CN106282345A - A kind of differentiate Oryza sativa L. phytochrome gene PHYB wild type and the molecular marker of mutant - Google Patents
A kind of differentiate Oryza sativa L. phytochrome gene PHYB wild type and the molecular marker of mutant Download PDFInfo
- Publication number
- CN106282345A CN106282345A CN201610671769.5A CN201610671769A CN106282345A CN 106282345 A CN106282345 A CN 106282345A CN 201610671769 A CN201610671769 A CN 201610671769A CN 106282345 A CN106282345 A CN 106282345A
- Authority
- CN
- China
- Prior art keywords
- mutant
- phyb
- wild type
- primer
- oryza sativa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses and a kind of differentiate Oryza sativa L. phytochrome gene PHYB wild type and the molecular marker of mutant.Detecting relevant labelling to phyB wild type and mutational site, its nucleotide sequence is respectively as shown in Seq No.1 2.Utilizing primer PHYBF4/PHYBR1 to carry out PCR amplification, amplified production carries out BamH I enzyme action and carries out electrophoretic analysis: if PCR primer for 175bp DNA fragmentation, then can not be wild type phyB by BamH I enzyme action；If able to by BamH I enzyme action, digestion products is 25bp and two DNA fragmentations of 151bp, then it is mutant phyB1.It is simple, quick that the molecular marker of the present invention has amplification, the advantage of low cost.This molecular marker phyB allelotype can be carried out effective, quick, identify reliably, for follow-up, phyB mutant is applied to the instrument that breeding population screening provides strong.
Description
Technical field
The present invention relates to a kind of differentiate Oryza sativa L. phytochrome gene PHYB wild type and the molecular marker of mutant, belong to and plant
Thing biological technical field.
Background technology
Higher plant utilizes phytochrome (phytochromes), cryptochrome (cryptochromes) and image assesment
(phototropins) light receptor such as, experiences the change of the condition such as light quality, light intensity, photoperiod in its growing environment, regulates self
Growth promoter, to adapt to surrounding to greatest extent.Wherein, phytochrome mainly experiences HONGGUANG (red light, R) and remote
HONGGUANG (far-red light, FR).In Oryza sativa L., phytochrome gene family includes 3 members: PHYA, PHYB and PHYC.Wherein
PHYB gene is positioned at the 3rd the short arm of a chromosome of Oryza sativa L., for single copy.Takano etc. (2005) are sieved by gamma ray induced mutation
Choosing has obtained multiple phyB mutant, is respectively designated as phyB1～phyB5.Wherein phyB1 mutant is at PHYB gene internal
At 1644bp insert base C, thus cause translation in advance terminate (Takano etc., 2005, Plant Cell, 2005,17:
3311-3325).By the photomorphogenesis feature of analyzing rice phytochrome mutant, find that phyB is at rice growth
With Stress responses has important function.Under the conditions of phyB mutant either long-day conditions or short-day, florescence is equal
The most in advance (Takano etc., 2005, Plant Cell, 2005,17:3311-3325)；Its drought stress patience is also remarkably reinforced
(Liu etc., 2012, Plant Mol Biol., 78 (3): 289-300)；And for rice blast, there is certain resistance (Xie
Deng, 2011, Mol.Plant 4 (4): 688-696).And the plant height of phyB mutant, grain number per spike, the economical character such as setting percentage with
Fine the comparing of wild rice Japan does not has notable difference (Takano etc., 2005, Plant Cell, 2005,17:3311-3325).
Therefore phyB mutant can be cultivated for rice varieties precocious, disease-resistant, drought-enduring as a kind of important germ plasm resource.
In order to phyB mutant is preferably applied in breeding, exploitation one distinguish simply and easily phyB mutant with
The molecular marker of other conventional rice kinds, to realize effective, reliable, the Rapid identification of phyB allelotype, in follow-up profit
Carry out that breeding population screening has important value with phyB mutational site.Although Takano etc. (2005) " Distinct and
Cooperative Functions of Phytochromes A,B,and C in the Control of
Deetiolation and Flowering in Rice " (The Plant Cell, Vol.17,3311 3325) article in
Developing a kind of molecular marker identifying phyB1 mutant, but this labelling amplified fragments is relatively big (1Kb), G/C content is higher,
Expand with the PCR buffer of high GC, and PCR proliferation time is longer, and for the restricted enzyme NlaIV of enzyme action
Belong to rare restricted enzyme, buy difficulty, and expensive (3.49 yuan/U, NEB Beijing), improve appraisal cost,
It is not suitable for identifying on a large scale；Often occur there is no the phenomenon such as stock, supply shortage, have a strong impact on appraisal and be smoothed out.
Summary of the invention
The primary and foremost purpose of the present invention is to overcome the deficiencies in the prior art, it is provided that a kind of mirror simple, effective, lower-cost
Other Oryza sativa L. phytochrome gene PHYB wild type and the molecular marker of mutant and primer.Another object of the present invention is to provide
The application of above-mentioned molecular marker.
The technical scheme is that and a kind of differentiate Oryza sativa L. phytochrome gene PHYB wild type and the molecule mark of mutant
Note, is characterized in that,
The nucleotide sequence as follows (Seq No.1) relevant to the detection of phyB wild type site:
TGTCACACAAAGCCCCAGCATCATGGACCTTGTGAAGTGTGATGGTGCTGCTCTGTATTACCATGGGAAGTACTACC
CTCTTGGTGTCACTCCCACAGAAGTTCAGATTAAGGACATCATCGAGTGGTTGACTATGTGCCATGGAGACTCCACA
GGGCTCAGCACAGATAGCCTT。
The nucleotide sequence as follows (Seq No.2) relevant to the detection of phyB mutant site:
TGTCACACAAAGCCCCAGCATCATGGACCCTTGTGAAGTGTGATGGTGCTGCTCTGTATTACCATGGGAAGTACTAC
CCTCTTGGTGTCACTCCCACAGAAGTTCAGATTAAGGACATCATCGAGTGGTTGACTATGTGCCATGGAGACTCCAC
AGGGCTCAGCACAGATAGCCTT。
Described phytochrome mutant phyB mutant is phyB1 mutant.
The invention also discloses a kind of for identify above-mentioned Oryza sativa L. phytochrome gene PHYB wild type and mutant point
The primer of sub-labelling, particularly as follows:
Forward primer PHYBF4:5 '-TGTCACACAAAGCCCCAGCATCATGGATC-3 ' (Seq No.3)；
Downstream primer PHYBR1:5 '-AAGGCTATCTGTGCTGAGCC-3 ' (Seq No.4).
Described for identifying that the molecular marker of Oryza sativa L. phytochrome gene PHYB wild type and mutant is at rice germplasm
Application in resource qualification or breeding assist-breeding.
Apply above-mentioned primer to identify Oryza sativa L. phytochrome gene PHYB wild type and the method for mutant, it is characterized in that, bag
Include following steps:
(1) utilize forward primer PHYBF4 and downstream primer PHYBR1 that oryza sativa genomic dna is carried out PCR amplification；
(2) pcr amplification product obtaining step (1) carries out electrophoretic analysis:
If pcr amplification product size is 175bp DNA fragmentation, then it is wild type phyB；
If pcr amplification product size is 176bp DNA fragmentation, then it is mutant phyB1；
(3) PCR primer obtaining step (1) carries out BamH I enzyme action and carries out electrophoretic analysis:
If PCR primer can not be still 175bp DNA fragmentation by BamH I enzyme action, then it is wild type phyB；
If PCR primer can be by BamH I enzyme action, digestion products is 25bp and two DNA fragmentations of 151bp, then be prominent
Variant phyB1.
PCR amplification system described in step (1) can utilize regular-PCR buffer to expand, it is also possible to uses PCR
Mix expands, and preferred system is 20 μ L systems, expands with PCR mix.This experiment PCR mix used is that full formula gold is public
Department 2 × EasyTaq PCR SuperMix (+dye), PCR reaction system includes following component:
Pcr amplification reaction program described in step (1) is preferably: 94 DEG C of denaturations 3min；94 DEG C of 30s, 60 DEG C of 30s, 72
DEG C 30s, 35 circulations；5min is extended after 72 DEG C.
Above-mentioned rice strain can be Japan's fine kind of report (open), new rice 18 (state examines rice 2008028) and
Face the rice strains such as rice 11 (Lu Nong examines word [2004] 014).
The present invention has such advantages as and effect relative to existing technology:
(1) develop a kind of for distinguish Oryza sativa L. phytochrome gene phyB mutant and other conventional rice kinds point
Sub-labeled primer PHYBF4/PHYBR1, thus phyB allelotype is carried out effective, quick, identify reliably, for follow-up will
PhyB mutant is applied to breeding population screening and provides powerful.
(2) the functional label primer PHYBF4/PHYBR1 of the present invention utilizes regular-PCR technology, it is possible to specific detection
PhyB mutant.Compared with existing labelling, the amplification of this labelling is simpler, quick；PCR amplification program time (1h) well below
Former markd time (2h) (Takano etc., 2005, Plant Cell, 2005,17:3311-3325)；PCR primer enzyme action institute
Restricted enzyme BamH I commonly use enzyme for molecular biology, all conventional stock of each company does not haves because supply shortage causes
Experiment disruption；(3.49 yuan/U, NEB is northern well below NlaIV for the price (0.0478 yuan/U, NEB Beijing) of BamH I simultaneously
Capital), it is substantially reduced cost.This labelling can carry out gene type to different rice material phyB1 mutant alleles, and
Can be applied to breeding cross as a kind of molecular marker, the segregating population that backcrosses is identified, improves molecular marker assisted selection breeding effect
Rate.
Accompanying drawing explanation
Fig. 1 Oryza sativa L. phytochrome PHYB wild-type sequence and phyB1 mutant sequence difference site comparison result；
Fig. 2, for utilizing this labeled primer PHYBF4/PHYBR1, utilizes 2 × GC buffer (TAKARA), 2 × PCR Mix
(TRANSGEN) and 10 × PCR buffer (TAKARA) carries out the result of PCR amplification；Wherein M:500bp DNA ladder；1:
Japan is fine；2:phyB1 mutant；3: new rice 18；4: new rice 18/phyB1 mutant F1；5: face rice 11；6: face rice 11/phyB1
Mutant F1；
Fig. 3 is for utilizing this labeled primer PHYBF4/PHYBR1, with 2 × GC buffer (TAKARA), 2 × PCR Mix
(TRANSGEN) and 10 × PCR buffer (TAKARA) carries out PCR amplification, and amplified production BamH I carries out the result of enzyme action；
Middle M:500bp DNA ladder；1: Japan is fine；2:phyB1 mutant；3: new rice 18；4: new rice 18/phyB1 mutant F1；
5: face rice 11；6: face rice 11/phyB1 mutant F1；
Fig. 4, for utilizing original labeled primer PHYBF1/PHYBR2, utilizes 2 × GC buffer (TAKARA), 2 × PCR
Mix (TRANSGEN) and 10 × PCR buffer (TAKARA) carries out the result of PCR amplification；Wherein M:2Kb DNA ladder；
1: Japan is fine；2:phyB1 mutant；3: new rice 18；4: new rice 18/phyB1 mutant F1；5: face rice 11；6: face rice 11/
PhyB1 mutant F1；
Fig. 5 is for utilizing original labelling PHYBF1/PHYBR2, with 2 × GC buffer (TAKARA) and 2 × PCR Mix
(TRANSGEN) carrying out PCR amplification, amplified production NlaIV carries out the result of enzyme action；Wherein M:2Kb DNA ladder；1: day
This is fine；2:phyB1 mutant；3: new rice 18；4: new rice 18/phyB1 mutant F1；5: face rice 11；6: face rice 11/phyB1 and dash forward
Variant F1。
Detailed description of the invention
Below in conjunction with embodiment and accompanying drawing, the present invention is described in further detail.Real with these according to description below
Executing example, those skilled in the art may determine that the basic feature of the present invention, but embodiments of the present invention are not limited to this.
Embodiment 1: the foundation of a kind of molecular marker differentiating Oryza sativa L. phytochrome gene PHYB wild type and mutant
(1) design of primers
Known phyB1 mutant inserts base C at PHYB gene internal 1644bp, thus causes translation the most eventually
Only (Takano etc., 2005, Plant Cell, 2005,17:3311-3325).Before and after mutational site, choose 175bp sequence enter
Row comparison (Fig. 1), according to sequence difference, practical dCAPS Finder 2.0 Photographing On-line software (http:// helix.wustl.edu/dcaps/dcaps.html) design primer, primer sequence is as follows:
Forward primer PHYBF4:5 '-TGTCACACAAAGCCCCAGCATCATGGATC-3 ' (Seq No.3)；
Downstream primer PHYBR1:5 '-AAGGCTATCTGTGCTGAGCC-3 ' (Seq No.4).
(2) amplified fragments theory analysis
Oryza sativa L. wild type gene group DNA can amplify the fragment (sequence 1) of a 175bp；PhyB mutant gene group DNA
Year can amplify the fragment (sequence 2) of 1 176bp；Wild type gene group DNA cloning fragment can not be by BamH I enzyme action, and phyB dashes forward
Variant gene group amplified fragments can be become two DNA fragmentations of 25bp and 151bp by BamH I enzyme action.
Seq No.1:
TGTCACACAAAGCCCCAGCATCATGGACCTTGTGAAGTGTGATGGTGCTGCTCTGTATTACCATGGGAAGTACTACC
CTCTTGGTGTCACTCCCACAGAAGTTCAGATTAAGGACATCATCGAGTGGTTGACTATGTGCCATGGAGACTCCACA
GGGCTCAGCACAGATAGCCTT。
Seq No.2:
TGTCACACAAAGCCCCAGCATCATGGACCCTTGTGAAGTGTGATGGTGCTGCTCTGTATTACCATGGGAAGTACTAC
CCTCTTGGTGTCACTCCCACAGAAGTTCAGATTAAGGACATCATCGAGTGGTTGACTATGTGCCATGGAGACTCCAC
AGGGCTCAGCACAGATAGCCTT。
Embodiment 2: utilize 6 Oryza sativa L. materials of molecular marker analysis of Oryza sativa L. phytochrome gene PHYB wild type and mutant
Material PHYB genotype
(1) extraction of rice leaf genomic DNA
Test material include Oryza sativa L. wild type Japan fine (numbering 1), phyB1 mutant (numbering 2), new rice 18 (numbering 3),
New rice 18/phyB1 hybridizes F1(numbering 4), face rice 11 (numbering 5), face rice 11/phyB1 hybridize F1(numbering 6).
Choose the young leaflet tablet of Oryza sativa L. individual plant, use SDS method to extract the genomic DNA of Oryza sativa L., specifically comprise the following steps that
1. take appropriate blade to be placed in 2mL centrifuge tube, add DNA extraction liquid 300 μ L, add steel ball one piece, broken with tissue
Breakdown mill instrument concussion about 30s；
2. centrifuge tube is placed in 65 DEG C of water-bath 30min, and period turns upside down and mixes 2-3 time；
3. stand to room temperature, add isopyknic chloroform, be aggressively shaken up and down, fully mix；
4. 12000rpm is centrifuged 10min, sucts honest and upright and thrifty 200 μ L in the 1.5mL centrifuge tube of new sterilizing；
5. add the isopropanol of isopyknic pre-cooling to turn upside down mixing, place about 30min, make DNA the most heavy for-20 DEG C
Form sediment；
6. 12000rpm is centrifuged 10min, outwells supernatant, adds 500 μ L 75% ethanol rinse once；
7. 12000rpm moment is centrifuged, and is upside down on napkin by centrifuge tube after outwelling supernatant, stands 2min；
8. appropriate 1 × TE buffer dissolving DNA is added in ventilating kitchen after dry DNA；
9.-20 DEG C of preservations it are placed in, standby.
(2) discriminating Oryza sativa L. phytochrome gene PHYB wild type and 6 Oryza sativa L. materials of molecular marker analysis of mutant are utilized
Material PHYB genotype
Utilizing and identify that primer PHYBF4 (Seq No.3)/PHYBR1 (Seq No.4) carries out PCR amplification, reaction system is respectively
Be 2 × GC buffer (TAKARA), 2 × PCR Mix (TRANSGEN) and 10 × PCR buffer (TAKARA), wherein 20 μ L
2 × PCR Mix (TRANSGEN) system is: DNA profiling 2 μ L, 10 μMs of each 0.3 μ L of primer (PHYBF4 and PHYBR1), 2 ×
EasyTaq PCR SuperMix 10 μ L, uses ddH20 supplies 20 μ L；PCR response procedures is: 94 DEG C of denaturations 3min, 94 DEG C of changes
Property 30s, 60 DEG C of renaturation 30s, 72 DEG C extend 30s, totally 35 circulations, then extension 5min after 72 DEG C.
(3) agarose gel electrophoresis detection, enzyme action and the genotype of amplified production judges
Pcr amplification product, through the agarose gel electrophoresis (1 × TAE, 120V, time 20min) of 2%, utilizes monarch to anticipate solidifying
Glue imaging system is observed, found that this primer can amplify single in wild type and mutant, clearly, the brightest
Bright band.Clip size and expection consistent (Fig. 2).Wherein the expanding effect of 2 × PCR Mix (TRANSGEN) system is best,
Band is the most clear.
Pcr amplification product BamH I (TAKARA) carries out enzyme action, and enzyme action system is: 10 × buffer 2 μ L, PCR primer
Take 10 μ L, BamH I 1U, use ddH2O polishing is to 20 μ L, 30 DEG C of enzyme action 1h.Then electrophoresis detection is carried out with the agarose gel of 3%
(1 × TAE, 120V, time 25min), utilize monarch anticipate gel imaging system observe, found that wild type remains as a list
One, band clearly, and phyB mutant band is significantly less than wild type, this is because enzyme action falls 25bp, but due to 25bp
Band is the least cannot be shown on gel；Hybridization F1 individual plant has two obvious bands, and size is big with wild type and mutant respectively
Little consistent (Fig. 3).Wherein the enzyme action effect of the amplified production of 2 × PCR Mix (TRANSGEN) system is best, and band is the most clear.
It is consistent with corresponding material banding pattern that above-mentioned genotype runs cementing fruit, consistent with expected results.Prove the mark of exploitation
Note can effectively distinguish wild type and mutant.
(4) with the comparative analysis of original identification marking
According to Takano etc., 2005, Plant Cell, the primer PHYBF1/ in 2005,17:3311-3325 articles
The above-mentioned primer of PHYBR2 sequent synthesis, primer sequence is as follows:
Forward primer PHYBF1:5 '-GGGTTCCATTGCATCTCTTG-3 ' (Seq No.5)；
Downstream primer PHYBR2:5 '-TTGCCCATTgCTTCCTCAAC-3 ' (Seq No.6).
Utilize above-mentioned primer PHYBF1 (Seq No.5)/PHYBR2 (Seq No.6), wild type and mutant are carried out PCR
Amplification, reaction system is 20 μ L systems: DNA profiling 2 μ L, 10 μMs of each 0.3 μ L of primer (PHYBF1 and PHYBR2), 2 × EasyTaq
PCR SuperMix 10 μ L, uses ddH2O supplies 20 μ L；PCR response procedures is: 94 DEG C of denaturations 3min, 94 DEG C of degeneration 1min,
60 DEG C of renaturation 1min, 72 DEG C extend 1min, totally 35 circulations, then extension 5min after 72 DEG C.Result is shown in Fig. 4, Fig. 4 can see
Going out, primer PHYBF1/PHYBR2 amplification condition requires higher, and the GC buffer and high efficiency PCR mix of the highest GC can
Amplification smoothly, and common 10 × PCR buffer can not effectively expand.The PCR program response time is longer simultaneously, PCR instrument
Actual run time was more than 2 hours.New labelling is greatly saved the time in contrast, can utilize common with stylish labelling
10 × PCR buffer expands, and provides cost savings.
The PCR primer of original identification marking PHYBF1/PHYBR2 amplification wild type and phyB mutant all can be by NlaIV
(NEB) enzyme action (Fig. 5)；Enzyme action system is: 10 × buffer 2 μ L, and PCR primer takes 10 μ L, NlaIV 1U, uses ddH2O polishing is extremely
20 μ L, 37 DEG C of enzyme action 1h.Then carry out electrophoresis detection (1 × TAE, 120V, time 25min) with the agarose gel of 1%, utilize
Monarch anticipate gel imaging system observe.Wherein wild type is that two clip size are respectively 564bp and 437bp, phyB sudden change physical ability
Enough is three bar segment by NlaIV (NEB) enzyme action, and size is respectively 437bp, 323bp and 242bp；Heterozygote banding pattern then has four
Bar segment, size is 564bp, 437bp, 323bp and 242bp (Fig. 5) respectively.Newly labelling is in contrast, enzyme used by new labelling
BamH I commonly uses enzyme for molecular biology, and all there are stock or product in each Reagent Company；And restricted enzyme used by former labelling
NlaIV is rare restricted enzyme, it is difficult to buy (such as: the product that TAKARA company is not correlated with).Used by new labelling
Enzyme BamH I price (0.0478 yuan/U, NEB Beijing), well below NlaIV (3.49 yuan/U, NEB Beijing), is more saved into
This；Additionally new marker bands: wild type 175bp, saltant type 151bp, heterozygosis is two 175bp and 151bp, relative to former labelling
Banding pattern is simpler, it is easier to interpretation (Fig. 2).
In sum, wild type and mutant can not only be effectively distinguished in the exploitation of new labelling, and with original labelling
Compare the most time-consuming and cost.It it is effective, quick, a cheap molecule mark identifying phytochrome PHYB mutant
Note.
Above-described embodiment is the present invention preferably embodiment, but embodiments of the present invention are not by above-described embodiment
Limit, the change made under other any spirit without departing from the present invention and principle, modify, substitute, simplification etc. all should
For equivalence substitute mode, within being included in protection scope of the present invention.
Claims (10)
1. differentiate Oryza sativa L. phytochrome gene PHYB wild type and a molecular marker for mutant, it is characterized in that, wild with phyB
The labelling that the detection of raw type site is relevant, its nucleotide sequence is as shown in Seq No.1；Relevant to the detection of phyB mutant site
Labelling, its nucleotide sequence is as shown in Seq No.2.
The most as claimed in claim 1 a kind of differentiate Oryza sativa L. phytochrome gene PHYB wild type and the molecular marker of mutant,
It is characterized in that, described phyB mutant is phyB1 mutant.
3. one kind is used for differentiating the Oryza sativa L. phytochrome gene PHYB wild type described in claim 1 or 2 and the molecule of mutant
The primer of labelling, is characterized in that, described primer is:
Forward primer PHYBF4:5 '-TGTCACACAAAGCCCCAGCATCATGGATC-3 '；
Downstream primer PHYBR1:5 '-AAGGCTATCTGTGCTGAGCC-3 '.
4. the answering in differentiating Oryza sativa L. phytochrome gene PHYB wild type and mutant of the molecular marker described in claim 1
With.
5. the application in Rice Germplasm Resources qualification or breeding assist-breeding of the molecular marker described in claim 1.
6. the application in differentiating Oryza sativa L. phytochrome gene PHYB wild type and mutant of the primer described in claim 3.
7. the application process described in claim 6, is characterized in that,
(1) utilize forward primer PHYBF4 and downstream primer PHYBR1 that oryza sativa genomic dna is carried out PCR amplification；
(2) pcr amplification product obtaining step (1) carries out electrophoretic analysis:
If pcr amplification product size is 175bp DNA fragmentation, then it is wild type phyB；
If pcr amplification product size is 176bp DNA fragmentation, then it is mutant phyB1.
8. the application process described in claim 6, is characterized in that,
(1) utilize forward primer PHYBF4 and downstream primer PHYBR1 that oryza sativa genomic dna is carried out PCR amplification；
(2) PCR primer obtaining step (1) carries out BamH I enzyme action and carries out electrophoretic analysis:
If PCR primer for 175bp DNA fragmentation, then can not be wild type phyB by BamH I enzyme action；
If PCR primer can be by BamH I enzyme action, digestion products is 25bp and two DNA fragmentations of 151bp, then be mutant
phyB1。
9. application process as claimed in claim 7 or 8, is characterized in that, PCR amplification system described in step (1) is 20 μ L bodies
System, including following component: 50ng/ μ L genomic DNA 2 μ L；10 μMs of forward primer PHYBF4 0.3 μ L；10 μMs of downstream primers
PHYBR1 0.3μL；2×EasyTaq PCR SuperMix 10μL；ddH2O supplies 20 μ L.
10. application process as claimed in claim 7 or 8, is characterized in that, the pcr amplification reaction program described in step (1) is:
94 DEG C of denaturations 3min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s, 35 circulations；5min is extended after 72 DEG C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610671769.5A CN106282345B (en) | 2016-08-16 | 2016-08-16 | A kind of molecular labeling identifying rice phytochrome gene PHYB wild type and mutant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610671769.5A CN106282345B (en) | 2016-08-16 | 2016-08-16 | A kind of molecular labeling identifying rice phytochrome gene PHYB wild type and mutant |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106282345A true CN106282345A (en) | 2017-01-04 |
| CN106282345B CN106282345B (en) | 2019-09-06 |
Family
ID=57671510
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610671769.5A Active CN106282345B (en) | 2016-08-16 | 2016-08-16 | A kind of molecular labeling identifying rice phytochrome gene PHYB wild type and mutant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106282345B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107475426A (en) * | 2017-09-25 | 2017-12-15 | 山东省水稻研究所 | A kind of molecular labeling for differentiating cultivation rice varieties indica rice type and application |
| CN107475254A (en) * | 2017-09-29 | 2017-12-15 | 江苏丘陵地区镇江农业科学研究所 | A kind of eary maturity of rice allele, its molecular labeling and application |
| CN111560458A (en) * | 2020-05-27 | 2020-08-21 | 山东省水稻研究所 | Molecular marker primer for rapidly and efficiently identifying rice phytochrome gene PHYB and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103497948A (en) * | 2013-09-12 | 2014-01-08 | 山东省农业科学院蔬菜研究所 | Molecular marker closely linked with celery cabbage PHYB gene promoter allelic variation type phyB1/B2 and application of molecular marker |
| CN105154531A (en) * | 2015-07-28 | 2015-12-16 | 华南农业大学 | Molecular marker for identifying wild type and mutant of 1000-grain weight gene TGW6 of rice |
-
2016
- 2016-08-16 CN CN201610671769.5A patent/CN106282345B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103497948A (en) * | 2013-09-12 | 2014-01-08 | 山东省农业科学院蔬菜研究所 | Molecular marker closely linked with celery cabbage PHYB gene promoter allelic variation type phyB1/B2 and application of molecular marker |
| CN105154531A (en) * | 2015-07-28 | 2015-12-16 | 华南农业大学 | Molecular marker for identifying wild type and mutant of 1000-grain weight gene TGW6 of rice |
Non-Patent Citations (2)
| Title |
|---|
| MAKOTO等: "Distinct and Cooperative Functions of Phytochromes A, B, and C in the Control of Deetiolation and Flowering in Rice", 《THE PLANT CELL》 * |
| 伊正君等: "《临床分子诊断学实验》", 31 January 2014, 华中科技大学出版社 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107475426A (en) * | 2017-09-25 | 2017-12-15 | 山东省水稻研究所 | A kind of molecular labeling for differentiating cultivation rice varieties indica rice type and application |
| CN107475254A (en) * | 2017-09-29 | 2017-12-15 | 江苏丘陵地区镇江农业科学研究所 | A kind of eary maturity of rice allele, its molecular labeling and application |
| CN111560458A (en) * | 2020-05-27 | 2020-08-21 | 山东省水稻研究所 | Molecular marker primer for rapidly and efficiently identifying rice phytochrome gene PHYB and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106282345B (en) | 2019-09-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hasan et al. | Recent advancements in molecular marker-assisted selection and applications in plant breeding programmes | |
| Nadeem et al. | DNA molecular markers in plant breeding: current status and recent advancements in genomic selection and genome editing | |
| Ram et al. | Genetic diversity among cultivars, landraces and wild relatives of rice as revealed by microsatellite markers | |
| CN107475426B (en) | A kind of molecular labeling for differentiating cultivation rice varieties indica rice type and application | |
| CN102766623B (en) | Drought-enduring maize germplasm identification and screening CAPS (cleaved amplified polymorphic sequence) marker and test method and application thereof | |
| CN106755437A (en) | A kind of SNP marker of identification of being bloomed for Chinese cabbage group bolting | |
| CN107312870A (en) | With molecular labeling, method and the application of capsicum sterile restoring gene close linkage | |
| CN106282345B (en) | A kind of molecular labeling identifying rice phytochrome gene PHYB wild type and mutant | |
| CN114717355A (en) | Watermelon whole genome SNP-Panel | |
| CN106701751B (en) | Molecular labeling and application with the long QTL QFll.sicau-4D close linkage of wheat flag leaf | |
| CN106755465B (en) | Molecular marker closely linked with wheat flag leaf length QTL QFLL | |
| Alhasnawi et al. | Application of inter simple sequence repeat (ISSR) for detecting genetic analysis in rice (Oryza sativa L.) | |
| Hu et al. | Fine mapping of a major quantitative trait locus, qgnp7 (t), controlling grain number per panicle in African rice (Oryza glaberrima S.) | |
| Książkiewicz et al. | Molecular marker resources supporting the Australian lupin breeding program | |
| Chunwongse et al. | Development of di-nucleotide microsatellite markers and construction of genetic linkage map in mango (Mangifera indica L.). | |
| Wang et al. | An extended random primer amplified region (ERPAR) marker linked to a dominant male sterility gene in cabbage (Brassica oleracea var. capitata) | |
| CN105524994B (en) | The molecular labeling HRM7 of barley grain length gene Lkl2 a kind of and its application | |
| Liu et al. | Introgression of sharp eyespot resistance from Dasypyrum villosum chromosome 2VL into bread wheat | |
| CN102286624B (en) | Qualitative and quantitative PCR (polymerase chain reaction) detection method for strain specificity of transgenic carnation Moonlite | |
| CN105671039B (en) | The molecular labeling indel15-1 of soybean early flowering season main effect QTL and its application | |
| CN108588261A (en) | A kind of identification is located at InDel primers and its application of the late bolting QTL on radish R02 chromosomes | |
| Su et al. | Validation of a set of informative simple sequence repeats markers for variety identification in Pak‐choi (Brassica rapa L. ssp. chinensis var. communis) | |
| Nouroz et al. | Identification and characterization of mobile genetic elements LINEs from Brassica genome | |
| CN105524993B (en) | The molecular labeling HRM1 of barley grain length gene Lkl1 a kind of and its application | |
| Sathishkumar et al. | Mining of simple sequence repeats in the Genome of Gentianaceae |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |