CN106282185B

CN106282185B - Complete siRNA for inhibiting expression of clusterin gene and application thereof

Info

Publication number: CN106282185B
Application number: CN201610687849.XA
Authority: CN
Inventors: 张必良; 杨秀群; 丹米其·萨玛斯基
Original assignee: Guangzhou Ribobio Co ltd
Current assignee: Guangzhou Ribobio Co ltd
Priority date: 2016-08-18
Filing date: 2016-08-18
Publication date: 2020-06-26
Anticipated expiration: 2036-08-18
Also published as: CN106282185A

Abstract

The invention discloses a complete set of siRNA for inhibiting expression of clusterin genes and application thereof. The siRNA provided by the invention consists of a sense strand and an antisense strand which is reversely complementary to the sense strand; the sense strand consists of 19-27 nucleotides, and the sense strand is 2 ' -ribose modified from 5-9 consecutive nucleotides from the 5 ' terminus and 5-9 consecutive nucleotides from the 3 ' terminus. Experiments prove that the siRNA molecule mixture improves the probability of inhibiting gene expression by the oligonucleotide; the suppression efficiency is improved on the whole; meanwhile, off-target effect is reduced; in the application process, the complex design, screening, verification and optimization processes of single RNAi molecules in the early stage are omitted, the operation is simple, the cost is saved, and the method is a universal, effective and rapid RNAi tool.

Description

Complete siRNA for inhibiting expression of clusterin gene and application thereof

Technical Field

The invention relates to the field of molecular biology, in particular to a set of siRNA for inhibiting expression of clusterin gene and application thereof.

Background

RNAi is widely present in natural species, and since the first discovery of RNAi phenomenon in nematodes (Caenorhabditis elegans) in 1998 by Andrew Fire and Craig Mello et al, researches on the mechanism principle, gene function, clinical application and the like of RNAi have been advanced after Tuschl and Phil Sharp et al have demonstrated that RNAi also exists in mammals in 2001; RNAi plays a key role not only in defense against viral infection, anti-transposon jumping and other various body protection mechanisms (Huntvagner et al, 2001; Tuschl, 2001; Waterhouse et al, 2001; Zamore 2001), but also its related products are promising candidates.

Clusterin (CLU), a heterodimeric glycoprotein sulfate (SGP-2), was first isolated in the testicular fluid in 1983, after which CLU was found to be widely present in many tissues of humans and animals, such as: testis, epididymis, kidney, heart, lung, uterus, ovary, breast and prostate, and is also present in almost all body fluids including plasma, milk, urine, cerebrospinal fluid and semen. Among them, it is highly expressed in organs such as testis, epididymis, liver and kidney. The clusterin is a multifunctional protein and participates in various physiological and biochemical processes, such as mediated cell aggregation, lipid exchange and transportation, cell membrane stabilization, reproductive function promotion and the like; recently, it has been discovered that it also plays an important role in cell cycle regulation, apoptosis, DNA damage, cell adhesion, and tissue remodeling.

As a result of alternative splicing, Clusterin has two major subtypes: secretory clusterin (sCLU) and karyotype clusterin (nCLU). sCLU is the main form of Clusterin, which has a cytoprotective effect and is a glycosylated protein with a relative molecular weight of 76-80 ku. It was found that the secreted protein of clusterin (sCLU)) is stimulated during EMT (epithelial to mesenchymal transition) and may itself promote the EMT process (Lenferink, a.e., c.canti et al (2009). "Transcriptome Profiling of TGF-beta-induced epithelial-to-mesenchymal transition peptides as a target for adaptive antibodies," Oncogene29:831), which leads to tumor invasion and chemotherapy resistance. Blocking EMT with oligonucleotides that interact with specific regions in sCLU can lead to tumor growth inhibition and increased response to cytotoxic drugs.

Clusterin may play an important role in the occurrence and development of tumors (oncogene, 2004, 23, 2298-.

Disclosure of Invention

An object of the present invention is to provide an siRNA that inhibits or reduces the expression of a target gene CLU.

The siRNA provided by the invention consists of a sense strand and an antisense strand which is completely reverse complementary to the sense strand;

the sense strand consists of 19-27 nucleotides and is 2 ' -ribose modified from 5-9 consecutive nucleotides from the 5 ' terminus and 5-9 consecutive nucleotides from the 3 ' terminus;

the antisense strand is reverse complementary to a segment on the target gene CLU.

The inhibition rate is at least 65%, 70%, 75%, 80%, 85% and 90%.

The siRNA reversely and complementarily binds to a target sequence on the target gene CLU through an antisense strand of the siRNA;

in the above siRNA, the sense strand consists of 24, 25 or 26 nucleotides;

or, the sense strand is 2 ' -ribomodified from 6 or 7 or 8 consecutive nucleotides from the 5 ' terminus and 6 or 7 or 8 consecutive nucleotides from the 3 ' terminus.

In the siRNA, the 2 ' -ribose modification is a 2 ' -O-methyl modification, a 2 ' -O-fluoro modification, a 2 ' -deoxy modification or a 2 ' -MOE modification.

The siRNA is any one of the following:

1) the siRNA is composed of a sense strand shown in a sequence 1 and an antisense strand shown in a sequence 2, and the sequence 1 is modified by 2 ' -O-Me from 7 continuous nucleotides from the 5 ' end and 7 continuous nucleotides from the 3 ' end;

2) the siRNA is composed of a sense strand shown in a sequence 3 and an antisense strand shown in a sequence 4, and the sequence 3 is modified by 2 ' -O-Me from 7 continuous nucleotides from the 5 ' end and 7 continuous nucleotides from the 3 ' end;

3) the siRNA is composed of a sense strand shown in a sequence 5 and an antisense strand shown in a sequence 6, and the sequence 5 is modified by 2 ' -O-Me from 7 continuous nucleotides from the 5 ' end and 7 continuous nucleotides from the 3 ' end;

4) the siRNA is composed of a sense strand shown in a sequence 7 and an antisense strand shown in a sequence 8, and the 7 continuous nucleotides from the 5 ' end and the 7 continuous nucleotides from the 3 ' end of the sequence 7 are modified by 2 ' -O-Me;

5) the siRNA shown in the specification consists of a sense strand shown in a sequence 9 and an antisense strand shown in a sequence 10, wherein 7 continuous nucleotides from the 5 ' end and 7 continuous nucleotides from the 3 ' end of the sequence 9 are modified by 2 ' -O-Me;

6) the siRNA shown in the sequence 11 consists of a sense strand shown in a sequence 11 and an antisense strand shown in a sequence 12, and the sequence 11 is modified by 2 ' -O-Me from 7 continuous nucleotides from the 5 ' end and 7 continuous nucleotides from the 3 ' end;

7) the siRNA shown in the sequence 13 consists of a sense strand shown in a sequence 13 and an antisense strand shown in a sequence 14, and the sequence 13 is modified by 2 ' -O-Me from 7 continuous nucleotides from the 5 ' end and 7 continuous nucleotides from the 3 ' end;

8) the siRNA shown in the sequence 15 consists of a sense strand shown in a sequence 15 and an antisense strand shown in a sequence 16, and the sequence 15 is modified by 2 ' -O-Me from 7 continuous nucleotides from the 5 ' end and 7 continuous nucleotides from the 3 ' end;

9) the siRNA shown in the sequence 17 consists of a sense strand shown in a sequence 17 and an antisense strand shown in a sequence 18, and the sequence 17 is modified by 2 ' -O-Me from 7 continuous nucleotides from the 5 ' end and 7 continuous nucleotides from the 3 ' end;

10) the siRNA shown in the sequence is composed of a sense strand shown in a sequence 19 and an antisense strand shown in a sequence 20, and the sequence 19 is modified by 2 ' -O-Me from 7 continuous nucleotides from the 5 ' end and 7 continuous nucleotides from the 3 ' end.

Another objective of the invention is to provide a siRNA set for inhibiting or reducing the expression of a target gene CLU. The inhibition rate is at least 70%, 75%, 80%, 85% and 90%.

The invention provides a set of siRNA, comprising at least 5 siRNAs as described above.

In the above siRNA set, the mass ratio of any 2 siRNAs in the siRNA set is 1:1-1: 5;

or, the siRNA in the siRNA set are mixed in equal mass ratio.

In the above siRNA set, the siRNA set consists of 7 siRNAs in total, namely the siRNA shown in 1) and the siRNA shown in 7) in the above siRNA;

or, the siRNA set consists of 6 siRNAs in total, wherein the siRNA is shown in 2) or 7) in the above siRNA;

or, the siRNA set consists of 5 siRNAs in total, namely, the siRNA shown in 1), the siRNA shown in 2), the siRNA shown in 4), the siRNA shown in 5) and the siRNA shown in 7) in the siRNA;

or, the siRNA set consists of 10 siRNAs in total, wherein the siRNA is shown in 1) or 10) in the siRNA.

A third object of the present invention is to provide the following substances 1) or 2).

The invention provides the following substances 1) or 2):

1) an agent that inhibits or reduces expression of a target gene CLU, which is a or B as follows:

a comprises the siRNA and transfection reagent;

b comprises the above siRNA set and transfection reagent;

2) a kit for inhibiting or reducing expression of a target gene comprising an siRNA as described above or a set of sirnas as described above or said agent.

In the above substance, the total concentration of all siRNA molecules in the siRNA set in the reagent is 2-100 nM.

The application of the siRNA or the siRNA set or the substance in inhibiting or reducing the expression of the target gene CLU is also the protection scope of the invention;

or the siRNA set or the substance in the above is also the scope of the present invention;

or the siRNA set or the substance in the product for inhibiting or reducing the expression of the target gene CLU is also the protection scope of the invention;

or the siRNA set or the substance in the product for inhibiting or reducing the expression of the target gene CLU in the cell is also the protection scope of the invention;

or the siRNA as described above or the siRNA set as described above or the substance as described above in the preparation of a product for preventing or alleviating or treating a disease caused by the expression of the target gene CLU is also within the scope of the present invention.

It is a fourth object of the present invention to provide a method for inhibiting or reducing the expression of a target gene CLU.

The method provided by the invention comprises the following steps: 2 ' -ribose modification is carried out on a sense strand of siRNA for inhibiting or reducing the expression of a target gene CLU, wherein 5-9 continuous nucleotides from the 5 ' end and 5-9 continuous nucleotides from the 3 ' end are both subjected to ribose modification;

the siRNA consists of a sense strand and an antisense strand reverse-complementary to the sense strand;

the sense strand consists of 19-27 nucleotides;

the antisense strand is reverse complementary to a segment on the target gene;

or the 2 ' -ribose modification is specifically a 2 ' -O-methyl modification, a 2 ' -O-fluoro modification, a 2 ' -deoxy modification or a 2 ' -MOE modification.

A fourth object of the invention is to provide a product.

The invention provides a product comprising the above siRNA or the above siRNA kit or the above substance;

and/or the product has at least one function of 1) to 3) as follows:

1) inhibiting or reducing CLU gene expression;

2) inhibiting or reducing CLU gene expression in a cell;

3) preventing or ameliorating or treating a disease caused by expression of a CLU gene;

or, the cell is a eukaryotic cell or a prokaryotic cell;

or, the cell is specifically a vertebrate cell, a mammalian cell, a primate cell, a human cell, a cancer cell with abnormal expression of a target gene or gene defect, a tumor cell, an inflammatory cell, a blood cell, a leukocyte, a brain cell, a liver cell, a lung cell, a kidney cell, a breast cell, a cervical cell, an endothelial cell, a nerve cell or a glial cell;

or, the cell is in particular a HeLa, 293T, A549 or HUVEC cell;

or, the product is in particular a medicament.

"inhibit" or similar expression in accordance with the present invention can refer to a decrease in the expression, activity or index of RNA or protein levels or related biochemical indicators relative to a negative control.

The concentration of individual siRNA molecules in the mixture of siRNA molecules may be random, preferably with the concentration of the siRNA molecules at their lowest and highest concentrations being 1:1 to 1:5, more preferably the concentrations of the individual siRNA molecules are equal.

The invention is to inhibit the expression of a target gene by introducing a siRNA molecule or a mixture thereof into a cell; introduction may be direct introduction or indirect introduction, and in addition to the use of transfection reagents, other known means of delivering siRNA molecules, e.g., cells, may be used, e.g., injection, transfection with vectors (which may be plasmids or viruses), electroporation, lipofection.

The siRNA molecules of the present invention refer to small single-stranded or double-stranded RNA molecules that have at least one double-stranded region that promotes the degradation of targeted mRNA by the action of siRNA.

"complementary" refers to the nuclear base pairing ability.

The length of a nucleotide or RNA molecule chain can also be expressed in terms of bases or base lengths in the present invention.

In some embodiments of the invention, the siRNA molecule includes at least one non-natural nucleotide, such as a chemically modified nucleotide, preferably a chemical modification in the sense strand or sense region; the sense strand or sense region refers to a continuous nucleotide strand complementary to the antisense strand or antisense region to form a double-stranded structure, and the antisense strand or antisense region refers to a continuous nucleotide strand that binds to the target mRNA in a complementary manner during RNAi. In some embodiments, the modification at the 2 ' -position of the ribose is specifically a 2 ' -methoxy modification, a 2 ' -fluoro modification, a 2 ' -deoxy modification, a 2 ' -MOE modification. In some embodiments, optionally 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides from positions 1-10 of the 5-terminus and/or 1-10 of the 3-terminus of the sense strand are modified. In some embodiments, the nucleotides 1-7 of the 5-terminus and the nucleotides 1-7 of the 3-terminus of the sense strand are modified. Sense strand modifications of the invention can serve as: (1) enhancing the stability of siRNA molecules; (2) reducing off-target of siRNA molecules; (3) improving the specificity of siRNA molecules; (4) reducing immune activation reaction, etc. By "specific" is meant that the siRNA has the necessary degree of complementarity with the target mRNA to induce inhibition of the target gene with little or no inhibition of non-mRNA.

The mixture of siRNA molecules is preferably obtained by solid phase synthesis, and may also be synthesized by transcription or other methods.

In one embodiment, the invention relates to the use of the siRNA molecules of the invention or mixtures thereof to inhibit the expression of a target gene in a cell, which may be a eukaryotic cell including a mammalian cell, preferably a rodent cell, a primate cell, a human cell; the cells may be derived from a variety of tissues or organs, such as blood, lymph, bone marrow, brain, blood vessels, liver, lung, bone, breast, cartilage, cervix, colon, cornea, embryo, kidney, muscle, ovary, pancreas, prostate, skin, intestine, spleen, stomach, etc.; the cell type can be a variety of, including adipocytes, fibroblasts, myocytes, cardiomyocytes, endothelial cells, epithelial cells, neural cells, glial cells, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils, basophils, mast cells, granulocytes, keratinocytes, chondrocytes, osteoblasts, osteoclasts, hepatocytes; or cells in pathological states, such as cancer cells, tumor cells, inflammatory cells, cells with gene defects (e.g., chromosomal abnormalities or gene mutations). Preferably the target gene expression in the target cell, more preferably the target gene expression in the target cell is high.

In one embodiment, the cell is a cancer cell, the cancer is prostate cancer, breast cancer, osteosarcoma, endometrial cancer, ovarian cancer, hepatocellular cancer, colorectal cancer, head and neck cancer, bladder cancer, salivary gland cancer, lung cancer, pancreatic cancer, or renal cell carcinoma; preferably, the cell is HeLa, 293T, A549 and HUVEC cell.

The siRNA set for interfering the CLU gene designed and synthesized by the invention has the advantages that: (1) the siRNA molecule mixture can effectively inhibit the expression of a target gene, all the siRNA molecule mixtures can ensure the inhibition efficiency of more than 70 percent, and the siRNA molecule sequences in the siRNA molecule mixtures can be obtained by an online tool or other conventional technologies without special design; in the prior art, not all designed siRNA molecules can achieve the effect of inhibiting gene expression, generally, the designed siRNA can inhibit the expression of a target gene only with the probability of 50 percent, only 25 percent of siRNA can achieve the effect of inhibiting more than 75 percent, and the siRNA needs to be screened and optimized subsequently or the effect of the siRNA is verified experimentally, which is time-consuming and labor-consuming; (2) the problem of inconsistent siRNA effect in different cell lines and different transfection reagents is solved, the target gene can be effectively silenced in a plurality of cell lines, and the target gene is not influenced by the transfection reagents; (3) the gene silencing effect of the siRNA molecules is enhanced, and the siRNA molecules have synergistic effect. (4) The off-target effect of the siRNA molecule is reduced.

In conclusion, the siRNA molecule mixture improves the probability of the oligonucleotide inhibiting gene expression; the suppression efficiency is improved on the whole; meanwhile, off-target effect is reduced; in the application process, the process of complex design, screening, verification and optimization of single RNAi molecules in the early stage is omitted, the operation is simple, and the cost is saved. Is a universal, effective and rapid RNAi tool.

Drawings

FIG. 1 shows the results of siRNA in vitro stability assay.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 preparation of siRNA set

1. Principle of design

All designed individual sirnas target gene CLU (as in table 1), design method refer to Elbashir et al.2002; paddison et al.2002; reynoldset al.2004; the method of Ui-Tei et al 2004 et al (Elbashir, S.M., Harborth, J., Weber, K., and Tuschl, T.2002.analysis of generation in colloidal cells using colloidal interference RNAs, methods26: 199. 213; Paddis, P.J., Caudy, A.A., Bernstein, E.Hannon, G.J., and Conklin, D.S.2002.short hairpin RNAs (short) sequence-specific interaction cells. genes & Dev.2004: 948. 958; Reynols, A.A., Leuce, D.D.2002, Q.Boeing in colloidal cells, S.22. nucleotide, S.22. detection, S.22. nucleotide, S.22. 12. D.23. nucleotide, S.22. sample, S.23. 12. Q.S. 948. and K.S.23. for use of colloidal interference proteins, S.D.D.D.D.A.D.Q.A.A. origin, colloidal interference in colloidal cells, S.32. C. D.D.D.D.D.D.A. for use, K.S.S.S.S.A. for analysis, K. for research, S.K. K. for research. To ensure the specificity of the siRNA, sequence identity (identity) was analyzed using BLAST (Basic Local Alignment Search Too, http:// www.ncbi.nlm.gov)) and the sequence with the least identity to the other sequences was selected.

The siRNA set consists of 5-10 siRNA molecules;

each siRNA consists of an SS sense strand consisting of 25 nucleotides and an antisense strand AS reverse-complementary to the SS sense strand, and is blunt-ended; each siRNA binds complementarily to a target sequence on a target gene through its antisense strand;

the AS strand and the SS strand are completely complementary in reverse directions, the AS strand is completely complementary to the target gene, and 7 consecutive nucleotides from the 5 ' end and 7 consecutive nucleotides from the 3 ' end of the SS strand are both modified by 2 ' -O-Me.

The target genes are shown in Table 1.

Table 1 target genes

Target genes	Name (R)	Login number
			CLU	Clusterin	NM_001831

2. Design of synthetic target Gene-corresponding set of siRNA

The names of the sirnas corresponding to the target genes shown in table 1 are shown in table 2, and the specific sequences are shown in table 3.

TABLE 2 siRNA molecule mixture composition

TABLE 3 sequence Listing of siRNA molecule mixture

In the above tables, mA, mU, mC and mG are respectively A after 2 '-O-Me modification, U after 2' -O-Me modification, C after 2 '-O-Me modification and G after 2' -O-Me modification.

Each siRNA in the set of siRNA group RM-2(7 siRNA mixtures), RM-3(6 siRNA mixtures), RM-1(5 siRNA mixtures) and RM-6(10 siRNA mixtures) is mixed according to the grouping requirement, wherein the total concentration of all siRNA molecules in the RM-2 mixture is 100nM, and each siRNA molecule is mixed in equal mass ratio.

Example 2 study of the inhibition of target Gene expression by Whole set of siRNA

Comparison of inhibitory Effect of the middle-formed set of siRNA RM-2 in one and different cell lines

After 4 different cell lines (293T, HeLa, A549 and HUVEC (ATCC) were seeded in cell culture plates and cultured for 24h, the cells were observed, and transfection was started in good condition.

TABLE 4 sources of cell lines

Cell lines	Name (R)	Origin of origin
			293T	Human embryonic kidney cell	ATCC
HeLa	Cervical cancer cells	ATCC
			A549	Non-small cell lung cancer cell	ATCC
HUVEC	Human umbilical vein endothelial cells	ATCC

50 μ L riboFECT transfection system: 5 μ L riboFECT^TMCP Reagent (C10511-05, RiboFECT, Guangzhou, Clin. RTM.), 5. mu.L of the siRNA set RM-2 prepared in example 1 (total concentration of all siRNAs was 100nM) and 40. mu.L of riboFECT^TMCP Buffer (C10511-05, Liebo Biotechnology, Inc., Guangzhou).

100 μ L LF2K transfection system: mu.L of LF2K (Invitrogen, 11668019), 5. mu.L of the set RM-2 siRNA set prepared in example 1 (total final concentration of all siRNAs is 100nM) and 94. mu.L of Opti-MEM cell culture medium (ThermoFisher Scientific, 31985070).

The above 50. mu.L of riboFECT transfection system or 100. mu.L of LF2K transfection system was added to each well of the cell culture plate to obtain different cell lines after transfection.

After 48h of transfection, different cell lines after transfection were collected, RNA was extracted by Trizol method, and the Reverse transcription kit was used for Reverse transcription (C10170, acute Bo Biotech, Guangzhou) to obtain cDNAs of different cell lines after transfection.

cDNA of different transfected cell lines is taken as a template, RT-PCR amplification is carried out by using H-CLU-F and H-CLU-R primers, human housekeeping gene actin is taken as an internal reference gene (Forward: 5-TCAAGATCATTGCTCCTCCTGAG-3; Reverse:5-ACATCTGCTGGAAGGTGGACA-3), Real-time fluorescence quantitative PCR reaction is carried out by using a Real-time PCR kit SYBR Premix (2 ×) (BIO-RAD750000131), Ct errors of 9 repetitions of a sample (each independent sample has 3 repetitions at the time of transfection, and each repetition has 3 repetitions at the time of qPCR) are within +/-0.5, and then relative quantitative analysis is carried out by using CFX 2.1. SPSS19.0 data statistical software data analysis, data in a table are mean values, and P values are all less than 0.05.

NC negative control group: the transfected siRNA is irrelevant non-specific siRNA,

5'UUCUCCGAACGUGUCACGU dTdT 3'

5'ACGUGACACGUUCGGAGAA dTdT 3'；

n blank control group: normal cells, no siRNA transfection.

H-CLU-F：CAAGGCGAAGACCAGTACTATC；

H-CLU-R：CAGTGACACCGGAAGGAAC

The Real-Time PCR inhibition rate calculation mode comprises the following steps:

the results are shown in Table 5:

table 5 shows the comparison of the inhibition (%) of RM-2 in different cell lines

The results show that compared with NC negative control group control (expression level is 1), the RM-2 mixture can achieve more than 70% of inhibition effect on different target genes in different cell lines by using different transfection reagents.

II, comparing the target gene inhibition efficiency of RM-2 mixture and single siRNA molecule in HeLa cells

The procedure was the same as the one described above except that HeLa cells were transfected with the siRNA set RM-2 prepared in example 1. Single siRNA in transfected RM-2 was used as a control.

The results of inhibition (%) are shown in Table 6.

TABLE 6 comparison of inhibition (%) of RM-2 to individual siRNA in HeLa cells

For short	RM-2	D1	D2	D3	D4	D5	D6	D7
									CLU	90	82	88	85	86	91	92	73

D1-D7 in the above table are the 7 siRNAs corresponding to each target gene, respectively, and RM-2 is the mixed sample of 7 siRNAs corresponding to the target gene CLU.

The result shows that the inhibition effect (inhibition rate) of the RM-2 mixture aiming at the target gene CLU is more than 90 percent; and compared with 7 single siRNA molecules with the same concentration, the siRNA molecules have the synergistic effect.

Thirdly, comparing the inhibition effect of different groups of siRNA sets transfected HeLa cells

The inhibition effect of different siRNA sets in HeLa cells was compared.

The procedure was the same as the one described above except that HeLa cells were transfected with the siRNA set sets RM-1, RM-2, RM-3, RM-6 corresponding to CLU prepared in example 1, respectively.

The results are shown in Table 7 below,

TABLE 7 siRNA mixtures with different siRNA numbers

siRNA mixtures	RM-1	RM-2	RM-3	RM-6
					Inhibition ratio (%)	79	83	89	91

The results show that the mixtures RM-1, RM-2, RM-3 and RM-6 can all play a role in efficiently inhibiting the expression of a plurality of genes.

Example 3 in vitro stability assay

The siRNA RB-CLU-D6 was diluted to 5. mu.M with RNase-free water, an equal volume of fresh rat serum (produced by bioscience, Inc. of Yuan mu, Shanghai) was added, and then incubated at 37 ℃ for 6 hours, and samples were taken for electrophoresis to observe the integrity of siRNA.

The results are shown in FIG. 1, where the siRNA of the present invention is stable in serum, and is expected to have better efficacy in vivo.

The other RB-CLU-Dx (x is D1-D10) have the same experimental results, and the detailed drawing is omitted.

Claims

1. An siRNA for inhibiting or reducing the expression of a target gene CLU, wherein the siRNA is any one of the following 2) or 5) or 6);

6) the siRNA shown in the sequence 11 consists of a sense strand shown in the sequence 11 and an antisense strand shown in the sequence 12, and the sequence 11 is modified by 2 ' -O-Me in 7 continuous nucleotides from the 5 ' end and 7 continuous nucleotides from the 3 ' end.

2.A set of siRNA that inhibits or reduces expression of a target gene CLU, characterized in that: the siRNA set is any one of A) to D);

10) the siRNA shown in the sequence is composed of a sense strand shown in a sequence 19 and an antisense strand shown in a sequence 20, and the sequence 19 is modified by 2 ' -O-Me from 7 continuous nucleotides from the 5 ' end and 7 continuous nucleotides from the 3 ' end;

A) the siRNA set consists of the siRNAs shown in 1) to 7);

B) the siRNA set consists of the siRNAs shown in 2) to 7);

C) the siRNA set consists of the siRNAs shown in 1), 2), 4), 5) and 7);

D) the siRNA set consists of the siRNAs shown in 1) to 10).

3. A set of siRNA according to claim 2, wherein: the siRNA in the siRNA set is mixed in equal amount.

4. A kit comprising the siRNA of claim 1 or the set of siRNA of claim 2 or 3; transfection reagents are also included.

5.1) or 2):

a comprises the siRNA of claim 1 and a transfection reagent;

b comprises the set of siRNA of claim 2 or 3 and a transfection reagent;

2) a kit for inhibiting or reducing expression of a target gene CLU comprising the siRNA of claim 1 or the set of siRNA of claim 2 or 3.

6. The use of any one of 1) to 4) below for inhibiting or reducing expression of a target gene CLU;

1) the siRNA of claim 1;

2) a set of siRNA of claim 2 or 3;

3) the kit of claim 4;

4) the substance of claim 5;

the use is a non-disease therapeutic use.

7. The use of any one of 1) to 4) described below for inhibiting or reducing expression of a target gene CLU in a cell;

1) the siRNA of claim 1;

2) a set of siRNA of claim 2 or 3;

3) the kit of claim 4;

4) the substance of claim 5;

the use is a non-disease therapeutic use.

8. The application of any one of the following 1) to 4) in preparing products for inhibiting or reducing the expression of the target gene CLU; the use is a non-disease therapeutic use;

1) the siRNA of claim 1;

2) a set of siRNA of claim 2 or 3;

3) the kit of claim 4;

4) the substance of claim 5.

9. The use of any one of the following 1) to 4) for the preparation of a product for inhibiting or reducing the expression of a target gene CLU in a cell; the use is a non-disease therapeutic use;

1) the siRNA of claim 1;

2) a set of siRNA of claim 2 or 3;

3) the kit of claim 4;

4) the substance of claim 5.

10. The use of any one of 1) to 4) below in the preparation of a product for preventing or alleviating or treating a disease caused by expression of a target gene CLU;

1) the siRNA of claim 1;

2) a set of siRNA of claim 2 or 3;

3) the kit of claim 4;

4) the substance of claim 5;

the use is a non-disease therapeutic use.

11. A product comprising the siRNA of claim 1 or the set of siRNA of claim 2 or 3 or the substance of claim 5;

the product has at least one function of 1) to 3) as follows:

1) inhibiting or reducing CLU gene expression;

2) inhibiting or reducing CLU gene expression in a cell;

the cell is a vertebrate cell.

12. The product of claim 11, wherein: the vertebrate cell is a mammalian cell.

13. The product of claim 12, wherein: the mammalian cell is a primate cell.

14. The product of claim 13, wherein: the primate cells are human cells.

15. The product of claim 14, wherein: the human cells are blood cells.

16. The product of claim 14, wherein: the human cell is a brain cell, a liver cell, a lung cell, a kidney cell, a breast cell and/or a cervical cell.

17. The product of claim 14, wherein: the human cell is an inflammatory cell.

18. The product of claim 14, wherein: the human cell is a tumor cell.

19. The product of claim 18, wherein: the tumor cell is a cancer cell with target gene abnormally expressed or gene defect.

20. The product of claim 18, wherein: the tumor cell is HeLa, 293T, A549 or HUVEC cell;

the product is a medicament.