CN106283200B - A kind of library constructing method improving amplicon literature data homogeneity - Google Patents

A kind of library constructing method improving amplicon literature data homogeneity Download PDF

Info

Publication number
CN106283200B
CN106283200B CN201610801187.4A CN201610801187A CN106283200B CN 106283200 B CN106283200 B CN 106283200B CN 201610801187 A CN201610801187 A CN 201610801187A CN 106283200 B CN106283200 B CN 106283200B
Authority
CN
China
Prior art keywords
amplicon
primer
reaction tube
concentration
melting temperature
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201610801187.4A
Other languages
Chinese (zh)
Other versions
CN106283200A (en
Inventor
易建明
屈武斌
蔡万世
王瑞超
杭兴宜
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aiji Taikang (Jiaxing) Biotechnology Co., Ltd.
Original Assignee
Igenetech Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Igenetech Co Ltd filed Critical Igenetech Co Ltd
Priority to CN201610801187.4A priority Critical patent/CN106283200B/en
Publication of CN106283200A publication Critical patent/CN106283200A/en
Application granted granted Critical
Publication of CN106283200B publication Critical patent/CN106283200B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1068—Template (nucleic acid) mediated chemical library synthesis, e.g. chemical and enzymatical DNA-templated organic molecule synthesis, libraries prepared by non ribosomal polypeptide synthesis [NRPS], DNA/RNA-polymerase mediated polypeptide synthesis

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to high-throughput gene sequencing fields, and the present invention provides a kind of library constructing methods improving amplicon literature data homogeneity, including：1) the amplification subsequence of multiple target areas and design primer are determined；2) primer is divided into multiple reaction tubes；3) original amounts for calculating every primer ensure that each amplicon obtains homogenization amplification；4) the 1st wheel is carried out to target area with the primer mixture of each reaction tube to expand；5) obtained amplicon is purified and is quantified；6) amplicon of each reaction tube is mixed so that the number of each amplicon is roughly the same；7) the 2nd wheel PCR reactions are carried out by template of mixed amplicon mixture, sequence measuring joints P5 and P7 is introduced into the both sides of amplicon；8) amplification sublibrary purified, quantified, be sequenced.

Description

A kind of library constructing method improving amplicon literature data homogeneity
Technical field
The invention belongs to high-throughput gene sequencing fields, specifically, the present invention relates to one kind for improving amplification Ziwen The library constructing method of library data homogeneity.
Background technology
It is a kind of target capture sequencing technologies that amplicon, which captures sequencing technologies, mainly using multiple PCR technique to multiple mesh It marks regional sequence and carries out specific amplification and enrichment, obtain the amplicon of target area, then use two generation sequencing technologies to expanding Increase son to be sequenced, obtains the sequence information of target area.Amplicon captures sequencing technologies compared with liquid-phase chip hybridization technique, Have many advantages, such as that the library construction period is short, sequencing depth is high, at low cost, panel flexible designs, therefore is gone out based on the technological development The sequencing products come are in targeting sequencing field increasingly by the welcome of consumer and favor.
Although it is numerous that amplicon captures sequencing technologies advantage, there is also some shortcomings, and it is exactly library to protrude disadvantage Data homogeneity is poor, be embodied in amplicon sequencing depth height differ, be irregular, standard deviation it is big.Library homogeneity is poor Two serious problems can be brought：1st is the cost for dramatically increasing sequencing：In targeting sequencing field, each amplicon is usually required that All reach some credible sequencing depth, to ensure the reliability of data results.Homogeneity difference shows to have in library a large amount of Amplicon be less than credible sequencing depth, it is therefore desirable to increase sequencing data total amount, their sequencing depth be increased to credible Depth is sequenced, this undoubtedly increases the cost of sequencing.Homogeneity difference also shows to have in library simultaneously the sequencing of multiple amplicons deep Degree is significantly higher than credible sequencing depth.These data for being higher by credible sequencing depth substantially belong to the invalid data of redundancy, real The utilization rate that sequencing data is reduced on border increases the cost of sequencing.Second serious problems is limitation amplification sublibrary Flux.The experimental results show that the increase with amplicon flux, primer dimer and non-specific band largely generate, The homogeneity in library is caused drastically to decline.In conclusion the homogeneity for improving library has become amplicon capture sequencing technologies Field urgent problem to be solved, and further decrease amplicon sequencing expense, improve the difficulty that amplicon flux must step.
For library homogeneity difference Producing reason, current Main Viewpoints are considered caused by internal cause and external cause.Internal cause The amplification efficiency of mainly amplicon is different, and the quantity height that amplicon accumulates after same loop number is caused to differ.Into one Step is the study found that the amplification efficiency of amplicon is largely influenced by primer sequence and primer quantity, such as certain primers Sequence is more easy to be identified and combined by archaeal dna polymerase, increase so as to cause the quantity of the amplicon；Increase the number of certain primer sequences Amount would generally then improve the quantity of corresponding amplicon.External cause is mainly primer dimer, non-specific band and target bar band sequence The fusion being complementarily shaped to because their generation can not only consume the required primer of target amplicon, while can also consume The substrate and archaeal dna polymerase of reaction system, cause target amplicon quantity drastically to decline.It is emphasized that they are to uniform The capability of influence of property increases and significantly increases with amplicon flux.
For internal cause, current most common solution is the ratio manually adjusted between multi-primers quantity, to adjust Quantitative proportion between whole amplicon improves the homogeneity of data.Although this method is effective, repeated multiple times adjustment is needed, If the flux of amplicon is high, workload is very big, is difficult to carry out in actual operation.It is especially high-throughput for external cause Amplification sublibrary, there are two current solutions.1st solution is that amplicon or multi-primers are divided into 2 A and 2 or more reaction tubes (pool) reduce dimer and Fei Te to reduce the quantity of multi-primers in single reaction tube The generation of anisotropic band improves the homogeneity in library.It is sequenced it is emphasized that dividing reaction tube and being captured also with amplicon A kind of indispensable means of technical research Long fragment gene sequence, because the sequencing reading length of illumina is usually 300bp, therefore need Long segment is divided into multiple amplicons to partially overlap end to end, this operation is called tiling.To avoid amplification subsequence Between complementary pairing formed artificial fusions, need by no sequence match amplicon primer be divided into a reaction tube.2nd Solution is to improve the designed capacity of primer, avoids generating primer dimer and non-specific band.For two of external cause Solution is theoretically highly effective, but actual effect is barely satisfactory.For reaction tube strategy, frequently problem has two It is a：First, reaction tube division is unreasonable, cause still to will produce a large amount of primer dimers and non-specific band in reaction tube；Two It is often to mix uneven when amplicon in each reaction tube is mixed (pooling), causes in certain reaction tubes Amplicon quantity is on the high side, and the amplicon quantity in certain reaction tubes is on the low side, reduces the homogeneity in library instead.Primer is set Stratagem is omited, it is difficult to while ensureing all primer efficient amplifications, avoid the generation of primer dimer and non-specific band.
Therefore, solution to the problems described above is badly in need of in this field, improves the homogeneity in library.
Invention content
The present invention provides a kind of library constructing methods improving amplicon literature data homogeneity, and the method includes such as Lower step：
1) it determines the amplification subsequence of multiple target areas, and separately designs for each the multiple amplification subsequence more Universal sequence is contained at 5 ' ends of weight primer, the multi-primers, the part held for sequence measuring joints sequence 3 '；
2) multi-primers are divided into multiple reaction tubes, the multi-primers in each reaction tube meet：
A) melting temperature of all primers is almost the same in each reaction tube；
B) primer in reaction tube cannot form primer dimer between each other；
C) primer can only cause the amplification of target amplicon, will not cause the formation of non-specific amplification band；
D) primer amplification obtains that artificial fusions will not be formed there is no the complementation in sequence between amplicon；
3) original amounts for calculating every primer make each amplicon obtain homogeneity amplification, and are divided according to step 2) Reaction tube, prepare the multi-primers mixture of each reaction tube；
4) the 1st wheel is carried out to target area sequence to expand, obtain amplicon with the multi-primers mixture of each reaction tube, Universal sequence is introduced into the both sides of amplicon；
5) amplicon of each reaction tube obtained to step 4) is purified and (preferably uses magnetic bead) and quantified；
6) amplicon of all reaction tubes is mixed, and keeps the number of each amplicon roughly the same, such as Difference is within 10%, within preferably 5%；
7) the 2nd wheel PCR reactions are carried out using mixed amplicon mixture as template, with sequence measuring joints primer, will be sequenced Connector (preferably P5 and P7) is introduced into the both sides of amplicon；
8) amplification sublibrary is purified and (preferably uses magnetic bead), quantitative, sequencing (sequencing of preferably two generations).
In one embodiment, the melting temperature of all primers is almost the same in each reaction tube, and standard is all draws Standard deviation≤5 DEG C of the melting temperature of object, preferably≤2 DEG C；
In one embodiment, the primer in reaction tube cannot form primer dimer between each other, set reaction tube The average melting temperature of inner primer is Tprimer, the melting temperature of dimer is Tdimer, then the standard analyzed is Tprimer- Tdimer>=10 DEG C, preferably >=15 DEG C.
In one embodiment, primer can only cause the amplification of target amplicon, will not cause non-specific amplification item The formation of band sets the average melting temperature of target amplicon primer in reaction tube as Tprimer, the solution of the sub- primer of non-specific amplification Chain temperature is Tnon-specific, then the standard analyzed is Tprimer–Tnon-specific>=10 DEG C, preferably >=15 DEG C.
In one embodiment, artificial fusions will not be formed, will be expanded there is no the complementation in sequence between amplicon It is compared two-by-two between increasing, and thermodynamics melting temperature (T is carried out to comparison resultpp) calculate, set target in reaction tube The average melting temperature of amplicon primer is Tprimer, then the standard analyzed is Tprimer–Tpp>=10 DEG C, preferably >=15 DEG C.
In one embodiment so that the number of amplicon is almost the same in each reaction tube, can be performed as follows： For the primer in each reaction tube, the equilibrium equation that primer A is combined with DNA profiling (T) is：Wherein in temperature It spends under t, there is the equilibrium constantWherein Δ GA=-RT × ln (KA), [AT] is amplified production concentration, [A] is primer A concentration, [T] are template concentrations, R is gas constant, are approximately equal to 1.9872cal/ (Kmol), T is absolute temperature, for primer B has same calculation formulaWherein Δ GB=-RT × ln (KB), [BT] is amplified production concentration, [B] is to draw Object B concentration, [T] are template concentrations, R is gas constant, are approximately equal to 1.9872cal/ (Kmol), T is absolute temperature；So that [AT]=[BT], therefore have formula：And for every primer, Δ G is Gibbs free amount, can pass through base It calculates and obtains in thermodynamic (al) nearest neighbor algorithm；
Therefore, for the primer in each reaction tube, the concentration of any one selected primer is remaining as benchmark concentration Each primer can calculate the ratio with benchmark primer concentration by above formula, may thereby determine that each primer Concentration, such as make [A]=[B].
In one embodiment so that the amplicon number between each reaction tube is substantially mixed substantially, can be with It realizes as follows：Required volume when each reaction tube amplicon merges is adjusted, the volume is by amplicon in each reaction tube Number and concentration determine.Such as amplicon is divided into 3 reaction tubes, the amplicon number in each reaction tube be respectively A, B and C, corresponding concentration is respectively a, b and c, then the volume needed for the merging of these three reaction tubes is respectively：1, aB/Ab and aC/Ac.
Description of the drawings
Fig. 1 is library construction flow.
Specific implementation mode
The present invention relates to the library constructions for improving amplicon literature data homogeneity, include the content of 4 aspects：
A kind of amplicon that divides of 1st aspect offer is the method for 2 and 2 or more reaction tubes, inside reaction tube substantially not Primer dimer, the artificial fusions that non-specific band and amplicon partial sequence complementarity are formed are will produce, ensure amplification Sub- efficient amplification；
2nd aspect provides a kind of computational methods confirming every primer primary quantity, makes every amplicon homogenization amplification；
3rd aspect provides a kind of mixed method merging reaction tube amplicon, the amplicon between reaction tube and reaction tube Uniformly mixing；
4th aspect provides a kind of amplicon library construction side of the method raising uniform property in library based on above-mentioned three aspect Method, advantage are that the data homogeneity of amplification sublibrary is good.
In the method that the 1st aspect divides that amplicon is 2 or 2 or more reaction tubes, the method meets the following conditions：
1) it determines the amplification subsequence of multiple target areas, and separately designs for each the multiple amplification subsequence more Universal sequence is contained at 5 ' ends of weight primer, the multi-primers, and for the part that sequence measuring joints sequence 3 ' is held, length is according to amplification Depending on the tuple of son；
2) melting temperature of all primers is almost the same in each pool, and standard is the standard of the melting temperature of all primers Difference≤5 DEG C, preferably≤2 DEG C；
3) primer in reaction tube cannot form primer dimer between each other, set the average unwinding of reaction tube inner primer Temperature is Tprimer, the melting temperature of dimer is Tdimer, then the standard analyzed is Tprimer-Tdimer>=10 DEG C, preferably >=15 ℃；
4) primer can only cause the amplification of target amplicon, will not cause the formation of non-specific amplification band, and setting is anti- The average melting temperature that interior target amplicon primer should be managed is Tprimer, the melting temperature of the sub- primer of non-specific amplification is Tnon-specific, then the standard analyzed is Tprimer–Tnon-specific>=10 DEG C, preferably >=15 DEG C；
5) artificial fusions will not be formed, two will be carried out between amplicon there is no the complementation in sequence between amplicon Two compare, and carry out thermodynamics melting temperature (T to comparison resultpp) calculate, target amplicon primer is flat in setting reaction tube Equal melting temperature is Tprimer, then the standard analyzed is Tprimer–Tpp>=10 DEG C, preferably >=15 DEG C.
In the present invention, the melting temperature T of target amplicon primerprimerIt is the unwinding temperature between primer and target sequence Degree.
2nd aspect confirms the computational methods of primer primary quantity based on following thermodynamics hybridization theory chemical equilibrium equation： For the primer in each reaction tube, the equilibrium equation that primer A is combined with DNA profiling (T) is：Wherein in temperature It spends under t, there is the equilibrium constantWherein Δ GA=-RT × ln (KA), [AT] is amplified production concentration, [A] is primer A concentration, [T] are template concentrations, R is gas constant, are approximately equal to 1.9872cal/ (Kmol), T is absolute temperature, for primer B has same calculation formulaWherein Δ GB=-RT × ln (KB), [BT] is amplified production concentration, [B] is to draw Object B concentration, [T] are template concentrations, R is gas constant, are approximately equal to 1.9872cal/ (Kmol), T is absolute temperature；
Since DNA profiling is genomic DNA, all primers have common template DNA, homogeneity amplification Target is that all amplified production contents are consistent, that is, [AT]=[BT], therefore has formula：And for every Primer, Δ G is Gibbs free amount, can be calculated by being based on thermodynamic (al) nearest neighbor algorithm and be obtained；
Therefore, for the primer in each reaction tube, the concentration of any one selected primer is remaining as benchmark concentration Each primer can calculate the ratio with benchmark primer concentration by above formula, may thereby determine that each primer Concentration.In the present invention, the original amounts for calculating every primer, make each amplicon obtain homogeneity amplification, and the starting is used Amount can float up and down on the basis of calculated value no more than 10%；It refers to that amplicon is dense that the amplicon, which obtains homogeneity amplification, It spends difference and is not more than 20%, preferably no greater than 10, most preferably no greater than 5%.
In the 3rd aspect merges the mixed method of each reaction tube amplicon, each reaction tube when merging required volume by each anti- The number and concentration that interior amplicon should be managed determine.For example amplicon is divided into 3 reaction tubes, the amplification subnumber in each reaction tube Mesh is respectively A, B and C, and corresponding concentration is respectively a, b and c, then the volume needed for the merging of these three reaction tubes is respectively：1, AB/Ab and aC/Ac.
4th aspect provides a kind of amplicon library construction side of the method raising library homogeneity based on above-mentioned three aspect Method the described method comprises the following steps：
1) it determines the amplification subsequence of multiple target areas, and separately designs for each the multiple amplification subsequence more Universal sequence is contained at 5 ' ends of weight primer, the multi-primers, the part held for sequence measuring joints sequence 3 '；
2) amplicon is divided into multiple reaction tubes according to the method for the 1st aspect；
3) original amounts of every primer are calculated according to the method for the 2nd aspect, and according to the reaction divided in step 2) Control for each reaction tube multi-primers mixture；
4) the 1st wheel is carried out to target area to expand, obtain amplicon, will lead to the multi-primers mixture of each reaction tube The both sides of amplicon are introduced into sequence；
5) amplicon of each reaction tube obtained to step 4) is purified and (preferably uses magnetic bead) and quantified；
6) amplicon of all reaction tubes is mixed according to the method for the 3rd aspect；
7) the 2nd wheel PCR reactions are carried out using mixed amplicon mixture as template, with sequence measuring joints primer, will be sequenced Connector (preferably P5 and P7) is introduced into the both sides of amplicon；
8) amplification sublibrary is purified and (preferably uses magnetic bead), quantitative, sequencing (sequencing of preferably two generations).
In an embodiment of the present invention：The target area sequence of detection totally 780 (Tables 1 and 2), it is thin with people's normal breast The gDNA that born of the same parents HTB-125 is extracted is template, builds multiplex PCR target capture sequencing library, parallel to repeat to test 3 (samples Product 1-3).
Embodiment 1：How reaction tube is divided；
1. determining the amplification subsequence of multiple target areas, and separately designs and draw for each the multiple amplification subsequence 3 ' ends of object, the primer are specific sequence (Tables 1 and 2), with target fragment sequence complementary pairing；5 ' ends of the primer For universal sequence, wherein universal sequence (SEQ ID NO.1) GAGATCTACACTCTTTCCCTACACGACGCTC of sense primer The universal sequence of TTCCGATCT, downstream primer are (SEQ ID NO.2) CATCATTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCT。
2. the melting temperature of all primers is almost the same in each reaction tube, standard is the mark of the melting temperature of all primers It is accurate it is poor≤5 DEG C, preferably≤2 DEG C；
3. the primer in reaction tube cannot form primer dimer between each other, the average unwinding of reaction tube inner primer is set Temperature is Tprimer, the melting temperature of dimer is Tdimer, then the standard analyzed is Tprimer-Tdimer>=10 DEG C, preferably >=15 ℃；
4. primer can only cause the amplification of target amplicon, the formation of non-specific amplification band will not be caused, setting is anti- The average melting temperature that interior target amplicon primer should be managed is Tprimer, the melting temperature of the sub- primer of non-specific amplification is Tnon-specific, then the standard analyzed is Tprimer–Tnon-specific>=10 DEG C, preferably >=15 DEG C；
5. will not form artificial fusions there is no the complementation in sequence between amplicon, two will be carried out between amplicon Two compare, and carry out thermodynamics melting temperature (T to comparison resultpp) calculate, target amplicon primer is flat in setting reaction tube Equal melting temperature is Tprimer, then the standard analyzed is Tprimer–Tpp>=10 DEG C, preferably >=15 DEG C.
Multi-primers design is carried out according to the principle and divides reaction tube, will be expanded 780 the multiple of target area and is drawn Object is divided into two reaction tubes, is respectively designated as Tube-1 and Tube-2.There are 388 pairs of multi-primers in Tube-1, in Tube-2 There are 392 pairs of multi-primers (referring to Tables 1 and 2).
The calculating of primer primary quantity in 2 reaction tube of embodiment；
For the primer in each reaction tube, the equilibrium equation that primer A is combined with DNA profiling (T) is： Wherein at temperature t, there is the equilibrium constantWherein Δ GA=-RT × ln (KA), [AT] be amplified production concentration, [A] is primer A concentration, [T] is template concentrations, R is gas constant, is approximately equal to 1.9872cal/ (Kmol), and T is absolute temperature Degree, has same calculation formula for primer BWherein Δ GB=-RT × ln (KB), [BT] is amplified production Concentration, [B] are primer B concentration, [T] is template concentrations, R is gas constant, are approximately equal to 1.9872cal/ (Kmol), and T is exhausted To temperature；
Since DNA profiling is genomic DNA, all primers have common template DNA, homogeneity amplification Target is that all amplified production contents are consistent, that is, [AT]=[BT], therefore has formula：And for every Primer, Δ G is Gibbs free amount, can be calculated by being based on thermodynamic (al) nearest neighbor algorithm and be obtained；
Therefore, for the primer in each reaction tube, the concentration of any one selected primer is remaining as benchmark concentration Each primer can calculate the ratio with benchmark primer concentration by above formula, may thereby determine that each primer Concentration.The primer of the concentration is mixed, the multi-primers mixture of each reaction tube is prepared.
According to the computational methods of above-mentioned primer initial amount, show that the initial amount of every primer of Tube-1 and Tube-2 (is shown in Table 1 With table 2), and be mixed, respectively obtain the multi-primers mixture of Tube-1 and Tube-2.
Table 1：(primer is compiled for primer sequence (3 ' specific sequence), primer annealing temperature and original amounts in Tuble-1 Number：T1P1-T1P388)
Table 2：(primer is compiled for primer sequence (3 ' specific sequence), primer annealing temperature and original amounts in Tuble-2 Number：T2P1-T2P392)
Embodiment 3 expands the structure of sublibrary.
1st step：1st wheel multi-PRC reaction amplification target area obtains amplicon
Shown in Fig. 1, each sample carries out 2 multi-PRC reactions, respectively Tube-1 and Tube-2.Each reaction Corresponding multi-primers mixture (primer mixture) is added, while the sample gDNA of corresponding amount is added.What reaction used Archaeal dna polymerase is that document report is suitable for two generation sequencing libraries structure archaeal dna polymerase, has hi-fi and strong amplification ability. The common archaeal dna polymerase Phusion DNA Polymerases (Thermo scientific) of the present embodiment use, High-Fidelity DNA Polymerase(NEB)、Q5High-Fidelity DNA polymerase(NEB)、Hifi Polymerase (KAPA), KOD FX (TOYOBO) etc..
Above-mentioned reaction system and reaction condition are the reaction condition suitable for the present embodiment.The method improved using the present invention When structure amplification sublibrary, reaction system and reaction condition can be according to the types of the number and archaeal dna polymerase used of amplicon Do corresponding adjustment.
2nd step：Multiple PCR products are taken turns using magnetic bead pair the 1st to purify
2.1 are added 45 μ l magnetic beads, after being sufficiently mixed, static 10min into the 25 μ l multiple PCR products of the first round；
2.2 are positioned over the multiple PCR products of mixing magnetic bead on magnetic frame, after magnetic bead is adsorbed, remove the liquid in pipe 80% ethyl alcohol of 180 μ l is added in body, stands 30s；
2.3 remove 80% ethyl alcohol, add 80% ethyl alcohol of 180 μ l, stand 30s；
2.4 remove 80% ethyl alcohol, stand 5min, and after 80% ethyl alcohol thoroughly volatilization, 30 μ l ddH are added2O is eluted；
2.5 are positioned over PCR pipe on magnetic frame, after magnetic bead is adsorbed, eluent are transferred in new PCR pipe, pipe Middle liquid is then the amplicon that the 1st wheel amplification obtains.
3rd step：Above-mentioned amplicon is quantified with Qbit quantitative instruments (Thermo scientific)；
3.1 prepare quantitative buffer solution：It takes 197 μ l dye buffers and 1 μ l fluorescent quantitations dyestuffs in quantity tube, fully mixes It is even；
The 3.2 amplicon products for obtaining 2 μ l the 1st wheels and quantitative buffer solution mixing, are protected from light and stand 2min；
3.3. quantity tube is positioned in Qbit quantitative instruments, measures the concentration of amplicon.The amplified production of Tube-1 is dense Degree is a concentration of 6.0ng/ μ l of amplified production of 5.4ng/ μ l, Tube-2.
4th step：The PCR product of Tube-1 after purification and Tube-2 is mixed
The volume of 4.1 amplified productions mixing takes turns multiple PCR products with the target area number in each reaction tube and the 1st Concentration is related.The case where being divided into 2 reaction tubes for amplicon, the amplicon number in reaction tube are respectively A and B, amplification Sub- concentration is respectively a and b, then two reaction tubes merge needed for volumes be respectively：1 and aB/Ab.In the present embodiment, Tube-1 With Tube-2 amplicon numbers be respectively 388 and 392 concentration it is respectively 5.4ng/ μ l and 6.0ng/ μ l, therefore the body of the two mixing Product ratio is about 1：0.91, mixed total volume is 5 μ l.
5th step：The 2nd wheel PCR reactions are carried out, so that amplicon both sides is taken sequence measuring joints sequence P5, (sequence is： AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT；SEQ ID NO.3) and P7 (sequence is：CAAGCAGAAGACGGCATACGAGATTCATCATTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT； SEQ ID NO.4)。
6th step：The amplified production that step 5 obtains is purified
6.1 are added 45 μ l magnetic beads, after being sufficiently mixed, static 10min into 25 μ l PCR products of the 2nd wheel；
6.2 are positioned over the PCR product of mixing magnetic bead on magnetic frame, after magnetic bead is adsorbed, remove the liquid in pipe, add Enter 80% ethyl alcohol of 180 μ l, stands 30s；
6.3 remove 80% ethyl alcohol, add 80% ethyl alcohol of 180 μ l, stand 30s；
6.4 remove 80% ethyl alcohol added, stand 5min, and after 80% ethyl alcohol thoroughly volatilization, 20 μ l TE bufferings are added Liquid elutes, and then PCR pipe is positioned on magnetic frame, after magnetic bead is adsorbed, eluent is transferred in new PCR pipe, manages Middle liquid is then the amplification sublibrary prepared.
7th step：Library is quantified
7.1 prepare quantitative buffer solution：It takes 197 μ l dye buffers and 1 μ l fluorescent quantitations dyestuffs in quantity tube, fully mixes It is even；
7.2, by 2 μ l amplification sublibraries and quantitative buffer solution mixing, are protected from light and stand 2min；
7.3. quantity tube is positioned in Qbit quantitative instruments, measures the concentration of amplicon.
8th step：The sequencing of two generations is carried out to amplification sublibrary
According to the sequencing flow that illumina companies provide, sequencing and data analysis are carried out to library.The present embodiment obtains Analysis result it is as shown in table 3, using method provided by the invention build library, comparison rate, coverage rate, capture rate, sequencing Depth is high.
Table 3：The sequencing analysis result of 760 target areas
Library title Comparison rate (%) Coverage rate (%) Capture rate (%) 20 × coverage rate A B C
Sample 1 97.76 98.26 96.47 99.91 94.07 89.97 12.37
Sample 2 95.24 98.77 95.65 99.24 94.21 88.51 13.89
Sample 3 95.65 97.89 95.75 98.78 95.03 87.62 12.48
Note：A：20% average sequencing depth percentage；B：30% average sequencing depth percentage；C：10% flank is averagely surveyed Sequence depth percentage.

Claims (14)

1. a kind of library constructing method improving amplicon literature data homogeneity, described method includes following steps：
1) it determines the amplification subsequence of multiple target areas, and multiple draw is separately designed for each the multiple amplification subsequence Universal sequence is contained at 5 ' ends of object, the multi-primers, the part held for sequence measuring joints sequence 3 '；
2) multi-primers are divided into multiple reaction tubes, the multi-primers in each reaction tube meet：
A) in each reaction tube the melting temperature of all primers standard deviation≤5 DEG C；
B) the average melting temperature T of reaction tube inner primerprimerThe melting temperature T of dimerdimer≥10℃；
C) in reaction tube target amplicon primer average melting temperature TprimerThe melting temperature of the sub- primer of non-specific amplification Tnon-specific≥10℃；
D) it will two-by-two be compared between amplicon, and to comparison result Computational Thermodynamics melting temperature Tpp, target in reaction tube The average melting temperature T of amplicon primerprimer–Tpp≥10℃；
3) original amounts for calculating every primer make each amplicon obtain homogeneity amplification, obtained amplicon concentration difference No more than 20%, and prepare according to the reaction tube divided in step 2) the multi-primers mixture of each reaction tube；
4) the 1st wheel is carried out to target area sequence to expand, obtain amplicon, and will with the multi-primers mixture of each reaction tube Universal sequence is introduced into the both sides of amplicon；
5) amplicon of each reaction tube obtained to step 4) is purified and is quantified；
6) amplicon of all reaction tubes is mixed, and the number of each amplicon is differed within 10%；
7) the 2nd wheel PCR reactions are carried out using mixed amplicon mixture as template, with sequence measuring joints primer, by sequence measuring joints It is introduced into the both sides of amplicon；
8) amplification sublibrary purified, quantified, be sequenced.
2. the method for claim 1 wherein the amplicon concentration difference obtained in step 3) to be not more than 10.
3. the method for claim 2, the amplicon concentration difference wherein obtained in step 3) is not more than 5.
4. being differed within 5% the method for claim 1 wherein the number of each amplicon is made in step 6).
5. the method for claim 1 wherein sequencing described in step 8) is to be sequenced in two generations.
6. the method for claim 1 wherein amplicon purifying to be carried out using magnetic bead.
7. the method for claims 1 or 2, wherein the sequence measuring joints are SEQ ID NO.3 and SEQ ID NO.4.
8. the method for any one of claim 1-6, wherein in each reaction tube the melting temperature of all primers standard deviation≤2 ℃。
9. the method for any one of claim 1-6, the wherein average melting temperature of reaction tube inner primer are TprimerDimer Melting temperature Tdimer≥15℃。
10. the method for any one of claim 1-6, the average melting temperature T of target amplicon primer wherein in reaction tubeprimer– The melting temperature of the sub- primer of non-specific amplification is Tnon-specific≥15℃。
11. the method for any one of claim 1-6, the average melting temperature of target amplicon primer is wherein in reaction tube Tprimer–Tpp≥15℃。
12. the method for any one of claim 1-6, wherein making the number of each amplicon differ within 10%, by as follows It carries out：
For the primer in each reaction tube, the equilibrium equation that primer A is combined with DNA profiling is：Wherein in temperature It spends under t, there is the equilibrium constantWherein Δ GA=-RT × ln (KA), [AT] is amplified production concentration, [A] is primer A concentration, [T] are template concentrations, R is gas constant, are approximately equal to 1.9872cal/ (Kmol), T is absolute temperature, for primer B has same calculation formulaWherein Δ GB=-RT × ln (KB), [BT] is amplified production concentration, [B] is to draw Object B concentration, [T] are template concentrations, R is gas constant, are approximately equal to 1.9872cal/ (Kmol), T is absolute temperature so that [AT]=[BT], therefore have formula：And for every primer, Δ G is Gibbs free amount, by being based on heat The nearest neighbor algorithm of mechanics, which calculates, to be obtained；
For the primer in each reaction tube, select the concentration of any one primer as benchmark concentration, remaining each draw Object calculates the ratio with benchmark primer concentration by above formula, so that it is determined that the concentration of each primer.
13. the method for any one of claim 1-6, wherein making the number of each amplicon differ within 10%, by as follows Mode is realized：Required volume, the volume when each reaction tube merges is adjusted to be determined by the number and concentration of amplicon in each reaction tube It is fixed.
14. the method for claim 9, wherein amplicon are divided into 3 reaction tubes, the amplicon number difference in each reaction tube For A, B and C, corresponding concentration is respectively a, b and c, then the volume needed for the merging of these three reaction tubes is respectively：1,aB/Ab And aC/Ac.
CN201610801187.4A 2016-09-03 2016-09-03 A kind of library constructing method improving amplicon literature data homogeneity Active CN106283200B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610801187.4A CN106283200B (en) 2016-09-03 2016-09-03 A kind of library constructing method improving amplicon literature data homogeneity

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610801187.4A CN106283200B (en) 2016-09-03 2016-09-03 A kind of library constructing method improving amplicon literature data homogeneity

Publications (2)

Publication Number Publication Date
CN106283200A CN106283200A (en) 2017-01-04
CN106283200B true CN106283200B (en) 2018-11-09

Family

ID=57710844

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610801187.4A Active CN106283200B (en) 2016-09-03 2016-09-03 A kind of library constructing method improving amplicon literature data homogeneity

Country Status (1)

Country Link
CN (1) CN106283200B (en)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107217102B (en) * 2017-07-14 2018-09-28 艾吉泰康生物科技(北京)有限公司 A kind of the primer sequence group and method in quickly and efficiently quality inspection library
CN109321634A (en) * 2017-07-26 2019-02-12 上海之江生物科技股份有限公司 Nucleic acid uniforms method and its kit and application
CN108103143B (en) * 2017-12-15 2021-11-09 序康医疗科技（苏州）有限公司 Method for constructing multiple PCR and rapid library in target region
CN110878334B (en) * 2019-11-12 2022-08-12 北京康普森生物技术有限公司 Primer for sequencing amplicon and two-step PCR library building method
CN114606576B (en) * 2022-04-08 2024-09-17 世华医学科技(苏州)有限公司 Method for constructing hybridization capture sequencing library

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004024314A2 (en) * 2002-09-11 2004-03-25 Exiqon A/S A population of nucleic acids including a subpopulation of lna oligomers
CN104790042A (en) * 2015-05-05 2015-07-22 天津诺禾致源生物信息科技有限公司 High-throughput sequencing library and building method thereof
CN105219766A (en) * 2015-11-10 2016-01-06 东华大学 A kind of multiple PCR method of three-wheel amplification
CN105695581A (en) * 2016-03-10 2016-06-22 东华大学 Medium-throughput gene expression analysis method based on second-generation test platform
WO2016138376A1 (en) * 2015-02-26 2016-09-01 Asuragen, Inc. Methods and apparatuses for improving mutation assessment accuracy

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004024314A2 (en) * 2002-09-11 2004-03-25 Exiqon A/S A population of nucleic acids including a subpopulation of lna oligomers
WO2016138376A1 (en) * 2015-02-26 2016-09-01 Asuragen, Inc. Methods and apparatuses for improving mutation assessment accuracy
CN104790042A (en) * 2015-05-05 2015-07-22 天津诺禾致源生物信息科技有限公司 High-throughput sequencing library and building method thereof
CN105219766A (en) * 2015-11-10 2016-01-06 东华大学 A kind of multiple PCR method of three-wheel amplification
CN105695581A (en) * 2016-03-10 2016-06-22 东华大学 Medium-throughput gene expression analysis method based on second-generation test platform

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Illumina sequencing library preparation for highly multiplexed target capture and sequencing;Matthias Meyer et al;《Cold Spring Harb Protoc》;20101231;全文 *
The effect of temperature and oligonucleotide primer length on the;DAN Y.WU;《DNA and Cell Biology》;20090325;233-238 *

Also Published As

Publication number Publication date
CN106283200A (en) 2017-01-04

Similar Documents

Publication Publication Date Title
CN106283200B (en) A kind of library constructing method improving amplicon literature data homogeneity
Hosokawa et al. Massively parallel whole genome amplification for single-cell sequencing using droplet microfluidics
CN105219766B (en) A kind of multiple PCR method of three-wheel amplification
White et al. High-throughput microfluidic single-cell digital polymerase chain reaction
CN106555226B (en) A kind of method and kit constructing high-throughput sequencing library
US20220411859A1 (en) Hydrogel beads for nucleotide sequencing
EP3458597B1 (en) Quantitative real time pcr amplification using an electrowetting-based device
CN107236729A (en) The method and kit of a kind of rapid build target nucleic acid sequencing library that enrichment is captured based on probe
CN103370425B (en) For the method for nucleic acid amplification, composition, system, instrument and kit
Matochko et al. Next-generation sequencing of phage-displayed peptide libraries
CN106811460B (en) Construction method and kit of next-generation sequencing library for low-frequency mutation detection
CN106282353A (en) A kind of method utilizing clamp primers to carry out multiplex PCR
Wang et al. Accelerating the understanding of cancer biology through the lens of genomics
CN103502448A (en) Methods and devices for nucleic acids synthesis
CN107760772A (en) For the method for nucleic acid match end sequencing, composition, system, instrument and kit
CN108430617A (en) It is prepared by the library for the based on PCR that drop divides
CN108138365A (en) A kind of unicellular transcript profile banking process of high throughput
Ameta et al. Darwinian properties and their trade-offs in autocatalytic RNA reaction networks
CN107904666A (en) A kind of library construction and quantitative approach applied to tumour driving genetic test
CN108866051A (en) Amplicon sequencing library and its construction method
Paul et al. Assessment of RainDrop BS-seq as a method for large-scale, targeted bisulfite sequencing
KR20170133270A (en) Method for preparing libraries for massively parallel sequencing using molecular barcoding and the use thereof
Radpour et al. Single-cell analysis of tumors: Creating new value for molecular biomarker discovery of cancer stem cells and tumor-infiltrating immune cells
CN112266948A (en) High-throughput targeting library building method and application
CN103571822A (en) Multipurpose DNA segment enrichment method used for next generation sequencing

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right

Effective date of registration: 20190823

Address after: 314100 Building No. 2, 371 Hongye Road, Dayun Town, Jiashan County, Jiaxing City, Zhejiang Province 101

Patentee after: Aiji Taikang (Jiaxing) Biotechnology Co., Ltd.

Address before: 102206 Beijing City, Changping District Beijing city Zhongguancun Life Science Park Life Road No. 8 School District No. 9 Building 3 Room 301

Patentee before: IGENETECH CO., LTD.

TR01 Transfer of patent right