceeded in clean centrifuge tube, 50,000* G is centrifuged 15min, removes supernatant, adds appropriate lysis buffer (tris-hcl, 0.1m of ph containing 10mm 8.0 to precipitation Edta, 20ug/ml pancreas rna enzyme, 0.5%sds), mix, in 37 DEG C of temperature bath 1h, plus protease k (100ug/ml) mixes latter 37 DEG C Digestion is overnight；
C) temperature bath adds the balance phenol (ph 7.4) that equal-volume is crossed through tris-hcl saturation after terminating, and fully mixes, 8000* G is centrifuged 15min；
D) draw supernatant and add equal-volume phenol: chloroform (1:1), after fully shaking mixes, 8,000*g is centrifuged 15min；
E) upper strata aqueous phase is moved in another centrifuge tube, add the ammonium acetate solution (10m) of 10% volume, add after mixing The ice-cold dehydrated alcohol of 2 times of volumes, shakes up to white flock precipitate；
F) by the dna being settled out through 75% washing with alcohol twice, it is dissolved in freezen protective in appropriate te buffer.
The quality testing of 1.2 extraction dna
Extract the dna completing and carry out quality testing using spectrophotography, gel electrophoresis.Determination sample is in 260nm/ The optical density value of 280nm, to guarantee to reach od260/280=1.8～2.0 of sequenom technical requirements；Concentration is in 10ng/ul Above standard.
2. genotype detection
2.1 methods of genotyping
In short, according to gene order, designing corresponding pcr primer and Single base extension primer sequence, using high flux Massarray time-of-flight mass spectrometry biochip system (sequenom, the U.S.) with find organize sample for analyze object, point The genotype in analysis candidate snp site, result is as shown in table 3 " allele " hurdle.Typing detection is by auspicious swallow biotechnology (north Capital) company limited assist complete.In below testing, agents useful for same unless otherwise noted, is the commercialization reagent of routine, can lead to Cross commercialization channel to buy.
2.2 genotypic assays operating procedures
2.2.1 design of primers
According to snp site by assay design 3.1 software of sequenom company, design and synthesize pcr primer and Single base extension primer sequence, primer information is shown in Table 2.
2.2.2 pcr reaction
Overall reaction system is as follows:
Pcr amplified reaction: pcr instrument is configured according to following programs:
2.2.3 sap enzymic digestion is reacted
According to following orders preparation sap enzyme mix:
Carry out sap enzymic digestion in pcr instrument:
37℃ 40min
85℃ 5min
25℃ ∞
2.2.4 single base extension
According to following orders preparation single base extension mix:
Carry out single base extension in pcr instrument:
2.2.5 go up machine testing
16 μ l tri-distilled waters will be added, 2000 leave heart 3min in centrifuge in 384 orifice plates of product；Add tree Fat, does resin purification reaction 35min, desalination on reversion well distributing rocker；2000 heart 3min is left in centrifuge after the completion of reaction. By the sample spot after desalting processing on sample target, spontaneous nucleation.
2.3 Good Laboratory control
When gene type detects, for quality control, set up parallel repeat samples hole as positive control, without dna Blank well as negative control, the fidelity factor of parallel sample analysis result is 100%.Additionally, the detection of typing operation adopts Blind is carried out, and tester cannot know that sample is the Packet State of case or comparison.
3. in discovery group snp and tnbc prognosis association analysiss
Association study is the common method in the cause of disease and prognostic study, compares prognosis by case-control study different The distribution of two groups of patient's (recurrence of disease free survival vs) genotype, filters out gene that may be related to prognosis.Last string in table 3 Different genetic models are shown, dom (dominant) represents dominant inheritance, rec (recessive) represents recessive inheritance, add (additive) represent combined mode.
If there are 2 allele in a site, have 3 kinds of genotype, such as aa, aa, aa, if regard danger as a Allele, in dominant inheritance's model, as long as there being a just to calculate frequency in genotype, and regardless of how many, is similar to qualitative, corresponding The frequency of aa, aa, aa is exactly 0,1,1；In recessive inheritance's model, only have 2 to be a in genotype and just calculate frequency, corresponding The frequency of aa, aa, aa is exactly 0,0,1.In combined mode, as long as there being 1 a just to count a frequency in genotype, corresponding aa, The frequency of aa, aa is respectively 0,1,2, is equivalent to dominant and recessive inheritance's model corresponding gene type frequency cumulative, i.e. 0+0=0, 1+0=1,1+1=2 (0,1,2).
In table 3, p value represents the statistical significance of disease free survival and genotype distribution each in patients with recurrent.Due to different something lost Pass model result difference, what table 3 result was chosen is all the minimum genetic model of p value.
In order to identify the snp with potential prognostic value, first 149 parts of samples in discovery group are tested.16 Snp is unsatisfactory for Hardy-Weinberg equilibrium (data is not shown).The association analysiss result of 111 snp and progression of disease risk are shown in table 3.Association study result shows, wherein 14 snp (rs12467225, rs712, rs7816, rs12050562, rs3748960, rs3654、rs11819488、rs10780691、rs7213430、rs3771286、rs4977544、rs7896、rs7854673、 Rs3780634 genotype) is distributed dramatically different (p < 0.05) in the patient of disease free survival and recurrence, show these snp with The recurrence of three female breast carcinoma and the correlation that shifts risk.
Relatedness between snp in table 3. difference expression gene and progression of disease risk
A. between snp and recurrence/shift risk, the hr value of relatedness and 95% credibility interval (ci) are big through age, tumor Little (≤2cm and > 2cm), lymph node involvement (no and have), histological classification, menopause situation (no and have), vascular invasion (no and Have), breast carcinoma or ovary family breast cancer (no or have), chemotherapy based on taxane/anthracycline (with or without) and radiotherapy (no and Have) etc. be corrected.
The checking associating of snp and tnbc prognosis in embodiment 4. validation group
In independent validation group, individual authentication is carried out to above-mentioned 14 snp, association study analysis method is with embodiment 3. This validation group includes 162 tnbc, wherein disease free survival 114, recurs 48.Result shows, wherein 3 snp and tnbc are multiple Send out significantly correlated (being shown in Table 4, p < 0.05), including the rs7816 of rs712 and ntrk2 of rs1054135, kras of fabp4.
Table 4.snp rs12467225, rs712, rs7816, rs12050562, rs3748960, rs3654, rs11819488、rs10780691、rs7213430、rs3771286、rs4977544、rs7896、rs7854673、 Rs3780634 and the relatedness of progression of disease risk
Between a.snp and recurrence/shift risk, the hr value of relatedness and 95% credibility interval (ci) are through age, tumor size (≤2cm and > 2cm), lymph node involvement (no and have), histological classification, menopause situation (no and have), vascular invasion (no and Have), breast carcinoma or ovary family breast cancer (no or have), chemotherapy based on taxane/anthracycline (with or without) and radiotherapy (no and Have) etc. be corrected.
A kind of fdr (false discovery rate): conventional statistical method, in order to carry out multiple check, thus drop The low false positive rate causing because of a large amount of site of disposable test.
Without the result of multiple check, false-positive probability occurs very big.In order to reduce the false positive of result, to above-mentioned Snp site carries out multiple check.Result shows, only fabp4 rs1054135 retain statistical significance (be shown in Table 4, fdr < 0.05).The g allele of rs1054135 and disease developing risk reduce related, in recessive model risk ratio for 0.14 (0.03-0.66) (it is shown in Table 5).
Relatedness (validation group) between table 5. rs1054135 genotype and tnbc risk of recurrence
A. between snp and recurrence/shift risk, the hr value of relatedness and 95% credibility interval (ci) are big through age, tumor Little (≤2cm and > 2cm), lymph node involvement (no and have), histological classification, menopause situation (no and have), vascular invasion (no and Have), breast carcinoma or ovary family breast cancer (no or have), chemotherapy based on taxane/anthracycline (with or without) and radiotherapy (no and Have) etc. be corrected.
Disease free survival (%) and recurrence (%) represent the ratio of different genotype in disease free survival group and recurrence group respectively.
Observed the analog result of relatedness between rs1054135 genotype and dfs using kaplan meier method (Fig. 1).Will subsequently find out and be analyzed it was demonstrated that having individuality and the dfs of rs1054135-gg genotype with verification setting combination Extend related, hr is 0.269 (95%ci=0.098-0.735；P=0.010).
Relation between bmi and fabp4 snp rs1054135 and dfs in embodiment 5. tnbc patient
In our study, whether in discovery group (p=0.164) or at validation group (p=0.565), bmi is not It is independent tnbc prognostic factor (Fig. 2).
We also compares the group difference of the bmi level with respect to rs1054135 genotype, find bmi with Rs1054135 genotype dependency (Fig. 3).
But in the association study of snp and prognosis using bmi as covariant when, find that there is aa/ag genotype In patient, overweight patient (bmi >=25kg/m2) tumor recurrence risk increase magnitude significantly improve (hr, 2.53；95%ci, 1.06 6.03), show that bmi has covariant effect to tnbc recurrence, in rs1054135-aa/ag subgroup, fat and high recurrence wind There is positive correlation between danger.This provides Additional evidence and shows, body fat content and fabp4 are (as lipometabolic important substrate And enzyme) synergism promotes tumor fast-growth and transfer.Therefore, the dependency between bmi and tumor prognosis may from different In crowd, the distribution of fabp4 genotype is relevant.
Dependency between embodiment 6. fabp4 expression, rs1054135 genotype and tnbc prognosis
Rs1054135 is located at the 3`utr end of target gene fabp4, and existing numerous studies show that the snp in this site may pass through The combination of impact and complementary mirna affects the expression (referring to Fig. 4) of target gene.And fabp4 is the base of differential expression in breast carcinoma Because thus it is speculated that rs1054135 genotype may be by regulating and controlling fabp4 expression, thus being conducive to neoplasm metastasis.
In order to verify this it is assumed that organizing (no diease occurrence by SABC in 52 tnbc with associated genotype data Deposit group, n=34；Recurrence group, n=18) middle its protein expression of analysis.
SABC is carried out as follows:
The immunohistochemical staining of fabp4 is carried out on formalin fix, paraffin-embedded tissue slice.Due to fabp4 Main expression in the cytosol of mature fat cell, we choose the adipose cell adjacent with tumor tissues.In short, using Microtome cuts out 4 μm of slabs, is transferred to adhesiveness slide, 15min is dried in 62 DEG C.All slides are all anti-with one (fabp4,1:100, ab92501, abcam, cambridge, uk) is incubated.Afterwards, it is incubated 1h in 37 DEG C in confining liquid. Subsequently use business-like streptavidin-biotin reagent box, the description according to manufacturer carries out immune detection, including with Biotinylated anti-Mus or the incubation of anti-rabbit immunoglobulin, the then streptavidin and 3 with peroxidase labelling, 3 '-two Aminobenzidine chromogenic substrate is incubated.Negative control omits an anti-incubation step.Finally with harris' hematoxylin to slide Redyed.
Strikingly, compared with apart from mammary gland tissue adipose cell farther out, the fat adjacent with mammary gland tissue is thin Born of the same parents assume higher fabp4 protein level (Fig. 5).
Pass through integral optical density (iod) quantitative determination further to be verified.Iod is carried out as follows:
Using moticcam4tablet (company of Mike Audi, China), from digitized SABC image Randomly select the adipocyte cell membrane adjacent with mammary gland tissue, and use imagej software (image- with intuos pen Proplus 6.0) middle its profile of select tools accurate Drawing providing.Cell membrane profile is changed into vectogram and is stored as The file of tiff form.The latter is committed to imagej algorithm, calculates the single diaphragm area of fabp4 dyeing and related iod.
Iod is as a result, it was confirmed that to have in the fatty tissue of rs1054135-aa/ag genotype fabp4 protein level notable more High (p < 0.01).Middle position iod of rs1054135-aa/ag group is 0.149, and has in the patient of rs1054135-gg genotype More than half do not express fabp4 (iod=0).The aobvious of fabp4 protein level is also been observed between disease free survival group and recurrence group Write difference (middle position iod is respectively 0.1240 and 0.1498) (Fig. 6), this is consistent with our imagination.
Statistical method
With the difference of the selected patient characteristic of chi-square criterion assessment, all p values all represent two-sided statistical detection.The holding of normal distribution Continue variable bmi to be given with meansigma methodss, between each group, difference non-paired t test is compared.Bmi between different genotype patient Group difference tested with single-factor analysis of variance.For iod, verify that distribution is special using shapiro wilk analysis Levy, and accordingly select t inspection or graceful-Whitney u-test to carry out group difference assessment.P < 0.05 is considered to have significance.Make With the survival function based on bmi and the genotype layering being ground gene for the kaplan-meier and cox method assessment.Examined using logarithm order Test the difference checking survival curve.
For single snp analysis, we test three kinds of genetic models to assess the significance of snp, and by minimum p Value selects the most suitable pattern of each snp.Represent the relatedness of snp and the relative risk ratio (hr) of relapse and metastasis and 95% confidence region Between (ci) be directed to age, tumor size (≤2cm and > 2cm), lymph node involvement (no and have), histological classification, menopause situation (no and have), chemotherapy based on taxane/anthracycline (with or without) and the factor correction such as radiotherapy (no and have).Consider to be ground The quantity of snp, assesses statistically significant using benjamini-hochberg false discovery rate (fdr) method after multiple comparisons correction Property.We are using fdr < 0.05 as having significance.Carry out Hardy-Weinberg equilibrium test.All statistical analysis all adopt Statistics software spss19.0 and graphpad prism5 are carried out.
The foregoing is only presently preferred embodiments of the present invention, not in order to limit the scope of the invention, all at this Within bright spirit and principle, any modification, equivalent substitution and improvement made etc., should be included in protection scope of the present invention Within.
List of references
1. He Jie, Zhao Ping, Chen Wanqing. China's tumour registration annual report [r] Beijing, military medicine Science Press, 2011: 68-69.
2. carey la,perou cm,livasy ca,et al.race,breast cancer subtypes,and survival in the carolina breast cancer study.jama.2006；295:2492-502.
3. telli ml,kurian aw,chang et,et al.asian ethnicity and breast cancer subtypes:a study from the california cancer registry.breast cancer res treat.2011；127:471-8.
4. sorliet,peroucm,tibshirani r,et al.gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications.proc natl acad sci usa.2001；98:10869-74.
5. perou,c.m.molecular stratification of triple-negative breast cancers.the oncologist.2010；15(suppl5):39-48.
6. ma xj,salunga r,tuggle jt,et al.gene expression profiles of human breast cancer progression.proc natl acad sci u s a.2003；100(10):5974-9.
7. hicks c,asfour r,pannuti a,et al.an integrative genomics approach to biomarker discovery in breast cancer.cancer inform.2011；10:185-204.
8. spencer c,hechter e,vukcevic d,et al.quantifying the underestimation of relative risks from genome-wide association studies.plos genet.2011；7(3):e1001337.
9. milne rl,antoniou ac.genetic modifiers of cancer risk for brca1and brca2mutation carriers.ann oncol.2011；22suppl 1:i11-7.
10. wellcome trust case control consortium.genome-wide association study of 14,000cases of seven common diseases and 3,000shared controls.nature.2007；447(7145):661-78.
11. manolio ta,brooks ld,collins fs.a hapmap harvest of insights into the genetics of common disease.j clin invest.2008；118(5):1590-605.
12. landi mt,chatterjee n,yu k,et al.a genome-wide association study of lung cancer identifies a region of chromosome 5p15 associated with risk for adenocarcinoma.am j hum genet.2009；85(5):679-91.
13. walsh t,king mc.ten genes for inherited breast cancer.cancer cell.2007；11(2):103-5.
14. pharoah p,antoniou a,berchuck a,et al.association between kras rs61764370 and triple-negative breast cancer--a false positive？lancet oncol.2011；12(8):723-4.
15. stevens kn,fredericksen z,vachon cm,et al.19p13.1 is a triple negative-specific breast cancer susceptibility locus.cancer res.2012 feb 13.
16. harusato a,naito y,takagi t,et al.suppression of indomethacin- induced apoptosis in the small intestine due to bach1 deficiency.free radic res.2011；45(6):717-27.
17. kanno h,ozawa h,dohi y,et al.genetic ablation of transcription repressor bach1 reduces neural tissue damage and improves locomotor function after spinal cord injury in mice.j neurotrauma.2009；26(1):31-9.
18. suzuki hi,yamagata k,sugimoto k,et al.modulation of microrna processing by p53.nature.2009 jul 23；460(7254):529-33.
19. bethke a,fielenbach n,wang z,et al.nuclear hormone receptor regulation of micrornas controls developmental progression.science.2009；324 (5923):95-8.
20. yu z,li z,jolicoeur n,et al.aberrant allele frequencies of the snps located in microrna target sites are potentially associated with human cancers.nucleic acids res.2007；35(13):4535-41.
21. sethupathy p,borel c,gagnebin m,et al.human microrna-155 on chromosome 21 differentially interacts with its polymorphic target in the agtr13'untranslated region:a mechanism for functional single-nucleotide polymorphisms related to phenotypes.am j hum genet.2007；81(2):405-13.
22. xiong f,wu c,chang j,et al.genetic variation in an mirna-1827 binding site in mycl1 alters susceptibility to small-cell lung cancer.cancer res.2011；71(15):5175-81.

Claims (17)

  1. The nucleic acid affinity ligand of single nucleotide polymorphism (snp) the site rs1054135 of 1.fabp4 gene is cloudy for three in preparation Application in the test kit of type Prognosis in Breast Cancer, wherein said test kit optionally includes auxiliary element, and described auxiliary element is selected from Pcr buffer, dntp, polymerase, ion, hybridization solution.
  2. 2. it is used for the test kit of three female Prognosis in Breast Cancer, it comprises the core of the snp site rs1054135 for fabp4 gene Sour affinity ligand, and optionally include auxiliary element, described auxiliary element is selected from pcr buffer, dntp, polymerase, ion, miscellaneous Hand over solution.
  3. 3. the application of claim 1 or 2 or test kit, wherein said nucleic acid affinity ligand is specific to described fabp4 gene The primer of snp site rs1054135 or probe, preferably described primer sequence such as 5 '- Acgttggatgggtttctgagatacacctac-3 ' (seq id no:22) and 5 '- Shown in acgttggatgcaaggtaaaaagggatatct-3 ' (seq id no:23)；Preferably described probe have with described The snp site rs1054135 of fabp4 gene or the sequence of its neighbouring nucleotide complementary, the sequence of more preferably described probe is such as Shown in 5 '-ggatttccctaggtagga-3 ' (seq id no:234), more preferably described probe is labeled.
  4. 4. the application of aforementioned any one claim or test kit, wherein said prognosis comprises the following steps:
    (1) nucleic acid from subject sample is made to contact with described nucleic acid affinity ligand；
    (2) determine the genotype of rs1054135；And
    (3) three female Prognosis in Breast Cancer of object are determined based on described genotype.
  5. 5. the application of claim 4 or test kit, wherein rs1054135 be gg genotype object three female Prognosis in Breast Cancer relatively Good, rs1054135 is that the object three female Prognosis in Breast Cancer of aa or ag genotype is poor.
  6. 6. the application of claim 4 or test kit, the determination of the genotype of wherein said rs1054135 is selected from following methods: straight Connect sequencing, Single base extension, allele-specific probe hybridization, allele-specific primerses extension, allele specific Property amplification, allele-specific nucleotide incorporation, 5' nuclease digestion, molecular beacon measure, oligonucleotide connect measure, big Little analysis and single strand conformation polymorphism.
  7. 7. the application of claim 4 or test kit, wherein said sample is selected from cerebrospinal fluid, blood, serum, expectorant, saliva, mucosa scrape Except thing, biopsy, tear secretions, seminal fluid and sweat.
  8. The binding partners of 8.fabp4 albumen are used for the application in the test kit of three female Prognosis in Breast Cancer, wherein institute in preparation State test kit optionally to include other affinity ligands, detect dyestuff or carry out other reagent needed for Protein Detection.
  9. 9. it is used for the test kit of three female Prognosis in Breast Cancer, it comprises the binding partners for fabp4 albumen, and optional bag Include other affinity ligands, detect dyestuff or carry out other reagent needed for Protein Detection.
  10. 10. the application of claim 8 or 9 or test kit, wherein said binding partners are to be specific to resisting of described fabp4 albumen Body.
  11. The application of 11. claim 8 or 9 or test kit, wherein said prognosis comprises the following steps:
    (1) albumen from subject sample is made to contact with described binding partners；
    (2) determine fabp4 protein expression level；And
    (3) three female Prognosis in Breast Cancer of object are determined based on described fabp4 protein expression level.
  12. The application of 12. claim 11 or test kit, the wherein relatively low object of fabp4 protein expression level three female breast carcinoma is pre- Preferable afterwards, the higher object of fabp4 protein expression level three female Prognosis in Breast Cancer is poor.
  13. The application of 13. claim 12 or test kit, wherein said sample be selected from adipose cell, cerebrospinal fluid, blood, serum, expectorant, Saliva, mucosa scrapings, biopsy, tear secretions, seminal fluid and sweat.
  14. The nucleic acid affinity ligand of snp site rs1054135 of 14.fabp4 gene and the binding partners of fabp4 albumen are in preparation For the application in the test kit of three female Prognosis in Breast Cancer.
  15. 15. test kits being used for three female Prognosis in Breast Cancer, it comprises the core of the snp site rs1054135 for fabp4 gene Sour affinity ligand and the binding partners for fabp4 albumen.
  16. The application of 16. claims 14 or 15 or test kit, wherein said prognosis comprises the following steps:
    (1) nucleic acid from subject sample is made to contact with described nucleic acid affinity ligand；
    (2) determine the genotype of rs1054135；
    (3) albumen from subject sample is made to contact with described binding partners；
    (4) determine fabp4 protein expression level；And
    (5) genotype based on described rs1054135 and described fabp4 protein expression level determine three female breast carcinoma of object Prognosis.
  17. The application of 17. claim 16 or test kit, wherein rs1054135 are gg genotype, and fabp4 protein expression level is relatively Preferably, rs1054135 is aa or ag genotype to low object three female Prognosis in Breast Cancer, and fabp4 protein expression level is higher Object three female Prognosis in Breast Cancer poor.
CN201610072847.XA 2016-02-02 2016-02-02 Correlation of SNP locus rs1054135 of FABP4 gene and triple negative breast cancer prognosis Active CN106337081B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610072847.XA CN106337081B (en) 2016-02-02 2016-02-02 Correlation of SNP locus rs1054135 of FABP4 gene and triple negative breast cancer prognosis

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610072847.XA CN106337081B (en) 2016-02-02 2016-02-02 Correlation of SNP locus rs1054135 of FABP4 gene and triple negative breast cancer prognosis

Publications (2)

Publication Number Publication Date
CN106337081A true CN106337081A (en) 2017-01-18
CN106337081B CN106337081B (en) 2020-01-21

Family

ID=57826626

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610072847.XA Active CN106337081B (en) 2016-02-02 2016-02-02 Correlation of SNP locus rs1054135 of FABP4 gene and triple negative breast cancer prognosis

Country Status (1)

Country Link
CN (1) CN106337081B (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106834491A (en) * 2017-03-03 2017-06-13 北京致成生物医学科技有限公司 Breast cancer prognosis-related gene mutation detection kit and its application method
CN106834476A (en) * 2017-02-21 2017-06-13 深圳市第二人民医院 A kind of breast cancer detection kit
CN106868128A (en) * 2017-02-21 2017-06-20 深圳市第二人民医院 The biomarker of one group of auxiliary diagnosis breast cancer and its application

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101014720A (en) * 2004-08-10 2007-08-08 加的夫大学学院咨询有限公司 Methods and kit for the prognosis of breast cancer
CN102443627A (en) * 2004-08-10 2012-05-09 加的夫生物学有限公司 Methods and kit for the prognosis of breast cancer

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101014720A (en) * 2004-08-10 2007-08-08 加的夫大学学院咨询有限公司 Methods and kit for the prognosis of breast cancer
CN102443627A (en) * 2004-08-10 2012-05-09 加的夫生物学有限公司 Methods and kit for the prognosis of breast cancer

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HARJES U等: "Fatty acid-binding peotein 4, a point of convergence for angiogenic and metabolic signaling pathways in endothelial cells", 《JOURNAL OF BIOLOGICAL CHEMISTRY》 *
王雯邈: "乳腺癌差异表达基因3′UTR遗传变异与三阴性乳腺癌预后关联研究", 《中国优秀硕士学位论文全文数据库医药卫生科技辑》 *
袁芃: "三阴性乳腺癌的预后相关SNP及大会亮点点评-袁芃教授访谈", 《HTTP://EURETINA.IONCOLOGY.COM.CN/ARTICLE/NEWSINFO.ASPX?ID=1542》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106834476A (en) * 2017-02-21 2017-06-13 深圳市第二人民医院 A kind of breast cancer detection kit
CN106868128A (en) * 2017-02-21 2017-06-20 深圳市第二人民医院 The biomarker of one group of auxiliary diagnosis breast cancer and its application
CN106834491A (en) * 2017-03-03 2017-06-13 北京致成生物医学科技有限公司 Breast cancer prognosis-related gene mutation detection kit and its application method
CN106834491B (en) * 2017-03-03 2019-10-15 北京致成生物医学科技有限公司 Breast cancer prognosis-related gene mutation detection kit and its application method

Also Published As

Publication number Publication date
CN106337081B (en) 2020-01-21

Similar Documents

Publication Publication Date Title
Nault et al. Molecular classification of hepatocellular adenoma associates with risk factors, bleeding, and malignant transformation
Hoffman et al. CLOCK in breast tumorigenesis: genetic, epigenetic, and transcriptional profiling analyses
Zhu et al. Immune gene expression profiling reveals heterogeneity in luminal breast tumors
CN106834462B (en) Application of gastric cancer genes
Wang et al. Human tumor microRNA signatures derived from large‐scale oligonucleotide microarray datasets
WO2021036620A1 (en) Application of a group of genes related to ovarian cancer prognosis
McArdle et al. Oligonucleotide microarray analysis of gene expression in neuroblastoma displaying loss of chromosome 11q
Nakka et al. Biomarker significance of plasma and tumor miR-21, miR-221, and miR-106a in osteosarcoma
Zou et al. Establishment and genomic characterizations of patient-derived esophageal squamous cell carcinoma xenograft models using biopsies for treatment optimization
Andrade et al. Gene expression profiling of lobular carcinoma in situ reveals candidate precursor genes for invasion
Yin et al. Serum/plasma microRNAs as biomarkers for HBV-related hepatocellular carcinoma in China
Lee et al. miR-106b-5p and miR-17-5p could predict recurrence and progression in breast ductal carcinoma in situ based on the transforming growth factor-beta pathway
US20110070582A1 (en) Gene Expression Profiling for Predicting the Response to Immunotherapy and/or the Survivability of Melanoma Subjects
Liu et al. rs11614913 polymorphism in miRNA-196a2 and cancer risk: an updated meta-analysis
Saleh et al. Comparative analysis of triple-negative breast cancer transcriptomics of Kenyan, African American and Caucasian Women
CN106337081A (en) Correlation of SNP site rs1054135 of FABP4 gene with triple-negative breast cancer prognosis
CN104152556A (en) Kit for judging adjunctive therapeutic effects of trastuzumab on breast cancer and application
CN107254546B (en) SNP marker related to breast cancer neoadjuvant chemotherapy curative effect and application thereof
Zatkova et al. AML/MDS with 11q/MLL amplification show characteristic gene expression signature and interplay of DNA copy number changes
Hedayat et al. Evaluating melanocytic lesions with single nucleotide polymorphism (SNP) chromosomal microarray
Liu et al. MicroRNA-223-5p targets long non-coding RNA TP73 antisense RNA1 to promote the invasion of gastric cancer
Li et al. Genetic polymorphisms of PRNCR1 and lung cancer risk in Chinese Northeast population: A case–control study and meta-analysis
Mirabbasi et al. Novel polymorphism rs12402181 in the mature sequence of hsa-miR-3117-3p has a protective effect against breast cancer development by affecting miRNA processing and function
Wu et al. Elevation of miR-191-5p level and its potential signaling pathways in hepatocellular carcinoma: a study validated by microarray and in-house qRT-PCR with 1,291 clinical samples
CN106498062A (en) A kind of product of diagnosis of prostate cancer and its application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant