CN106319039A - Method for fast detection of lily bulb rot pathogen fusarium oxysporum - Google Patents
Method for fast detection of lily bulb rot pathogen fusarium oxysporum Download PDFInfo
- Publication number
- CN106319039A CN106319039A CN201511017538.4A CN201511017538A CN106319039A CN 106319039 A CN106319039 A CN 106319039A CN 201511017538 A CN201511017538 A CN 201511017538A CN 106319039 A CN106319039 A CN 106319039A
- Authority
- CN
- China
- Prior art keywords
- lilii
- fusarium oxysporum
- lily
- fusarium
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for fast detection of lily bulb rot pathogen fusarium oxysporum based on a DNA molecule detection technology. The invention relates to specific primers for lily fusarium oxysporum amplification. The method solves the problem that the existing method needs separation and purification of pathogens from bulbs suffering from rot, realizes identification of pathogen types through primer amplification, sequencing and comparison after DNA extraction and cannot realize identification of lily fusarium oxysporum through the existing general primers directly based on an amplification result. The specific primer pair for lily fusarium oxysporum amplification is named as FO-lilii F/FO-lilii R. The primers realize fast and accurate amplification of a desired fragment of the lily bulb rot pathogen fusarium oxysporum.
Description
Technical field
The present invention relates to a pair specific primer for quickly detection Bulbus Lilii Fusarium oxysporum, belong to Pathogen detection qualification field.
Background technology
Bulbus Lilii is Liliaceae (Liliacea) lilium (Lilium) perennial flowering bulb, and flower appearance is graceful, beautiful in colour, is loved by the people,
It is one of big cut-flower in the world five, is also high-grade potted flower and excellent garden floriculture.But Bulbus Lilii is also a class is easier to susceptible flowers, along with cultivation
The expansion of training area, the prolongation of planting time, Researches of Lilium Diseases occurs the most serious.In Researches of Lilium Diseases, Fusarium oxysporum the lily bulb caused
Canker (also known as stem rot, droop) is to endanger one of the most serious soil-borne fungus sexually transmitted disease (STD) evil (Wu Zhuhua etc., 2013) during Bulbus Lilii produces.Point
Fusarium oxysporum can endanger each organ of Bulbus Lilii plant, based on underground bulb.After plant catches an illness, underground bulb starts browning from the tip of a root, through plateau,
Final whole bulb rots.Aerial parts shows as plant and downgrades, and blade is wilted withered, and basal part of stem is hung contracting, and when pulling out, stem stalk is easily broken, causes large quantities of planting
Strain the most withered before blooming (dragon is refined preferably etc., 1999；Liang Qiaolan etc., 2004), serious shadow is to the yield and quality of Bulbus Lilii.If can be fungus
Infect and in early days pathogen is identified accurately and rapidly and classify, prevent and treat targetedly, can effectively prevent disease from spreading.
At present, the authentication method of Fusarium spp. mainly has traditional Morphological Identification and molecular biology identification two kinds.Traditional Morphological Identification mainly depends on
Identify about the feature description of Fusarium spp. according to Booth (1971) system and Lu Jiayun etc. (2000).The Morphological Identification one of Fusarium oxysporum
As be that the Comprehensive Traits combined with cultural colony and morphological characteristic is identified, not only the cycle is long, and process is complicated, and easily by operator's subjective consciousness
Impact.Additionally, due to the kind of Fusarium spp. is more, different hosts has different physiological specialization types, and affected by external environment and usually can
Producing many mutation, this makes traditional Morphological Identification be difficult to accurately to carry out.
Molecular Identification substantially increases the accuracy and efficiency of qualification, thus is used widely in the qualification of Fusarium spp..Fusarium spp. Molecular Identification depends on
Sequence analysis is carried out, between the most conventional method is according to transcribing in 18s rDNA and 28s rDNA according to the nucleotide sequence of Fusarium spp. genome
Septal area (internal transcribed space, ITS) sequence analysis carry out Fusarium spp. different genera taxonomic identification (Suga et al., 2000；Tomasz
Et al., 2004).Fungus rDNA section has multiple tandem repetitive sequence, comprises 18S, 5.8S, 28S and interval region (Du Xuanxin, 2006).
In rDNA, the genome sequence of 18S, 5.8S, 28S tends to conservative in being listed in most of biology, changes little, and ITS is as noncoding region between biological species,
There is higher diversity (Zhu Haiyan, 2012).White etc. (1990) universal primer that has been fungus rDNA-ITS sequential design: ITS1 (5 '-TC
CGTAGGTGAACCTGCGG-3 '), ITS4 (5 '-TCCTCCGCTTATTGATATGC-3 ') and ITS5 (5 '-GGAAGTAAAAGT
CGTAACAAGG-3 ') it is used for expanding most of basidiomycetes and ascomycetes, identify to classification of fungi and bring great convenience.On Bulbus Lilii, many employings are above-mentioned
Universal primer carries out Molecular Identification to Fusarium oxysporum.Yang Xiumei (2010) uses universal primer ITS1/ITS4 to expand Bulbus Lilii wilt ribosome
The ITS region of gene, by comparing with the ITS sequence of other Fusarium spp. in nucleic acid database, determines the cause of disease of area, Songming Bulbus Lilii droop first
For Fusarium oxysporum.The homesick PCR amplification waiting (2014) to use universal primer ITS1/ITS4 that pathogen F1 carries out rDNA-ITS of Zheng, mirror
Making oriental hybrid lily stem rot pathogen is Fusarium oxysporum.Zhu Haiyan (2012) uses universal primer ITS4/ITS5 to county of Hunan Longhui fossilia dentis mastodi hundred
The bulb-rot cause of disease closed is identified, its pcr amplification product base sequence is up to 99% with the sequence homology of Fusarium oxysporum.But,
The ITS sequence taxonomic identification of universal primer can only be distinguished to reaping hook genus, it is impossible to directly distinguishes (Yang Yingying etc., 2012) the most of the same race that reaping hook belongs to, also
The Variable Area partial sequence with Bulbus Lilii Fusarium oxysporum inherited character cannot be directly amplified from fungus hybrid dna sample, it is necessary to by means of
Detailed alignment, analyzes tested strain and the homology of known strain in gene order storehouse, makes Molecular Identification the most loaded down with trivial details.Therefore, design hundred
Close the specific primer of Fusarium oxysporum, and Bulbus Lilii Fusarium oxysporum is carried out specific amplification for quick Testing and appraisal Bulbus Lilii Fusarium oxysporum particularly
Important.
List of references:
[1] Booth C.The genus Fusarium [M] .London, CIM, 1971.
[2] Suga H, Hasegawa T, Mitsui H, et al.Phylogenetic analysis of the phytopathogenic fungus Fusarium solani
Based on the r DNA-ITS region [J] .Mycological Research, 2000,104 (10): 1175-1183.
[3] Tomasz K, Gabriel F, Agnieszka P, et al.Development of PCR assay based on ITS2 rDNA polymorphism for
The detection and differentiation of Fusarium sporotrichioides [J] .FEMS Microbiology Letters, 2004,239:
181-186.
[4] White T J, Bruns T, Lee S.Analysis of phylogenetic relationships by amplification and direct sequencing of
Ribosomal RNA genes [C] .Innis M A, ed PCR Protoco is A Gudie to Methos and Applications, New York:
Academic, 1990:15-22.
[5] Du Yixin. Guangdong Province's Fructus Caricae Identification of The Fungal Species Causing and biological characteristic research [D]. Shandong Agricultural University, 2006.
[6] Liang Qiaolan, Xu Bingliang, Liu Yanmei. bird watching Pathogens of Root Rot is identified and Chemicals [J]. Gansu Agriculture University's journal, 2004,39 (1): 25-
28.
[7] Long Yayi, Zhang Jinzheng, Zhang Lannian. the king [M] of Bulbus Lilii flowering bulb. Beijing: Golden Shield publishing house, 1999.
[8] Lu Jiayun. Plant Pathogenic Mycology [M]. Beijing: Chinese agriculture publishing house, 2000.
[9] Wu Zhuhua, Zhan Dezhi, Shi Jisen, etc. Bulbus Lilii Fusarium oxysporum bulb-rot progress [J]. Jiangsu's agriculture science, 2013,41 (6): 1-5.
[10] Yang Xiumei, Wang Jihua, Wang Lihua, etc. Bulbus Lilii droop Pathogen identification and ITS sequence analysis [J]. southwest agricultural journal, 2010,23 (6):
1914-1916.
[11] Yang Yingying, Liu Bo, Xiao Rongfeng, etc. Fructus Lycopersici esculenti, Fructus Solani melongenae and Fusarium oxysporum Molecular Identification and Pathogenicity [J] thereof. tropical crops journal,
2012,33 (5): 906-912.
[12] Zheng thinks of one's home, Wei Zhigang, Mao Shasha, etc. the oriental hybrid lily Analysis of Resistance [J] to stem rot. plant protection journal, 2014,41 (4): 429-437.
[13] Zhu Haiyan. Lilium longiflorum bulb-rot Pathogen identification and indoor Study on Fungicide Toxicity [D]. Agricultural University Of Hunan, 2012.
Summary of the invention
The method for identifying molecules of Fusarium bulbigenum mostly is from the separation of susceptible bulb, purification pathogen, expands and order-checking through universal primer after extracting DNA
The kind of pathogen is identified, it is impossible to from amplification, directly identify the kind of Fusarium bulbigenum with existing universal primer after comparison.The present invention
Solve the existing universal primer problem to cannot directly detect Fusarium oxysporum from mixed fungus DNA sample, it is provided that a kind of for quickly
The species-specific primer pair of detection Bulbus Lilii Fusarium oxysporum, in order to quickly and accurately Bulbus Lilii Fusarium oxysporum is carried out Molecular Identification.
This programme inventive technique scheme is as follows:
1, CTAB method extracts fungal DNA
(1) pathogen liquid culture
On superclean bench, in Rhizoma Solani tuber osi fluid medium, shake cultivation 5-7d with the mycelia connecing collarium picking colony edge of sterilization
(temperature 26 DEG C, rotating speed 150r/min).Sterile gauze filters bacterium solution, collects mycelia and carries out DNA extraction.
(2) CTAB method extracts DNA
1. in 1.5mL centrifuge tube, add 2%CTAB buffer 650 μ L, 65 DEG C of preheatings.Mycelia is ground fully by liquid nitrogen, takes rapidly 0.2g and grind
The mycelium powder of milled is put in warmed-up CTAB buffer, after mixing, and 65 DEG C of water-bath 1h, every 15min gentle agitation once.
2., after 1h water-bath terminates, it is placed on 4 DEG C or room temperature is cooled to room temperature.
3. adding 650 μ L chloroforms: isoamyl alcohol (24: 1), turn upside down, after mixing, 13000r/min is centrifuged 10min.
4. take supernatant in another new centrifuge tube, add isopyknic chloroform: isoamyl alcohol (24: 1), after mixing, 6000r/min is centrifuged 10min.
5. take supernatant to another centrifuge tube, add isopyknic isopropanol, after mixing, put into-20 DEG C of precipitation 1h.
6. 10000r/min is centrifuged 10min, abandons supernatant, adds 70% ethanol 300 μ L, washing precipitation.
7. 7000r/min is centrifuged 5min, is repeated 2 times.
7. abandon supernatant, in precipitation, add dehydrated alcohol 300 μ L washing fully.
8. 7000r/min is centrifuged 5min.
9. dry precipitation, add 80 μ L ddH2O, dissolving DNA, it is put in-20 DEG C and saves backup.
2, for detecting the PCR amplification of the specific primer pair of Bulbus Lilii Fusarium oxysporum
The specific primer of design Bulbus Lilii Fusarium oxysporum to named FO-lilii F/FO-lilii R, the base sequence of forward primer FO-lilii F is 5 '-
CTCCCAACCCCTGTGACATACC-3 ', the base sequence of reverse primer FO-lilii R is 5 '-GCCGATCCCCAACA
CCAAAC-3′.It is 20 μ L: masterplate DNA 2 μ L for detecting the PCR amplification system of the specific primer pair of Fusarium oxysporum, primers F O-lilii
F 0.5 μ L, primers F O-lilii R 0.5 μ L, 2 × Taq PCR Master Mix 10 μ L；ddH2O 7μL.Pcr amplification reaction program is: 95 DEG C
Denaturation 3min；95 DEG C of degeneration 30s, 64 DEG C of annealing 30s, 72 DEG C extend 1min, totally 35 circulations；72 DEG C extend 10min.
Accompanying drawing explanation
Fig. 1 is the lily bulb that Fusarium oxysporum is infected.
Fig. 2 is to utilize universal primer ITS1/ITS4 that 3 kinds of Fusarium spp. of Fusarium are carried out the testing result figure of PCR amplification.In Fig. 2, M swimming lane is
Marker, 1,2,3 swimming lanes are respectively universal primer ITS1/ITS4 and the PCR of Fusarium oxysporum, the raw Fusarium spp. of layer and Fusarium graminearum are expanded product
Thing.
Fig. 3 is the testing result figure utilizing specific primer that 3 kinds of Fusarium spp. of Fusarium are carried out PCR amplification by FO-lilii F/FO-lilii R.Fig. 3
Middle M swimming lane is Marker, 1,2,3 swimming lanes be respectively specific primer to FO-lilii F/FO-lilii R to Fusarium oxysporum, the raw Fusarium spp. of layer and
The pcr amplification product of Fusarium graminearum.
Fig. 4 is to utilize specific primer to the FO-lilii F/FO-lilii R sequence to Bulbus Lilii Fusarium oxysporum amplified production.
Fig. 5 is the pathogenic qualification of Bulbus Lilii Fusarium oxysporum.In Fig. 5, A is matched group, B and C is that Fusarium oxysporum infects ' Suo Bang ' lily bud scale.
Fig. 6 is the testing result figure of the lily bud scale PCR amplification that Fusarium oxysporum is infected by specific primer by FO-lilii F/FO-lilii R.M in Fig. 6
Swimming lane is Marker, and 1 swimming lane is that primer carries out the product of PCR amplification to the lily bud scale that Fusarium oxysporum is infected by FO-lilii F/FO-lilii R.
Fig. 7 is to utilize specific primer to the FO-lilii F/FO-lilii R testing result figure to not belonging to fungus together and carry out PCR amplification.In Fig. 7, M swimming lane is
Marker, 1-8 swimming lane be respectively primer to FO-lilii F/FO-lilii R to Fusarium oxysporum, the raw Fusarium spp. of layer, Fusarium graminearum, Botrytis cinerea,
Paeonia suffruticosa Fructus Vitis viniferae spore, Phytophthora cactorum, Phytophthora capsici and the pcr amplification product of gladiolus penicillium sp.
Detailed description of the invention
1, CTAB method extracts fungal DNA
(1) pathogen liquid culture
On superclean bench, in Rhizoma Solani tuber osi fluid medium, shake cultivation 5-7d with the mycelia connecing collarium picking colony edge of sterilization
(temperature 26 DEG C, rotating speed 150r/min).Sterile gauze filters bacterium solution, collects mycelia and carries out DNA extraction.
(2) CTAB method extracts DNA
1. in 1.5mL centrifuge tube, add 2%CTAB buffer 650 μ L, 65 DEG C of preheatings.Mycelia is ground fully by liquid nitrogen, takes rapidly 0.2g and grind
The mycelium powder of milled is put in warmed-up CTAB buffer, and after mixing, 65 DEG C of water-bath 1h, every 15min, gentle agitation is once.
2., after 1h water-bath terminates, it is placed on 4 DEG C or room temperature is cooled to room temperature.
3. adding 650 μ L chloroforms: isoamyl alcohol (24: 1), turn upside down, after mixing, 13000r/min is centrifuged 10min.
4. take supernatant in another new centrifuge tube, add isopyknic chloroform: isoamyl alcohol (24: 1), after mixing, 6000r/min is centrifuged 10min.
5. take supernatant to another centrifuge tube, add isopyknic isopropanol, after mixing, put into-20 DEG C of precipitation 1h.
6. 10000r/min is centrifuged 10min, abandons supernatant, adds 70% ethanol 300 μ L, washing precipitation.
7. 7000r/min is centrifuged 5min, is repeated 2 times.
7. abandon supernatant, in precipitation, add dehydrated alcohol 300 μ L washing fully.
8. 7000r/min is centrifuged 5min.
9. dry precipitation, add 80 μ L ddH2O, dissolving DNA, it is put in-20 DEG C and saves backup.
2, infect ' Suo Bang ' lily bud scale by separating the Bulbus Lilii Fusarium oxysporum obtained, take scale disease of catching an illness and be good for junction, utilize CTAB method to extract DNA,
The same above-mentioned steps of method (2).
3, present embodiment is for detecting the specific primer of Bulbus Lilii Fusarium oxysporum to named FO-lilii F/FO-lilii R, forward primer FO-lilii F's
Base sequence is 5 '-CTCCCAACCCCTGTGACATACC-3 ', and the base sequence of reverse primer FO-lilii R is 5 '-GCCGATCC
CCAACACCAAAC-3′。
4, the PCR amplification system of the present embodiment specific primer pair for detecting Bulbus Lilii Fusarium oxysporum is 20 μ L: masterplate DNA 2 μ L, primer
FO-lilii F 0.5 μ L, primers F O-lilii R 0.5 μ L, 2 × Taq PCR Master Mix 10 μ L；ddH2O 7μL。
5, the pcr amplification reaction program of the present embodiment species-specific primer pair for detecting Bulbus Lilii Fusarium oxysporum is: 95 DEG C of denaturations 3min；
95 DEG C of degeneration 30s, 64 DEG C of annealing 30s, 72 DEG C extend 1min, totally 35 circulations；72 DEG C extend 10min.
6, utilize present embodiment primer that to 3 kinds of Fusarium spp. of Fusarium, FO-lilii F/FO-lilii R is carried out PCR amplification, then carry out agarose and coagulate
Gel electrophoresis detect, testing result as it is shown on figure 3, from testing result it can clearly be seen that only Fusarium oxysporum amplify single at 300bp
Significantly specific band.PCR primer being checked order, the gained sequence Gen Bank nucleic acid database in NCBI website carries out Blast comparison,
Find that sequence is 99% with the homology of Fusarium oxysporum rDNA ITS sequence in data base.
7, ' Suo Bang ' the lily bud scale DNA utilizing present embodiment primer to infect FO-lilii F/FO-lilii R to Fusarium oxysporum carries out PCR amplification,
Then carrying out agarose gel electrophoresis detection, testing result as shown in Figure 6, can be clearly seen that from testing result amplifying one is about 300bp
Obvious specific band, through order-checking and comparison be defined as Fusarium oxysporum.
8, utilize present embodiment primer that the FO-lilii F/FO-lilii fungus to not belonging to together is carried out PCR amplification, then carry out agarose gel electrophoresis inspection
Surveying, testing result is as it is shown in fig. 7, can be clearly seen that from testing result only Fusarium oxysporum amplifies single obvious specific band.
Claims (2)
1. the method quickly detecting lily bulb canker pathogen Fusarium oxysporum, it is characterised in that comprise the steps:
(1) CTAB method extracts fungal DNA.
(2) specific primer of design Bulbus Lilii Fusarium oxysporum is to named FO-lilii F/FO-lilii R, and the base sequence of forward primer FO-lilii F is 5 '-
CTCCCAACCCCTGTGACATACC-3 ', the base sequence of reverse primer FO-lilii R is 5 '-GCCGATCCCCAACACCAA
AC-3′。
(3) PCR amplification system of the specific primer pair for detecting Bulbus Lilii Fusarium oxysporum is 20 μ L: masterplate DNA 2 μ L, primers F O-lilii F
0.5 μ L, primers F O-lilii R 0.5 μ L, 2 × Taq PCR Master Mix 10 μ L, ddH2O 7μL。
(4) the pcr amplification reaction program of the specific primer pair for detecting Bulbus Lilii Fusarium oxysporum is:
(5) the pcr amplified fragment sequence of the specific primer pair for detecting Bulbus Lilii Fusarium oxysporum is:
TAGTCCCGGCGACGCCCGCTCCGGTAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTAT
ATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCG
ATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGA
ACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCAC
AGTTTGGTGTGGGGGGATCGGCA, a length of 296bp.
The method of quick detection Bulbus Lilii Fusarium oxysporum the most according to claim 1, it is characterised in that: it is used for described in step (2) identifying Bulbus Lilii point
The specific primer of fusarium oxysporum is to for FO-lilii F/FO-lilii R, and the base sequence of forward primer FO-lilii F is 5 '-CTCCCAACCCCTGT
GACATACC-3 ', the base sequence of reverse primer FO-lilii R is 5 '-GCCGATCCCCAACACCAAAC-3 '.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201511017538.4A CN106319039A (en) | 2015-12-30 | 2015-12-30 | Method for fast detection of lily bulb rot pathogen fusarium oxysporum |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201511017538.4A CN106319039A (en) | 2015-12-30 | 2015-12-30 | Method for fast detection of lily bulb rot pathogen fusarium oxysporum |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106319039A true CN106319039A (en) | 2017-01-11 |
Family
ID=57725128
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201511017538.4A Pending CN106319039A (en) | 2015-12-30 | 2015-12-30 | Method for fast detection of lily bulb rot pathogen fusarium oxysporum |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106319039A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111607657A (en) * | 2020-05-06 | 2020-09-01 | 兰州百源基因技术有限公司 | Primer, probe, kit and method for RT-QPCR (reverse transcription-quantitative polymerase chain reaction) detection of fusarium oxysporum |
| CN112735527A (en) * | 2021-01-06 | 2021-04-30 | 武汉华大基因技术服务有限公司 | Method, device and storage medium for analyzing series sequence |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101974650A (en) * | 2010-11-30 | 2011-02-16 | 中国农业科学院植物保护研究所 | Polymerase chain reaction (PCR) method for detecting fusarium oxysporum and kit |
| CN103725782A (en) * | 2013-12-23 | 2014-04-16 | 湖南省植物保护研究所 | Method, kit and primer for detecting pathogenic bacteria of lotus fungal rot disease carried by lotus seeds |
| CN104263813A (en) * | 2013-07-18 | 2015-01-07 | 宁波市农业科学研究院 | Sequences of primer for identifying fusarium solani and/or fusarium oxysporum, kit and method thereof |
-
2015
- 2015-12-30 CN CN201511017538.4A patent/CN106319039A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101974650A (en) * | 2010-11-30 | 2011-02-16 | 中国农业科学院植物保护研究所 | Polymerase chain reaction (PCR) method for detecting fusarium oxysporum and kit |
| CN104263813A (en) * | 2013-07-18 | 2015-01-07 | 宁波市农业科学研究院 | Sequences of primer for identifying fusarium solani and/or fusarium oxysporum, kit and method thereof |
| CN103725782A (en) * | 2013-12-23 | 2014-04-16 | 湖南省植物保护研究所 | Method, kit and primer for detecting pathogenic bacteria of lotus fungal rot disease carried by lotus seeds |
Non-Patent Citations (1)
| Title |
|---|
| 窦红涛等: "临床常见镰刀菌rDNA ITS序列分析", 《临床和实验医学杂志》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111607657A (en) * | 2020-05-06 | 2020-09-01 | 兰州百源基因技术有限公司 | Primer, probe, kit and method for RT-QPCR (reverse transcription-quantitative polymerase chain reaction) detection of fusarium oxysporum |
| CN112735527A (en) * | 2021-01-06 | 2021-04-30 | 武汉华大基因技术服务有限公司 | Method, device and storage medium for analyzing series sequence |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hosen et al. | Borofutus, a new genus of Boletaceae from tropical Asia: phylogeny, morphology and taxonomy | |
| Chen et al. | Isolation and varietal characterization of Ganoderma resinaceum from areas of Ganoderma lucidum production in China | |
| Hameed | Inflorescence rot disease of date palm caused by Fusarium proliferatum in Southern Iraq | |
| Abedi-Tizaki et al. | Morphological and molecular identification of'Fusarium'head blight isolates from wheat in north of Iran | |
| Singapurwa et al. | Identification of contaminant fungi on Pedetan, An dry fish product of Lemuru (Sardinella lemuru) | |
| de Souza et al. | Genetic and biological diversity of Trichoderma stromaticum, a mycoparasite of the cacao witches'-broom pathogen | |
| Mohankumar et al. | Diversity and pathogenicity of Botryosphaeriaceae associated with macadamia branch dieback in Australia | |
| Liu et al. | Characterization of Colletotrichum causing anthracnose on rubber trees in Yunnan: two new records and two new species from China | |
| CN106319039A (en) | Method for fast detection of lily bulb rot pathogen fusarium oxysporum | |
| Wu et al. | Morphological and molecular identification of Paracoccus marginatus (Hemiptera: Pseudococcidae) in Yunnan, China | |
| Cui et al. | Amanita chuformis, a new Amanita species with a marginate basal bulb | |
| Lin et al. | Ambrosiella in Taiwan including one new species | |
| CN104498593B (en) | Identify or auxiliary identify storage bean weevil primer to and test kit | |
| Carlier et al. | Ophiostoma arduennense sp. nov.(Ophiostomatales, Ascomycota) from Fagus sylvatica in southern Belgium | |
| Lee et al. | Report of postharvest rot of kiwifruit in Korea caused by Sclerotinia sclerotiorum | |
| Zhang et al. | Characterization of Colletotrichum gloeosporioides responsible for anthracnose disease of Trichosanthes kirilowii Maxim in central China | |
| Grisan et al. | Development of a molecular approach to describe the diversity of fungal endophytes in either phytoplasma-infected, recovered or healthy grapevines | |
| Muni et al. | Morphological and molecular characterization of Magnaporthe oryzae (fungus) from infected rice leaf samples | |
| Belosokhov et al. | Alternaria spp. and Colletotrichum coccodes in potato leaves with early blight symptoms. | |
| Shanqi et al. | Leaf disease caused by Epicoccum thailandicum on Amomum villosum in China | |
| Zohmangaiha et al. | Ganoderma Species of Mizoram, India | |
| Hosen et al. | Two new species of Xanthagaricus and some notes on Heinemannomyces from Asia. Mycokeys 28: 1–18 | |
| Khoo et al. | First report of Epicoccum sorghinum causing leaf spot on Platostoma palustre in Malaysia | |
| Ravi et al. | First report of Fusarium proliferatum causing rot of onion bulbs (Allium cepa L.) in India | |
| Maghrebi et al. | First report of Leptosphaeria maculans and Leptosphaeria biglobosa causing blackleg disease of oilseed rape in Tunisia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170111 |