CN106324259A - Prokineticin 2 as biomarker for psoriasis and its use - Google Patents
Prokineticin 2 as biomarker for psoriasis and its use Download PDFInfo
- Publication number
- CN106324259A CN106324259A CN201610804908.7A CN201610804908A CN106324259A CN 106324259 A CN106324259 A CN 106324259A CN 201610804908 A CN201610804908 A CN 201610804908A CN 106324259 A CN106324259 A CN 106324259A
- Authority
- CN
- China
- Prior art keywords
- psoriasis
- biomarker
- skin
- wound healing
- psoriatic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/20—Dermatological disorders
- G01N2800/205—Scaling palpular diseases, e.g. psoriasis, pytiriasis
Abstract
The invention relates to an endogenous regulatory peptide prokineticin 2 (PK2) as a biomarker for psoriasis and its use, and belongs to the field of medical molecular biology. The inventor found that PK2 has a new biological function that promotes wound healing and psoriasis by detecting the expression of PK2 in the blood and skin of psoriasis as a biomarker for detecting the occurrence or development of psoriasis. The invention also relates to the use of PK2 in the treatment or detection of psoriasis and its use in wound healing. The invention has found that PK2 has the function of promoting the occurrence of psoriasis and can detect the occurrence or development of psoriasis by detecting the expression of PK2 in skin and blood of psoriasis. PK2 can be used as the specificity biomarker of the occurrence or development of psoriasis; PK2 as a target has a very good effect on the treatment of psoriasis, and the treatment of psoriasis provides a new target. In addition, the invention also relates to the activity of PK2 to promote wound healing and to provide a new drug template for wound healing.
Description
Technical field:
The present invention relates to a kind of Prokineticin2 (being called for short PK2) as psoriasis biomarker and application thereof, specifically
It is that endogenic regulation peptide prokineticin2 (being called for short PK2), as psoriasis biomarker and application thereof, belongs to medical science and divides
Sub-biology techniques field.
Background technology:
At dermatological field, psoriasis (psoriasis) is a kind of common with erythema, and squama is main performance,
For common chronic recurrent complex disease, by World Health Organization (WHO) be classified as the big pertinacious disease in 20th century human skin disease field two it
One, primary disease sickness rate is up to 2% in white people, and in Chinese population is 0.123%, and the domestic individuality that there are about 5,000,000 is suffered from
Suffer from, and to have a net increase of the speed increase of 100,000 cases every year.This disease of psoriasis is commonly called as " psoriasis ", and easily recurrence difficulty is effected a radical cure and delays
Do not heal, and joint damage easily occurs in patient, causes the dyskinesia.Psoriatic is generally subject to discrimination in various degree,
Its quality of life is worse than other chronics, has investigation to show, the quality of life of psoriasis people is only above presses down
Strongly fragrant disease patient[1].The more important thing is, psoriatic subjects pain, pruritus, the most hemorrhage etc. physical stress.But, by
Unclear in the psoriatic cause of disease, what its Clinical heterogeneity and significantly polygenic inheritance mode showed factors combines work
Develop with participating in it, mainly have inherited genetic factors, infection, medicine, fatigue and immune factor etc.[2].Psoriasis
Specific biomarker is the most significant to the elaboration of psoriatic diagnosis, treatment and pathomechanism[2].Tradition is found
Psoriasis biomarker be from the blood or blood plasma of psoriasis people find expression raise some factors, cell or
Medium.Biomarker as psoriasis candidate is a lot, but not disclosure satisfy that the most effective, sensitive and special at present
Require it is thus possible to be transformed into the biomarker of clinical practice[2]。
Onset of psoriasis complicated mechanism, fails to understand so far.Generally acknowledge that this sick correlative factor is more, such as heredity, infection, spirit at present
Factor, endocrine factors, dysbolismus, immunologic function disorder etc..Wherein, dysimmunity has gained public acceptance is psoriatic heavy
Want factor.In the dermal pathology section of typical psoriatic visible, horn cell hyperplasia, downward (the most basad carefully
Born of the same parents' layer) grow and form " pestle shape " and highlight；The horn cell of multiple-layer overlapped is upwards formed at epidermis position, due to parakeratosis,
Containing nucleus in these epidermis cell, the neutrophil infiltration have between horn cell significantly, being dispersed in, formed " micro-
Pus infections ".Therefore, at least following two factor in psoriatic pathology: inflammation/immunocyte；Horn cell hyperplasia is also
Parakeratosis.
Inflammation/the immunocyte found at psoriatic lesion position at present has mononuclear phagocyte, Langerhan's cells, tree
Prominent the T cell subgroup such as shape cell, Th1, Th17/Th22 cell and neutrophilic granulocyte etc..Inflammatory factor mediation related to this
The generation of psoriatic lesion.Have now been found that relevant important inflammatory factor has TNF-a, IL-17, IL-22/IL-23 etc..And
And the cytokine profiles of immunocyte secretion participates in psoriatic pathological process, as IL-1, IL-2, IL-8, IFN-γ etc. can
Stimulating the hypertrophy of keratinocyte, VEGF, Endothelin etc. participate in expansion and the propagation of dermal capillary.
PK2 is the peptide molecule of a kind of secreting type[3,4], be present in human body and animal tissue has several functions
Secretory protein, they participate in the various activities of body many tissues, including: gastrointestinal smooth muscle shrinks；Promote ovary and testis
The angiogenesis of ball；Endotheli ocytosis, migration and the break-through in induction adrenal cortex source；Congenital as Survival Factor regulation
And acquired immune system, including growth, existence and the function of hematopoietic stem cell and lymphocyte etc.；Neuronal survival；Pain
Feel.It addition, it has been also reported that: PK2 has blood vessel hyperplasia, promotes the functions such as inflammation generation[5], and blood vessel hyperplasia and inflammation
It is important two pathological characters of psoriasis.Psoriasis and wound healing have a lot of common ground and dependency.Such as, blood vessel hyperplasia
And epidermal cell proliferation；Psoriasis can increase wound healing rate to also have document to show, but its increase healing rate affect machine
Make the most unclear.And the contact between PK2, IL-1 is how, with psoriatic generation and development relationship how, by literature search,
Have no the open report identical with the present invention.
List of references:
1.Boehncke,W.H.and S.Boehncke,More than skin-deep:the many dimensions
of the psoriatic disease.Swiss Med Wkly,2014.144:p.w13968.
2.Di Meglio,P.,F.Villanova,and F.O.Nestle,Psoriasis.Cold Spring Harb
Perspect Med,2014.4(8).
3.Negri,L.,et al.,Nociceptive sensitization by the secretory protein
Bv8.Br J Pharmacol,2002.137(8):p.1147-54.
4.Negri,L.,et al.,Bv8/Prokineticin proteins and their receptors.Life
Sci,2007.81(14):p.1103-16.
5.Negri,L.,et al.,Biological activities of Bv8analogues.Br J
Pharmacol,2005.146(5):p.625-32.
Summary of the invention:
In view of the defect of prior art, an object of the present invention is to provide a kind of relevant with monitoring to psoriasis prediction
Specific biomarker PK2.
Further, mainly by the expression of the biomarker PK2 described in detection psoriasis human blood and skin
Predict
Or monitoring psoriasis.
The two of the purpose of the present invention are to provide specific biomarker PK2 use in psoriasis detection or treatment
On the way.
Further, specific biomarker PK2 treats psoriasis as drug targets/or therapeutic targets in preparation
Application in terms of medicine.
The three of the purpose of the present invention are to provide the PK2 application at the related drugs preparing wound healing effect.
Prokineticin 2 of the present invention is as detecting psoriatic biomarker, it is characterised in that described biology
Label is endogenic regulation peptide prokineticin2 (PK2).
Expression by the biomarker PK2 described in detection psoriasis human blood and skin.
Biomarker PK2 purposes in psoriasis detection or treatment.
Described biomarker PK2 purposes in psoriasis detection or treatment, it is characterised in that: described biological mark
Note thing PK2 as drug targets and/or therapeutic targets in terms of preparation detects psoriatic reagent or treatment psoriasis
Purposes.
Biomarker PK2 purposes in treatment wound healing medicine.
Inventor finds that PK2 has the new biological function promoting that wound healing and psoriasis occur, can be by inspection
Survey expressing of PK2 in psoriasis human blood and skin to occur or the biomarker of development as detection psoriasis.
In one embodiment of the invention, inventor is confirmed by research: by DASELISA immunological technique
(ELISA) detection, in psoriasis human blood, the concentration of PK2 is about 6.5 times of Healthy People, and the PK2 concentration in skin is about health
13 times of people.During high performance liquid chromatography (HPLC) analyzes psoriasis application on human skin simultaneously, the content of PK2 is also significantly larger than Healthy People,
The analysis result of IHC also indicates that the expression of PK2 Healthy People to be significantly larger than in psoriasis application on human skin.So PK2 is psoriasis people
Blood and skin in be up-regulated.
Another embodiment 4 applies Animal Models of Psoriasis K14-VEGF transgenic mice, PK2 is carried out process LAN or strikes
Fall, and the psoriasis symptom of mouse model is analyzed.Test result indicate that in embodiment 4, PK2 process LAN can significantly increase the weight of
Psoriasis disease, and strike the expression of fall PK2, then can slow down psoriatic Development process.Horn cell and macrophages secrete IL-
1, IL-1 mono-aspect of secretion can act on fibroblast induced fibroblast secrete cytokines and promote into fiber finer
Born of the same parents and the differentiation and proliferation of horn cell, on the other hand can promote the secretion of PK2, forms vicious cycle and maintains psoriatic holding
Supervention is raw.
By Chick chorioallantoic membrane assay, embodiment 5 also demonstrate that PK2 can promote angiogenesis, and make blood vessel be distorted
Thus increase the weight of psoriatic disease.
Therefore, in psoriasis human blood and dermatological specimens, the content Healthy People to be significantly larger than of PK2.Another in the present invention
In an outer embodiment, inventor finds the silver bits of the mice psoriasis model in imiquimod induction and K14-VEGF transgenic
In sick mouse skin, the expression of PK2 is also high than normal mouse.And self exempt from other detected with psoriasis human blood simultaneously
Epidemic disease disease, as in Crohn disease, ulcerative colitis, atherosclerosis and type i diabetes patient blood, PK2 does not has
Express and raise, and related experiment proves that PK2 can promote psoriatic generation, it is possible to by detection patient blood
Psoriasis is detected by the concentration of PK2.
Visible, PK2 can be as the specific biomarker of psoriasis.In K14-VEGF transgene mouse model, strike
Fall PK2 can alleviate psoriatic disease, so PK2 is also used as psoriatic therapeutic targets, by neutralizing the effect of PK2
Or the expression reducing PK2 slows down psoriatic disease, prompting PK2 can be as the crucial target of curing psoriasis.Further, since
Wound healing and psoriasis have a lot of similarity, the embodiment of the present invention 6 to show: PK2 can also promote mice wound healing.
In to psoriatic research process, additionally find that PK2 can also remarkably promote wound healing.
Present invention firstly discovers that PK2 has the function promoting that psoriasis occurs, and by detection psoriasis application on human skin and blood
The expression of the PK2 in liquid, can detect psoriatic generation or development, and therefore, P2 can occur as psoriasis or the spy of development
The biomarker of the opposite sex；PK2 had good effect as target to psoriatic treatment, to psoriatic treatment simultaneously
Provide new target.Moreover, it relates to PK2 can conglutinant activity, provide new medicine for wound healing
Thing template.
Accompanying drawing illustrates:
Fig. 1 represents: PK2 content in HPLC method detection Healthy People skin；
Fig. 2 represents: PK2 content in HPLC method detection psoriasis patients skin；
Fig. 3 represents: by molecular weight, Mass Spectrometric Identification judges that peak shown in arrow is PK2；
Fig. 4 represents: the expression contrast of PK2 in IHC detection normal human skin and psoriasis application on human skin；
Fig. 5 represents: PK2 content balance in IHC detection normal human skin and psoriasis application on human skin；
Fig. 6 represents that ELISA method detects PK2 content balance in Healthy People and psoriasis application on human skin；
Fig. 7 represent ELISA method detection PK2 normal person and other autoimmune diseasees (CD, UC, AS,
Diabetes) content balance in blood；
Fig. 8 shows that the mice psoriasis model of western blot method detection imiquimod induction and K14-VEGF turn base
Because of the expression of PK2 and the comparison of normal mouse in psoriasis mouse model skin.**p<0.01.
Fig. 9-15 shows PK2 process LAN and strikes the fall impact on K14-VEGF transgenic mice psoriasis index.Wherein C:
Control, NaCl (0.9%) solution；S:sh-PK2,retrovirus of psh-PK2(knock-down of
PK2)；NS:negative control of sh-PK2；P:PLVX-PK2,the lentivirus of PK2-PLVX-puro
(overexpression of PK2)；NP:negative control of PLVX-PK2,the lentivirus of
empty PLVX-puro.
Fig. 9 represents the microphotograph of mouse ear redness；
Figure 10 represents the quantitative of mouse ear redness；
Figure 11 represents mouse ear swelling；
Figure 12 represents that mouse ear swelling is quantitative；
Figure 13 represents mouse ear weight；
Figure 14 represents mouse ear thickness；
Figure 15 represents mouse lymph nodes weight；
Figure 16-18 display PK2 and the positive control EGF effect to wound healing；
Figure 16 represents postoperative 1,3,5,7th day wound healing figure；
Figure 17 represents the dynamic curve figure that the 1st, 3,5,7 day PK2 process group wound surface reduces；
Figure 18 represents the dynamic curve figure that the 1st, 3,5,7 day EGF process group wound surface reduces.
Detailed description of the invention:
Elaborating the present invention below in conjunction with the accompanying drawings, the effect of embodiment only illustrates rather than the restriction present invention.
Fig. 1-Fig. 7 shows the ratio of PK2 content in the psoriasis people of different detection method detection and Healthy People skin and blood
Relatively.Wherein, the psoriasis people of display different detection method detection and the comparison of PK2 content in Healthy People skin and blood,
Embodiment 1: PK2 content detection contrast in psoriasis people and healthy human blood and skin
The enzyme-linked immunosorbent assay for measuring (ELISA) being detected as routine of PK2 in blood, test kit is purchased from
cusabio.com.Concrete steps operate to specifications.In skin, the detection of PK2 uses reverse phase HPLC chromatograph
(RP-HPLC), immunohistochemistry (IHC), tri-kinds of methods of ELISA.Before carrying out RP-HPLC and ELISA, by quantitative skin
Skin tissue is homogenized, and detects after carrying out protein quantification.
As shown in figs. 1-7, Fig. 1 represents: PK2 content in HPLC method detection Healthy People skin；Fig. 2 represents: HPLC method detects
PK2 content in psoriasis patients skin；Fig. 3 represents: by molecular weight, Mass Spectrometric Identification judges that peak shown in arrow is PK2；Fig. 4 table
Show: the expression contrast of PK2 in IHC detection normal human skin and psoriasis application on human skin；Fig. 5 represents: IHC detection normal human skin and
PK2 content balance in psoriasis application on human skin；Fig. 6 represents that ELISA method detects PK2 content pair in Healthy People and psoriasis application on human skin
Ratio；Fig. 7 represents that ELISA method detection PK2 is at normal person and other autoimmune diseasees (CD, UC, AS, diabetes) blood
Content balance in liquid.Result shows:
Shown by research: detected by DASELISA immunological technique (ELISA), PK2 in psoriasis human blood
Concentration be about 6.5 times of Healthy People, the PK2 concentration in skin is about 13 times of Healthy People.PK2 psoriasis people skin and
Expression in blood is all higher than Healthy People, but in other autoimmune diseasees (CD, UC, AS, diabetes) blood not
There is significant change (p < 0.01), so, PK2 is probably psoriasis specific index.
Embodiment 2: psoriasis mice and PK2 detection in normal mouse skin
Take imiquimod inducing mouse psoriasis model skin homogenate and K14-VEGF transgenic psoriasis mouse model
Skin homogenate and normal mouse skin homogenate, carry out the western blot of PK2.
Result as shown in Figure 8, imiquimod induction psoriasis mice skin and K14-VEGF transgenic psoriasis mice
PK2 in model skin expresses apparently higher than normal mouse skin (p < 0.01), and result shows high performance liquid chromatography (HPLC)
Analyzing the content of PK2 in psoriasis application on human skin and be also significantly larger than Healthy People, the analysis result of IHC also indicates that in psoriasis application on human skin
The expression Healthy People to be significantly larger than of PK2, so PK2 is up-regulated in the blood and skin of psoriasis people.
Embodiment 3:PK2 process LAN slow virus drops retroviral structure with striking
Slow virus carrier builds: mice PK2 genes of interest is double through EcoRI and BamHI with PLVX-puro slow virus carrier
After enzyme action, PK2 is connected to PLVX-puro carrier.
Retroviral Vector builds: according to Cheng, M.Y.et al document, and design is effectively for the siRNA sequence of mice PK2
Row, chemosynthesis corresponding oligonucleotide sequence CATAAGGATCTGCACACC
TATCTCGAGATAGGTGTGCAGATCCTTATGTTTT, and synthesize the unordered sequence AGTACTGCTTACG of above-mentioned sequence
ATACGGTTCAAGCGACCGTATCGTATTAGCAGTACTTTT is as control sequence.And be connected to use by the sequence of synthesis
The RNAi-Ready pSIREN-RetroQ retroviral vector that BamHI and EcoRI enzyme action is good, constitute psh-PK2 or
psh-Scr。
Slow virus is packed: slow virus carrier PLVX-PK2 and its helper plasmid pMDlg/PRRE, the Prsv-that will build
REV and pMD2.G Fugene 6 (Promega, the U.S.) cotransfection 293T cell.The packaging slow disease without genes of interest simultaneously
Poison is as comparison.
Retrovirus is packed: the retroviral vector psh-PK2 xfect polymer that will build
(Clontech, the U.S.) transfection EcoPackTM2-293 cell.Packaging psh-Scr retrovirus compares simultaneously.Concrete bag
Dress step is as follows:
(1) 24h before transfection, adjustment cell density is 6 × 105 cells/ml, is re-seeded into the Tissue Culture Flask of T175
In, 37 DEG C.Can be used for transfecting when cell density reaches 70%～80%.Before transfection, cell culture medium is replaced by serum-free by 2h
Culture medium.
(2) prepared each DNA solution is pressed transfection reagent description and transfection reagent cotransfection corresponding package cell.
(3) culture medium containing transfection mixture, every bottle of cell is gone to add PBS liquid, gently double swerve after cultivating 8h
Once culture bottle is with the transfection mixture of washing remnants, then goes.
(4) every bottle of cell adds containing the new cell culture medium of 10% serum, in 37 DEG C, continue in 5%CO2 incubator
Cultivate 48 hours.
The results of virus and concentration: collect the cell supernatant of latter 48 hours of transfection (transfection can be to count for 0 hour), can
Adding fresh culture to continue to cultivate 24 hours, collect and merge supernatant, in 4 DEG C, 4000g is centrifuged 10min, removes cell debris.
Collect supernatant, centrifugal 2.5 hours of supercentrifuge P28S rotary head 25000rpm 4 DEG C.After centrifugal end, remove supernatant, collecting pipe
End virus also carries out titer determination.
Embodiment 4:PK2 process LAN and strike the fall impact on mice psoriasis index in K14-VEGF transgenic mice
Virus in embodiment 3 is injected in Mice Body, it is achieved the process LAN of PK2 and strike fall to detect PK2 at K14-
Process LAN and strike the fall impact on mice psoriasis index in VEGF transgenic mice.
The impact analysis expressing PK2: 10,20,30 days mouse skins before drawing medicine respectively and after administration, IHC analyzes
The expression of PK2, takes mouse blood elisa assay PK2 and expresses.
The psoriasis index of 10,20,30 days analysis mices before drawing medicine respectively and after administration, K14-VEGF transgenic is little
Mus psoriasis symptom is mainly reflected on mouse ear, including mouse ear redness, and swelling, weight, thickness, and lymph node
Weight then reflects inflammatory conditions.
As shown in Fig. 9-15, PK2 process LAN can significantly increase the weight of psoriatic above-mentioned symptom, illustrates that PK2 can increase the weight of silver
The state of an illness that bits are sick, suppresses PK2 can alleviate psoriatic above-mentioned symptom and the most more illustrates that PK2 rises in psoriasis generating process
To facilitation, PK2 can be as treating a psoriatic target.
Embodiment 5: Chick chorioallantoic membrane assay
Choose instar chicken embryo on the 6th, 70% alcohol wipe sterilization eggshell surface, eggshell is opened the side of a size about 1cm × 1cm
Shape skylight, carefully raises following shell membrane, after exposing chick chorioallantoic membrane, with the little filter through sterilizing with the tweezers of sterilization
The scraps of paper or medical gelatin sponge are carefully attached on chorioallantoic membrane as carrier, then are added on carrier by the sample drop of variable concentrations,
After sealing skylight with sterilizing medical proof fabric, after being placed on 37 DEG C of biochemical cultivation cases continuation cultivations 3 days, in dissecting Microscopic observation Embryo Gallus domesticus blood
The situation that pipe generates.Result shows, PK2 can promote angiogenesis and can cause buckling of vessel, this symptom and psoriasis
The symptom increased the weight of is closely similar.
The effect to wound healing of embodiment 6:PK2
With 1% Nembutal sodium solution intraperitoneal injection of anesthesia mice, reject its back hair by electric clippers, through alcohol disinfecting
After, open, in its back lateral symmetry, the circular wound surface that two diameters are about 8mm.While as comparison, another side is administered or sun
Property comparison.Wherein comparison is the NaCl solution of 0.9%, and administration group is 100 μ g/ml PK2 10 μ l, and positive control is 100 μ g/
Ml Mus source EGF recombiant protein 10 μ l, is taken twice daily, and every other day by camera shooting record wound surface situation of change, and surveys with ruler
Amount wound surface, record wound surface change.Being set to 100% by starting the face wound surface of the 1st day, the wound surface area of postoperative 3rd, 5,7 day is with just
Start and obtain percent value after face compares on the 1st day and plot broken line graph.
The PK2 effect to wound healing, as shown in figs. 16-18, compared with matched group, PK2 can be obviously promoted mice whole bark
Layer wound healing, and particularly evident in wound healing (wound healing the 3rd day) effect in early days.The effect of the 3rd day than the positive
The effect of comparison EGF also to highlight.The matched group ground wound area of 3,5 and 7 days accounts for the ratio of first day wound area and is respectively
77.8, it is 42.8,21.6 and 7.6% that 44.6 and 32.1%, PK2 process group is worth accordingly, and EGF positive controls is respectively
77,20.8 and 9.8%.
Therefore, mainly wound healing there is remarkable effect in early days with PK2.
Claims (5)
1. a Prokineticin 2 is as detecting psoriatic biomarker, it is characterised in that described biomarker
Thing is endogenic regulation peptide prokineticin2 (PK2).
Prokineticin 2 the most according to claim 1 is as detecting psoriatic biomarker, it is characterised in that:
Expression by the biomarker PK2 described in detection psoriasis human blood and skin.
3. the biomarker Prokineticin 2 (PK2) purposes in psoriasis detection or treatment.
Biomarker Prokineticin 2 (PK2) the most according to claim 3 is in psoriasis detection or treatment
Purposes, it is characterised in that: described biomarker PK2 detects psoriasis as drug targets and/or therapeutic targets in preparation
Reagent or treatment psoriasis in terms of purposes.
5. the biomarker Prokineticin 2 (PK2) purposes in treatment wound healing medicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610804908.7A CN106324259B (en) | 2016-09-06 | 2016-09-06 | New application of 2 reagent of Prokineticin in terms of psoriasis detection is with treatment |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610804908.7A CN106324259B (en) | 2016-09-06 | 2016-09-06 | New application of 2 reagent of Prokineticin in terms of psoriasis detection is with treatment |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106324259A true CN106324259A (en) | 2017-01-11 |
| CN106324259B CN106324259B (en) | 2019-06-04 |
Family
ID=57787444
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610804908.7A Active CN106324259B (en) | 2016-09-06 | 2016-09-06 | New application of 2 reagent of Prokineticin in terms of psoriasis detection is with treatment |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106324259B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110075278A (en) * | 2018-06-27 | 2019-08-02 | 中国人民解放军南京军区福州总医院 | Liraglutide merges the application in curing psoriasis drug in curing psoriasis drug and in diabetes B |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005023231A1 (en) * | 2003-09-10 | 2005-03-17 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Polypyrimidine tract binding protein promotes insulin secretory granule biogenesis |
| CN1802169A (en) * | 2003-03-12 | 2006-07-12 | 健泰科生物技术公司 | Use of bv8 and/or EG-VEGF to promote hematopoiesis |
-
2016
- 2016-09-06 CN CN201610804908.7A patent/CN106324259B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1802169A (en) * | 2003-03-12 | 2006-07-12 | 健泰科生物技术公司 | Use of bv8 and/or EG-VEGF to promote hematopoiesis |
| WO2005023231A1 (en) * | 2003-09-10 | 2005-03-17 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Polypyrimidine tract binding protein promotes insulin secretory granule biogenesis |
Non-Patent Citations (4)
| Title |
|---|
| LUCIA NEGRI ET AL: "Bv8, the amphibian homologue of the mammalian prokineticins, modulates ingestive behaviour in rats", 《BRITISH JOURNAL OF PHARMACOLOGY》 * |
| M. LI ET AL: "Identification of Two Prokineticin cDNAs_ Recombinant Proteins Potently Contract Gastrointestinal Smooth Muscle", 《MOLECULAR PHARMACOLOGY》 * |
| XIAOQIN HE ET AL: "Prokineticin 2 Plays a Pivotal Role in Psoriasis", 《EBIOMEDICINE》 * |
| 容明强: "利用活性多肽为分子探针研究银屑病分子机制取得重要进展", 《中国科学院昆明动物研究所官网》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110075278A (en) * | 2018-06-27 | 2019-08-02 | 中国人民解放军南京军区福州总医院 | Liraglutide merges the application in curing psoriasis drug in curing psoriasis drug and in diabetes B |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106324259B (en) | 2019-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Altuntas et al. | Autoimmunity to uroplakin II causes cystitis in mice: a novel model of interstitial cystitis | |
| Yu et al. | Kinetic alterations of collagen and elastic fibres and their association with cardiac function in acute myocardial infarction | |
| CN105980408A (en) | Therapeutic methods and compositions | |
| CN107149679A (en) | The aP2 and its suppressing method of secretion | |
| CN110426523A (en) | Purposes of the AIM as biomarker in diagnosis, prognosis and Treatment monitoring rheumatoid arthritis | |
| CN102023218A (en) | Serum maker of HBV (hepatitis B virus) infestor and application thereof | |
| CN107216373A (en) | Detect antigen polypeptide pond and its application of mycobacterium tuberculosis infection | |
| CN104829690B (en) | It is a kind of that there is the peptide of the bursa of farbricius 11 for promoting immunologic function | |
| Zhang et al. | Circulating PD-1hiCXCR5+ CD4+ T cells are associated with a decrease in hepatitis B surface antigen levels in patients with chronic hepatitis B who are receiving peginterferon-α therapy | |
| Erdmann et al. | Lack of functional TSLP receptors mitigates Th2 polarization and the establishment and growth of 4T1 primary breast tumours but has different effects on tumour quantities in the lung and brain | |
| Piccoli et al. | Serum cytokine profile by ELISA in patients with echinococcal cysts of the liver: a stage-specific approach to assess their biological activity | |
| CN113584173B (en) | Application of lncRNA SLC25A21-AS1 AS esophageal squamous cell carcinoma marker | |
| Filippone et al. | Potent CCR3 receptor antagonist, SB328437, suppresses colonic eosinophil chemotaxis and inflammation in the winnie murine model of spontaneous chronic colitis | |
| CN105388300B (en) | Tuberculosis immunodiagnosis molecular marker and vaccine use thereof | |
| CN110338139A (en) | A kind of construction method of gout animal model and application | |
| CN106324259A (en) | Prokineticin 2 as biomarker for psoriasis and its use | |
| Shu et al. | IL-8 triggers neutrophil extracellular trap formation through an nicotinamide adenine dinucleotide phosphate oxidase-and mitogen-activated protein kinase pathway-dependent mechanism in uveitis | |
| CN102901826A (en) | New potential human cytokine TMEM98 and uses thereof | |
| CN102755633B (en) | Application of human recombinant protein PDCD5 to treatment of autoimmune disease | |
| Packi et al. | Food allergies and parasites in children | |
| CN115584345A (en) | Method for determining tumor electric field treatment parameters | |
| CN108324947A (en) | The application of TNF receptor associated factor (TRAF) 4 and its inhibitor in preparing treatment fatty liver and relevant disease drug | |
| Guo et al. | A new biomarkers feature pattern consisting of TNF-α, IL-10, and IL-8 for blood stasis syndrome with myocardial ischemia | |
| Feliz-Norberto et al. | Neutrophil reverse migration from liver fuels neutrophilic inflammation to tissue injury in Nonalcoholic Steatohepatitis | |
| Xu et al. | Tuberous Sclerosis Complex 1 Deficiency in Macrophages Promotes Unclassical Inflammatory Response to Lipopolysaccharide In Vitro and Dextran Sodium Sulfate-Induced Colitis in Mice |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |