CN106267226A

CN106267226A - Treat osteosarcomatous triptolide derivant and preparation method thereof

Info

Publication number: CN106267226A
Application number: CN201510308612.1A
Authority: CN
Inventors: 吕诚; 江峰; 张保亭; 刘振丽
Original assignee: Beijing Consulting Co Ltd
Current assignee: Beijing Consulting Co Ltd
Priority date: 2015-06-09
Filing date: 2015-06-09
Publication date: 2017-01-04

Abstract

The present invention relates to field of medicaments, specifically provide new triptolide derivant and preparation method thereof, triptolide derivant of the present invention is such as the conjugates of following formula (I): the present invention with nucleic acid aptamer (Aptamer) as targeted molecular, with triptolide (Triptolide) or its analog as parent drug, and use sulfur sulfide linkage, polypeptide linkers and glucosides connecting key auxiliary at different intervals (spacer) connect targeted molecular and parent drug, the conjugates of triptolide and the like obtained by the present invention is made to have good anti-osteosarcoma targeting and water solublity, bioavailability is high, toxic and side effects is low, active anticancer is strong.

Description

Treat osteosarcomatous triptolide derivant and preparation method thereof

Technical field

The invention belongs to field of medicaments, in particular it relates to one is used for treating osteosarcomatous thunder Tripterygium wilfordii A prime derivant and preparation method thereof.

Background technology

Osteosarcoma is one the most common in bone malignant tumour, is to develop from Interstitial cell system, swollen It is owing to tumor directly or indirectly forms tumor osteoid tissue and bone group through cartilage phase that tumor mushrooms out Knit.Needing after osteosarcoma definitive pathological diagnosis at once to carry out putting treatment, amputation is then as tradition excision The important method of tumor tissues.The state of an illness is served and preferably controls effect by which, but the body to patient Grieved evil is relatively big, has a strong impact on postoperative quality of life.Although combining operative treatment by new adjuvant chemotherapy, Its prognosis has bigger improvement, and within 5 years, nowadays survival rate is risen to by about the 10% of late 1970s About 60%, but between nearly more than 30 years, osteosarcoma underwent operative has the recurrence of 30-40% after treating 3 years Rate, although having carried out multiple effort, fails to obtain greater advance always.

The chemotherapy of current routine clinical use mainly with High-dose methotrexate, cisplatin, amycin, Ifosfamide is main.Chemotherapy improves the osteosarcomatous therapeutic effect of part, decreases postoperative misery, Improve survival rates.

Triptolide (Tripodile, TP) is the epoxidation of isolated from Chinese medicine Radix Tripterygii Wilfordii Diterpenic lactone, has another name called thunder A prime, is one of the principle active component of Radix Tripterygii Wilfordii.Radix Tripterygii Wilfordii first Element has highly significant anti-tumor activity.Research shows, triptolide is that a kind of broad-spectrum tumor presses down Preparation, external can induced various types of tumors apoptosis, including ovarian cancer, breast carcinoma, colon cancer, mouth Chamber cancer, gastric cancer etc., internal tumor growth and the Nasopharyngeal neoplasms of suppressing, including neoplastic hematologic disorder, evil Property tumor and solid tumor.Triptolide anti-tumor activity is better than cisplatin, amycin, paclitaxel etc. and passes System cancer therapy drug, can effectively suppress tumor cell proliferation under extremely low concentration (2-10ng/ml).Remove Outside this, triptolide also can avoid tumor drug resistance, improves tumor cell to other anticarcinogen simultaneously The sensitivity of thing, combine performance cooperative effect with chemotherapeutics and ionizing radiation.

Ling Chang congruence is it has been investigated that triptolide can significantly inhibit the increasing of multiple osteosarcoma cell Grow, and can induce it that apoptosis occurs；Activation wire plastochondria associated signal paths；Significantly inhibit kindred Tumor at nude mice tumor growth, and detect phenomena of apoptosis [Shi Qianwei, Li Shuguang, Li Jun, Ling Changquan. Experimentation .2013 of the anti-osteosarcoma cell of triptolide, 33,659-663].

Although it is active that triptolide has significant anti-osteosarcoma, but itself poorly water-soluble, biological Availability is low, and toxicity is relatively strong, and treatment window is narrow.Triptolide is to tumor cell and normal cell simultaneously There is no selectivity, bring the biggest toxic and side effects.The most how to improve its water solublity, strengthen its target Just become a kind of inevitable to Journal of Sex Research.

Ren Tianbin etc. connect triptolide, this conjugates at the two ends of Polyethylene Glycol by disulfide bond Being stable existence in general fluid environment, triptolide constitutes hydrophobic inner core due to hydrophobicity, Shell is hydrophilic Polyethylene Glycol, once reaches lesion locations, due to the stimulation of reducing environment, and two Sulfide linkage starts fracture, thus quickly discharges the triptolide [CN10243866] in kernel.

Georg et al. on the hydroxyl of triptolide 14-position on introduce hydrophilic group to strengthen it water-soluble Property [WO2010129918].Dai et al. it is also proposed the Thunder God that some dissolubility improve and toxicity reduces Rattan lactone prodrugs [US6548537].

But, the research report about targeting prodrug of triptolide is less, and these strengthen Thunder God The water miscible prodrug of rattan A prime there is also many defects.Such as Triptolide succinate prodrug Not exclusively convert [European Journal of Cancer 2009,45,1764-1772] etc..

Therefore, develop a kind of have targeting, simultaneously can strengthen the water miscible prodrug of triptolide Imperative.

Summary of the invention

For above technical situation, the present invention provides a kind of new triptolide derivant, described in spread out Biology is such as the conjugates of following formula (I):

Wherein, R₁=for H or OH；R₂=for H or OH；R₃=for H or OH；R₄=for H or OH；R₅=for H or OH；R₆=for H or OH；R₇=for H or OH；G is O or NH；M For O or OH；X is O or OH；

Substituent group S₁For to amino aryl methoxycarbonyl group, to amino aryl methoxyl group, N, N '-dimethyl-N-carbonyl Base ethylenediamine, to hydroxyl virtue methoxycarbonyl group, to hydroxyl virtue methoxyl group, to sulfydryl virtue methoxycarbonyl group, right Sulfydryl virtue methoxyl group, substituted sulfhydryl bytyry, substituted sulfhydryl valeryl, sulfydryl carbethoxyl group or sulfydryl Third oxygen carbonyl；

Substituent group L is sulfur sulfur connecting key, polypeptide linkers or glucosides connecting key；

Substituent group S₂For butanimide alkyl acyl, alkyl bisacyl, or butanimide alkyl Amino diacyl；

A is aptamer；

Wherein S₁It is connected with M or X；Wherein work as S₁When being connected with M, M be O, X be O, X With C₁₈Between be double bond and C₃-C₄Between be double bond, or work as S₁When being connected with M, M be that O, X are OH, X and C₁₈Between be singly-bound, and C₁₈-C₃Between and C₁₉-C₄Between be double bond；Wherein work as S₁With X phase Lian Shi, M be OH, X be O, X and C₁₈Between be singly-bound and C₁₈-C₃Between and C₁₉-C₄Between be double Key.

Those skilled in the art are not difficult to know by the chemical constitution of triptolide, and this structure exists change Isomer, the characteristic of therefore known structure change based on triptolide and the like and occur Tautomerization in formula (I) conjugates of the present invention, this broadly falls into those skilled in the art based on this area General knowledge and triptolide known features institute expectability go out；Unless tied at formula (I) conjugates of the present invention Structure loses tautomeric condition；As exemplary explanation, S in formula (I) the most of the present invention₁With When M is connected, M be O, X be O, X and C₁₈Between be double bond and C₃-C₄Between be double bond chemistry knot Structure with work as S₁When being connected with M, M be O, X be OH, X and C₁₈Between be singly-bound, and C₁₈-C₃ Between and C₁₉-C₄Between for the chemical constitution of double bond actual be interchange structure, belong to exchange isomer, wherein Mainly with M as O, X as O, X and C₁₈Between be double bond and C₃-C₄Between chemical constitution exist； And work as S₁When being connected with X, X is O, and now this position loses tautomeric condition；But this Other positions with structure exchange characteristic of bright formula (I) derivant create due to its architectural characteristic Tautomer, it is again based on the characteristic that structure known to triptolide is exchanged, and this is also this Skilled person combines what common sense in the field institute expectability went out, is protected without departing from the present invention Scope.

As one of embodiment of the present invention, when described substituent group L is sulfur connection connecting key, described sulfur Sulfur connecting key structure is as follows :-S-S-.

As one of embodiment of the present invention, when described substituent group L is polypeptide link key, described polypeptide Connecting key is the polypeptide that two to four aminoacid connect；

As one of embodiment of the present invention, described polypeptide chain is preferably valine and citrulline, phenylpropyl alcohol Propylhomoserin and lysine, alanine and lysine, valine and lysine, phenylalanine and arginine, Phenylalanine and citrulline, leucine and citrulline, isoleucine and citrulline, or tryptophan and bright The dipeptides that propylhomoserin is formed.

As one of embodiment of the present invention, when described L is described glucosides connecting key, described sugar Glycosides connecting key is β-Artogicurol.

As one of embodiment of the present invention, described S₂There is following structure: butanimide alkyl Acyl group (formula i), alkyl bisacyl (formula ii) or butanimide alkyl amino diacyl (formula iii):

N is the positive integer of 1-10, the positive integer of prioritizing selection 4-6, such as n be 1,2,3,4,5, 6, the integer of 7,8,9 or 10, m is the positive integer of 1-10, the positive integer of prioritizing selection 4-6, example In the integer that m is 1,2,3,4,5,6,7,8,9 or 10, formula (i)～formula (iii) A is the aptamer in the present invention, and L is the connecting key in the present invention.

As one of embodiment of the present invention, described aptamer A can be can targeting for this area Any aptamer of osteosarcoma cell；

As one of embodiment of the present invention, described aptamer A includes but not limited to have SEQ ID Nucleotide sequence shown in NO.1, SEQ ID NO.2 or SEQ ID NO.3, wherein

SEQ ID NO.1:

GTACTTCCGACTTGGGGCGGGTTTGTTGCTGGCTGTCGGCAAAAGTGC A, is called for short " LC4 "；

SEQ ID NO.2:

GTACTTCCGGCGGGTTCTATGGGCCCTGTCTCCCTTCCCAAAAGTGCA CGCTAC, is called for short " LC5 "；

SEQ ID NO.3:

GTACTTCCCGCGTGTGTGTGTTTGTCGGAGTGTTATCGCAAAAGTGCA CGCTAC, is called for short " LC6 ".

As one of embodiment of the present invention, above-mentioned aptamer can use the preparation method that this area is conventional Being prepared, the present invention includes but not limited to following methods:

1) screening of aptamer

Prepare the reverse of above-mentioned ssDNA pool, the forward primer of FITC labelling and Biotin labelling Primer；

Selection rat osteoblast is target cell, and rat hepatocytes system and peripheral blood lymphocytes are non-target Cell, uses the cell dissociation buffer without enzyme to process well-grown cell, is inoculated in culture dish, mistake Night cultivates, and can be used for library screening when cell length to 95%；

Target cell is digested, and hatches with random library incubation buffer；

After hatching end, cell centrifugation is got off, add distilled water, collect supernatant, containing the in supernatant One takes turns the single stranded DNA that screening is combined with target cell, expands for PCR, the sub-literary composition of preparation next round screening Storehouse；

After the concentrated pipe of PCR primer dsDNA concentrates, hatch with streptavidin-magnetic bead, add Alkaline solution carries out alkaline denaturation so that Biotin-ssDNA is fixed on magnetic bead after being combined with streptavidin, Free library, FITC-ssDNA Asia is then separated；Then supernatant is taken, during addition acid solution is carried out With；

Library, above-mentioned FITC-ssDNA Asia is carried out high-resolution sepharose electrophoresis, again separates FITC-ssDNA and polluted sequence therein (dsDNA)；

Ethidium bromide staining 10 minutes, cuts the target stripe of FITC-ssDNA, passes through under uviol lamp Small-molecular-weight DNA purification reclaims test kit and reclaims；

2) enrichment of aptamer

Only the first round screen in target cell is hatched, from second take turns from the beginning of, just sieve after introducing Non-target cell is negative is sieved through journey；Finally centrifugal collection supernatant, discards the sequence being combined with non-target cell, weight Multiple said process 5-20 circulation；

3) order-checking of aptamer:

The Library PCR amplification being finally enriched to is become double-stranded DNA, uses Cloning Kit to clone, Through blue white macula screening, selected clone checks order；RNA structure software is used according to sequencing result Analysis with DNAMAN software carries out primary sequence and secondary structure, to obtain final product.

As one of embodiment of the present invention, described method step 1) in incubation buffer can this The various buffer solution being suitable to the present invention that field is conventional, the present invention is preferably containing 1.0mM MgCl₂, 0.1mg/ml yeast tRNA and the phosphate buffer solution of 0.1mg/ml salmon sperm dna；

As one of embodiment of the present invention, described method step 1) in the reaction condition of PCR permissible Capable field technique personnel combine the present invention and those skilled in the art are determined, as being preferable to carry out One of scheme, the present invention preferred PCR reaction condition is: 94 degree of denaturations 3min, 94 degree of degeneration 30s, 56 degree of annealing 30s, 72 degree extend 30s, and last 72 degree extend 5min.

As one of embodiment of the present invention, described method step 1) in aqueous slkali can select this The alkaline solution that field is conventional, the present invention includes but not limited to the NaOH solution that aqueous slkali is 200mM；

As one of embodiment of the present invention, described method step 1) in acid solution can select this The acid solution that field is conventional, the present invention includes but not limited to that acid solution is 100mM hydrochloric acid.

As one of embodiment of the present invention, described method step 1) in deposition condition be: agar Sugar electrophoresis, voltage is set as 180V, and electrophoresis time is 40 minutes.

As one of embodiment of the present invention, the system of the aptamer of described selectively targeted osteosarcoma cell Preparation Method farther includes:

1) screening of aptamer

Selecting rat osteoblast ROS17/2.8 (ATCC) is target cell, rat hepatocytes system BRL-3A (ATCC) and peripheral blood lymphocytes is non-target cell, use the cell dissociation buffer without enzyme to process to grow Good cell, according to 5 × 10⁶It is inoculated in culture dish, incubated overnight, when cell length to 95% Can be used for library screening；

Target cell is digested, hatches under the conditions of 37 degree 1 hour with random library, hatch buffering Liquid is containing 1.0mM MgCl₂, 0.1mg/ml yeast tRNA and 0.1mg/ml salmon sperm dna PBS；

After hatching end, cell centrifugation is got off, add distilled water, 100 degree of heating in water bath 10 minutes, Collect supernatant, supernatant screens containing the first round single stranded DNA being combined with target cell, expand for PCR Increase, preparation next round screening Ya Wenku；

PCR reaction condition is: 94 degree of denaturations 3min, 94 degree of degeneration 30s, 56 degree of annealing 30s, 72 degree extend 30s, and last 72 degree extend 5min；

After the concentrated pipe of PCR primer dsDNA concentrates, to hatch 1 at 37 degree little with streptavidin-magnetic bead Time, add 200mM NaOH solution and carry out alkaline denaturation 7 minutes, break the hydrogen bond between dsDNA, Biotin-ssDNA is fixed on magnetic bead, free FITC-ssDNA after being combined with streptavidin Sub-library is then separated；Take supernatant, add appropriate 100mM hydrochloric acid solution and be neutralized；

Library, above-mentioned FITC-ssDNA Asia is carried out high-resolution sepharose electrophoresis, and voltage is set as 180V, electrophoresis time is 40 minutes, again separates FITC-ssDNA and polluted sequence therein；

2) enrichment of aptamer

In order to reduce the loss in ssDNA library, target cell is only hatched by first round screening；From Second takes turns beginning, introduces the negative sieved journey of non-target cell after just sieving；Just sieving the process of hatching consistent with the above, During negative sieve, after hatching 1 hour under 37 degree of environment, centrifugal collection supernatant, discard thin with non-target The sequence that born of the same parents combine；

Repeat said process 5-20 circulation, in order to obtain higher affinity and specific aptamer, Along with the increase of screening wheel number, being gradually increased washing dynamics, washing times also increases to 5 times from 3 times, Wash time increased to 5 minutes from 3 minutes.

Enrichment condition is analyzed by screening process every several recycling flow cytometers；By target Cell and non-target cell digest, and carry out 37 degree with enriched library with it and hatch 1 hour, and PBS washes After three times, add 400ul PBS re-suspended cell, flow cytometry analysis fluorescence intensity；Treat that fluorescence is strong When degree reaches to a certain degree, terminate screening；

3) order-checking of aptamer:

The Library PCR amplification being finally enriched to is become double-stranded DNA, uses Cloning Kit to clone, Through blue white macula screening, select multiple clone and check order, then use RNA structure software and DNAMAN software carries out the analysis of primary sequence and secondary structure；Carry out blocking according to analysis result and Identifying, obtaining primary sequence is:

As one of embodiment of the present invention, described triptolide derivant includes but not limited to following Compound described in table is:

Wherein, S₁When being connected with M, X and C₁₈Between be double bond and C₃-C₄Between be double bond, or work as S₁ When being connected with X, X and C₁₈Between be singly-bound and C₁₈-C₃Between and C₁₉-C₄Between be double bond.

Above-claimed cpd of the present invention equally can tautomerization characteristic based on triptolide and the like And recurring structure change, as exemplary explanation, i.e. S₁When being connected with M, X and C₁₈Between be double Key and C₃-C₄Between can be converted into X for the chemical constitution of double bond be OH, X and C₁₈Between be singly-bound, And C₁₈-C₃Between and C₁₉-C₄Between be the chemical constitution of double bond, this broadly fall into those skilled in the art based on The known features institute expectability of common sense in the field and triptolide goes out；Work as S equally₁When being connected with X, Now this position loses tautomeric condition, but other of triptolide derivant of the present invention The position with structure exchange creates tautomer due to its architectural characteristic, and it is again based on The characteristic that structure known to triptolide is exchanged, it is normal that this is also that those skilled in the art combine this area Knowledge and triptolide known features institute expectability go out, its model protected without departing from the present invention Enclose.

The preparation method of formula of the present invention (I) triptolide derivant can be by those skilled in the art According to the present invention and combine common sense in the field and be prepared.Such as include but not limited to adopt with the following method Preparation:

One) by S1 and L in polar aprotic solvent or halogenated hydrocarbon solvent by condensation reaction or Substitution reaction, obtains intermediate one；

Two) in halogenated hydrocarbon solvent and triptolide or its analog are by different work for intermediate one Change reagent and be condensed to yield intermediate two；

Three) intermediate two and S2 is condensed to yield intermediate in polar aprotic solvent or halogenated hydrocarbons Three；

Four) intermediate three and aptamer A are anti-by additive reaction or condensation in aqueous buffer Coupling should be carried out and obtain conjugates.

The inventive method step one) in, as one of embodiment, described polar non-solute can With polar non-solute commonly used in the art, the present invention includes but not limited to dimethyl sulfoxide, N, N-bis- Methylformamide, N,N-dimethylacetamide, N-Methyl pyrrolidone, ether, oxolane, first Base tertbutyl ether, acetone or their two or more mixture；As embodiment it One, described halogenated hydrocarbons can be halogenated hydrocarbons commonly used in the art, and the present invention includes but not limited to dichloromethane Alkane, chloroform, tetrachloromethane, dichloroethanes, sym-tetrachloroethane etc. or they two or more Mixture；

The inventive method step 2) in, as one of embodiment, described halogenated hydrocarbons can be ability The halogenated hydrocarbons that territory is conventional, the present invention includes but not limited to dichloromethane, chloroform, tetrachloromethane, dichloro Ethane, sym-tetrachloroethane or they two or more mixture；As one of embodiment, Described activating reagent includes but not limited to as Arylmethoxycarbonyl acyl chlorides, such as p-nitrophenyl methoxy acyl chlorides, benzene first Oxygen acyl chlorides, to methylbenzene methoxy acyl chlorides, benzenyl trichloride methoxy acyl chlorides, to chlorobenzene methoxy acyl chlorides, right Fluorobenzene methoxy acyl chlorides, Tritox, trifluoro acetonitrile or DCC；

The inventive method step 3) in, as one of embodiment, described polar non-solute can With polar non-solute commonly used in the art, the present invention include but not limited to N,N-dimethylacetamide, N-Methyl pyrrolidone, ether, oxolane, methyl tertiary butyl ether(MTBE), acetone or they two kinds or Two or more mixture；As one of embodiment of the present invention, described halogenated hydrocarbons can be this area Conventional halogenated hydrocarbons, the present invention includes but not limited to dichloromethane, chloroform, tetrachloromethane, two chloroethenes Alkane, sym-tetrachloroethane etc. or they two or more mixture.

The inventive method step 4) in, as one of embodiment, described aqueous buffer includes But it is not limited to phosphate buffered solution or sodium carbonate/bicarbonate buffer solution.

Selectively, those skilled in the art can use the purification that this area is conventional according to actual needs Method, as included but not limited to, reversed phase high-performance liquid chromatography or post color law popularization are to step 4) in gained Described formula (I) triptolide derivative products be purified, purification condition can be by this area skill Art personnel combine the character of common sense in the field and gained particular compound and are determined.

The present invention with nucleic acid aptamer (Aptamer) as targeted molecular, with triptolide And the like (Triptolide) for parent drug, using can be at the sulfur of tumor cells selectivity fracture Sulfide linkage, polypeptide linkers and glucosides connecting key are aided with different space and connect targeted molecular and parent medicine Thing, obtained nucleic acid aptamer-triptolide conjugates has good tumor-targeting and water-soluble Property, thus bioavailability is high, toxic and side effects is low, and active anticancer is strong.The present invention also passes through connecting key L Successfully by aptamer-medicament coupling thing link, and couplings of the present invention is made not only to protect in blood circulation Keep steady fixed, thus reduce owing to medicine discharges the toxic and side effects caused in blood circulation in advance；Again can Making couplings of the present invention after entering tumor cell, connecting key ruptures, it is possible to discharge former medicine, thus Kill cancerous cell.

It is demonstrated experimentally that the present invention with nucleic acid aptamer (Aptamer) as targeted molecular, with Radix Tripterygii Wilfordii first Element (Triptolide) and the like is parent drug, and using can be in tumor cells selectivity fracture Sulfur sulfide linkage, polypeptide linkers and glucosides connecting key are aided with different space and connect targeted molecular and parent Medicine, obtained conjugates has good tumor-targeting and water solublity, and bioavailability is high, Toxic and side effects is low, and active anticancer is strong.

Accompanying drawing explanation

Fig. 1: different time points triptolide-osteosarcoma aptamer conjugates release in each tissue Rate；

Fig. 2: the concentration of triptolide derivant in each time point different tissues；

The measurement of Fig. 3: gross tumor volume；

Fig. 4: the mrna expression level of NF-κ B after the per injection medicine in serum.

Detailed description of the invention

Following example are only used for being expanded on further the present invention, but limit the present invention the most in any manner Effective range.

The preparation of aptamer

1. experiment material:

1.1 ssDNA libraries, the forward primer of FITC labelling and the reverse primer of Biotin labelling:

SsDNA library:

5’-ATCCAGAGTGACGCAGCA-40nt-TGGACACGGTGGCTTAGT-3’

5 ' primers: 5 '-FITC-ATCCAGAGTGACGCAGCA-3 '；

3 ' primers: 5 '-biotin-ACTAAGCCACCGTGTCCA-3 '；Biological by the raw work in Shanghai Engineering company provides.

1.2 rat osteoblasts: ROS17/2.8, purchased from Chinese Academy of Sciences's cell bank, culture fluid is 10% tire The DMEM culture medium of Ox blood serum.

1.3 rat hepatocytes: BRL-3A, purchased from Chinese Academy of Sciences's cell bank, culture fluid is 10% tire cattle The DMEM culture medium of serum.

Rat peripheral hemocyte: PBMCs, directly separates from rat peripheral blood.

1.4 culture fluid: DMEM culture medium and hyclone are purchased from Gbico company

1.5 flow cytometers: purchased from BD Immunocytometry Systems

1.6 CH inverted light microscope: purchased from Japanese Olympus company

1.7 PCR kit (article No.: R011), DNA Marker (20bp DNA ladder (Dye Plus), article No.: 3420A) and agarose gel (Agarose MS-6, article No.: D615) be purchased from Dalian Takara company

1.8 small-molecular-weight DNA purification reclaim test kit (article No.: ZP205) purchased from Beijing Zoman Biotechnology, Co., LTD

The magnetic bead (article No.: Z5482) of 1.9 streptavidins is purchased from Promega company

1.10 tetrazolium bromides (MTT, article No.: M2128) are purchased from Sigma company

1.11 PCR instrument are purchased from Perkin Elmer company of the U.S..

1.12 ultraviolet gel imaging systems are purchased from Rio-Rad company.

1.13 concentration tubes (Amicon Ultra-15 centrifugal Filter-10k) are purchased from Merck Milipore Company.

The synthesis of 1.14 nucleic acid aptamers is synthesized by Chengdu lead drug development corporation, Ltd.

2. experimental technique:

The screening of 2.1 aptamers

Prepare the reverse of above-mentioned ssDNA pool, the forward primer of FITC labelling and Biotin labelling Primer.

Selecting rat osteoblast ROS17/2.8 (ATCC) is target cell, rat hepatocytes system BRL-3A (ATCC) and peripheral blood lymphocytes is non-target cell, use the cell dissociation buffer without enzyme to process to grow Good cell, according to 5 × 10⁶It is inoculated in culture dish, incubated overnight, when cell length to 95% Can be used for library screening.

Target cell is digested, hatches under the conditions of 37 degree 1 hour with random library, hatch buffering Liquid is containing 1.0mM MgCl₂, 0.1mg/ml yeast tRNA and 0.1mg/ml salmon sperm dna Phosphate buffer solution (PBS).

After hatching end, cell centrifugation is got off, add distilled water, 100 degree of heating in water bath 10 minutes, Collect supernatant, supernatant screens containing the first round single stranded DNA being combined with target cell, expand for PCR Increase, preparation next round screening Ya Wenku.

PCR reaction condition is: 94 degree of denaturations 3min, 94 degree of degeneration 30s, 56 degree of annealing 30s, 72 degree extend 30s, and last 72 degree extend 5min.

The concentrated pipe of PCR primer dsDNA (Amicon Ultra-15 centrifugal Filter-10k) is dense After contracting, hatch 1 hour at 37 degree with streptavidin-magnetic bead (Z5482, Promega), add 200mM NaOH solution carries out alkaline denaturation 7 minutes, breaks the hydrogen bond between dsDNA so that Biotin-ssDNA Being fixed on after being combined with streptavidin on magnetic bead, free library, FITC-ssDNA Asia is then separated Come.Take supernatant, add appropriate 100mM hydrochloric acid solution and be neutralized.

Library, above-mentioned FITC-ssDNA Asia is carried out high-resolution sepharose electrophoresis (D615, Takara), voltage is set as 180V, and electrophoresis time is 40 minutes, again separates FITC-ssDNA And polluted sequence (dsDNA) therein.

Ethidium bromide staining 10 minutes, cuts the target stripe of FITC-ssDNA, passes through under uviol lamp Small-molecular-weight DNA purification recovery test kit (ZP205, Beijing Zoman Biotechnology, Co., LTD) reclaim.

The enrichment of 2.2 aptamers

In order to reduce the loss in ssDNA library, target cell is only hatched by first round screening.From Second takes turns beginning, introduces the negative sieved journey of non-target cell after just sieving.Just sieving the process of hatching consistent with the above, During negative sieve, after hatching 1 hour under 37 DEG C of environment, centrifugal collection supernatant, discard thin with non-target The sequence that born of the same parents combine.

Enrichment condition is analyzed by screening process every several recycling flow cytometers.By target Cell and non-target cell digest, and carry out 37 degree with enriched library with it and hatch 1 hour.PBS washes After three times, add 400ul PBS re-suspended cell, flow cytometry analysis fluorescence intensity.Treat that fluorescence is strong When degree reaches to a certain degree, terminate screening.

The order-checking of 2.3 aptamers

The Library PCR amplification being finally enriched to is become double-stranded DNA, uses Cloning Kit (Invitrogen, cat.no.K4500-01) clones, through blue white macula screening, multiple grams of random choose Grand check order.

RNA structure software and DNAMAN software is used to carry out primary sequence according to sequencing result Analysis with secondary structure.Block according to analysis result and identify.Finally pick out three candidates Aptamer, primary sequence is:

2.4 HPLC analyze

Cell is cracked, takes 0.2mL cell pyrolysis liquid, add 50ul I.S. (2ug/ml), and 1.2 ML ethyl acetate solution, is centrifuged 5 minutes after concussion.Take organic solution 1mL drying with water bath, 0.1mL Methanol redissolves, and 4 degree are centrifuged 10 minutes.Take supernatant (10ul) sample introduction analysis.

Chromatographic condition: Zorbax Extend-C18 chromatographic column (Agilent Technologies, U.S.A.), ODS pre-column (Security Guard,U.S.A.), column temperature 30 degree, flowing is first mutually Alcohol/acetonitrile/water (15/20/65, v/v/v%), flow velocity 1.0ml/min, detects wavelength 218nm.

The preparation of the triptolide derivant containing aptamer

Embodiment 1

Aptamer-butanimide alkyl acyl-polypeptide linkers-p-aminophenyl methoxycarbonyl group-Radix Tripterygii Wilfordii first The synthesis (being called for short the dipeptides that " purpose product 6 "-polypeptide connects with valine and citrulline) of element structure.

1. the synthesis of intermediate product 3

Under nitrogen atmosphere, 82.9mg triptolide 2 (0.23mmol) is dissolved in dry dichloromethane In alkane, add several pyridines, be cooled to-50 DEG C, the p-nitrophenyl of dropping 273.8mg (1.27mmol) The dichloromethane solution of methoxy acyl chlorides 1 ,-50 DEG C of stirrings after dropping, after 12 hours, reaction Mixture dchloromethane, the potassium hydrogen sulfate solution washing of gained material 0.5N, saturated common salt Water washs, and collects organic facies anhydrous sodium sulfate and is dried, after filtration, and decompression and solvent recovery, residue Thing pillar layer separation obtains product 3.MS Theoretical Calculation 525.16, actually detected to 525.21.

2. the synthesis of intermediate product 5

Under blanket of nitrogen, 47.3mg compound 3 (0.09mmol) is dissolved in dry oxolane-two In the mixed solvent 5mL of chloromethanes 1: 1, add 51.5mg compound 4 (0.09mmol) and 25 Mg N, N-diisopropyl ethyl amine (0.19mmol), stir 48 hours under room temperature, adds ethyl acetate, Organic facies is washed with 10% citric acid solution, and saturated aqueous common salt washs, washing, and anhydrous sodium sulfate is dried, Filtering, decompression and solvent recovery, residue pillar layer separation obtains product 5.MS Theoretical Calculation 958.43, Actually detected to 958.38.

3. the synthesis of the product 6 of mesh

The LC4 of 300nmol sulfur-bearing sulfide linkage is dissolved in PBS buffer solution (pH 7.4), adds tricarboxylic Ethyl phosphine reductase 12 hour, removes the tricarboxylic of excess with G-25 Sephadex size-exclusion column Ethyl phosphine.200mmol compound 5 is dissolved in 50mL DMF, at ice bath together with eluate After lower cultivation 12 hours, concentration reversed-phase high-performance liquid chromatography purifies lyophilizing and obtains purpose product 6.MS Theoretical Calculation 16393.38, actually detected to 16393.96.

Embodiment 2

Aptamer-butanimide alkyl acyl-polypeptide linkers-paraphenetidine-triptolide knot The synthesis (being called for short the dipeptides that " purpose product 10 "-polypeptide connects with valine and citrulline) of structure.

1. the synthesis of intermediate product 7

Under nitrogen atmosphere compound 4108.8mg (0.19mmol) is dissolved in dry In DMF, add cesium carbonate 13mg (0.04mmol), Tritox 0.2mL (1.9mmol), room The lower stirring of temperature, TLC follows the tracks of reaction and terminates to reaction, filters, and after mother liquor concentrations, pillar layer separation obtains Intermediate product 7.MS Theoretical Calculation 715.21, actually detected to 715.24.

2. the synthesis of intermediate product 9

By 71.7mg compound 7 (0.10mmol) and 36.0mg triptolide 2 (0.10mmol) It is suspended in dichloromethane stirring, is cooled to 0 DEG C, drip 4.4 μ L trifluoromethanesulfonic acid (0.05mmol), TLC tracks to reaction to be terminated, and decompression boils off solvent, and pillar layer separation obtains product 9.MS theory meter Calculation 914.44, actually detected to 914.38.

The LC4 of 300nmol sulfur-bearing sulfide linkage is dissolved in PBS buffer solution (pH 7.4), adds three carboxyethyls Phosphine reductase 12 hour, removes three carboxyethyls of excess with G-25 Sephadex size-exclusion column Phosphine.200mmol compound 9 is dissolved in 50mL DMF, trains under ice bath together with eluate After educating 12 hours, concentration reversed-phase high-performance liquid chromatography purifies lyophilizing and obtains product 10.MS theory meter Calculation 16349.40, actually detected to 16349.97.

Embodiment 3

The synthesis of aptamer-succinyl-polypeptide linkers-p-aminophenyl methoxycarbonyl group-triptolide structure (be called for short " dipeptides that purpose product 15-connects with valine and citrulline).

1. the preparation of the product 12 of mesh

(Fmoc refers to fluorenylmethyloxycarbonyl protection group)

Under blanket of nitrogen, 47.3mg compound 3 (0.09mmol) is dissolved in dry oxolane- In the mixed solvent 5mL of dichloromethane 1: 1, add 54.2mg compound 11 (0.09mmol) and 25mg N, N-diisopropyl ethyl amine (0.19mmol), stir 48 hours under room temperature, adds acetic acid Ethyl ester, organic facies washs with 10% citric acid solution, and saturated aqueous common salt washs, washing, anhydrous slufuric acid Sodium is dried, and filters, and decompression and solvent recovery, residue pillar layer separation obtains product 12.MS is theoretical Calculating 987.43, actually detected to 987.47.

2. the preparation of intermediate product 13

Under nitrogen atmosphere, 29.6mg compound 12 (0.03mmol) is joined the DMF of 20% piperidines In solution 3mL, being stirred at room temperature, TLC tracks to reaction to be terminated.Decompression boils off solvent, and residue is used Pillar layer separation obtains product 13.MS Theoretical Calculation 765.36, actually detected to 965.42.

3. intermediate product 14

Under blanket of nitrogen, 15.3mg (0.02mmol) compound 13 is dissolved in 0.2mL dichloromethane, Succinic anhydrides 6.0mg (0.06mmol), DMAP 7.3mg (0.06mmol) is added in system. Mixture is stirred at room temperature overnight, and adds water dilution, be extracted with ethyl acetate (3*10 in system ML), organic facies saturated aqueous common salt washs, and anhydrous sodium sulfate is dried.Decompression boils off solvent, residue Product 14 is obtained with chromatography over CC.MS Theoretical Calculation 865.37, actually detected to 865.33.

4. the preparation of the product 15 of mesh

20nmol nucleic acid aptamer LC4 is dissolved in 200 μ L 0.5M Na₂CO₃/NaHCO₃buffer (pH 9.0), 12nmol compound 14 is dissolved in 200 μ L DMSO, and 40nmol DMT-MM is dissolved in 200μL DMSO.By three after 0 DEG C of mix and blend 12 hours, concentrate and use RP-HPLC color Spectrum purifies lyophilizing and obtains product 15.MS Theoretical Calculation 16265.34, actually detected to 16265.96.

Embodiment 4

Aptamer-butanimide alkyl acyl-glucosides connecting key-replacement para hydroxybenzene methoxycarbonyl group N, N '- The synthesis (being called for short " purpose product 21 ") of dimethyl-ethylenediamine carbonyl-triptolide structure.

1. the preparation of intermediate product 17

Being dissolved in dichloromethane by 91.4mg compound 16 (0.10mmol) ,-50 DEG C add 13.2mg N, and N '-dimethyl ethylenediamine (0.15mmoB, stirring, and it is gradually heating to room temperature, TLC follows the tracks of reaction extremely Terminating, decompression boils off solvent, and residue chromatography over CC obtains product 17.MS Theoretical Calculation 862.33, actually detected to 862.37.

2. the preparation of intermediate product 18

Being dissolved in dichloromethane by 78.8mg compound 3 (0.15mmol) ,-50 DEG C add 86.3 The dichloromethane solution of mg compound 17 (0.10mmol) ,-50 DEG C of stirrings, and it is gradually heating to room Temperature, TLC follows the tracks of and reacts to terminating, and decompression boils off solvent, and residue chromatography over CC obtains product 18.MS Theoretical Calculation 1248.46, actually detected to 1248.55.

3. the preparation of intermediate product 19

The compound 20 (0.03mmol) of 37.5mg is dissolved in methanol, adds the hydroxide Han 6.5mg The aqueous solution of lithium (0.27mmol), is stirred at room temperature, and TLC tracks to reaction to be terminated.Decompression boils off molten Agent, residue pillar layer separation obtains product 19.MS Theoretical Calculation 886.35, actually detected arrives 886.42。

4. the preparation of intermediate product 20

By 319.3mg compound 19 (0.36mmol) and 123.3mg 6-(dimaleoyl imino) caproic acid Succinimide ester (MC-OSu) (0.40mmol) is dissolved in 5mLN-methyl pyrrolidone (NMP), Being stirred at room temperature, TLC tracks to reaction to be terminated.Decompression boils off solvent, adds second toward the grease obtained Ether, has Precipitation, filters, and the filter cake ether washing obtained obtains product 20.MS Theoretical Calculation 1079.42, actually detected to 1079.65.

5. the preparation of the product 21 of mesh

The LC5 of 300nmol sulfur-bearing sulfide linkage is dissolved in PBS buffer solution (pH 7.4), adds tricarboxylic Ethyl phosphine reductase 12 hour, removes the tricarboxylic of excess with G-25 Sephadex size-exclusion column Ethyl phosphine.200mmol compound 20 is dissolved in 50mL DMF, together with eluate under ice bath After cultivating 12 hours, concentration reversed-phase high-performance liquid chromatography purifies lyophilizing and obtains product 21.MS is theoretical Calculating 17784.38, actually detected to 17784.87.

Embodiment 5

Aptamer-butanimide alkyl acyl-sulfur sulfide linkage-to sulfydryl benzene methoxycarbonyl group-triptolide knot The synthesis (being called for short " purpose product-27 ") of structure.

1. the preparation of intermediate product 23

38.9mg compound 22 (0.10mmol) is dissolved in dichloromethane, drips 16.8mg pair The dichloromethane solution of sulfydryl benzyl alcohol (0.12mmol), is stirred at room temperature, and TLC tracks to reaction knot Bundle, decompression boils off solvent, and residue pillar layer separation obtains product 23.MS Theoretical Calculation 437.11, Actually detected to 437.23.

2. the preparation of intermediate product 24

Being dissolved in dichloromethane by 52.6mg compound 3 (0.1mmol) ,-50 DEG C add 65.6mg The dichloromethane solution of compound 23 (0.15mmol) ,-50 DEG C of stirrings, and it is gradually heating to room temperature, TLC follows the tracks of and reacts to terminating, and decompression boils off solvent, and residue chromatography over CC obtains product 24. MS Theoretical Calculation 823.25, actually detected to 823.33.

3. the preparation of intermediate product 25

24.7mg compound 24 (0.03mmol) is joined the DMF solution 3mL of 20% piperidines In, it being stirred at room temperature, TLC tracks to reaction to be terminated.Decompression boils off solvent, and residue column chromatography is divided From obtaining product 25.MS Theoretical Calculation 601.18, actually detected to 601.20.

4. the preparation of intermediate product 26

By 216.6mg compound 25 (0.36mmol) and 123.3mg MC-OSu (0.40mmol) Being dissolved in 5mL NMP, be stirred at room temperature, TLC tracks to reaction to be terminated.Decompression boils off solvent, past The grease obtained adds ether, has Precipitation, filters, and the filter cake ether washing obtained obtains Product 26.MS Theoretical Calculation 794.25, actually detected to 794.30.

5. the preparation of the product 27 of mesh

The LC5 of 300nmol sulfur-bearing sulfide linkage is dissolved in PBS buffer solution (pH 7.4), adds tricarboxylic Ethyl phosphine reductase 12 hour, removes the tricarboxylic of excess with G-25 Sephadex size-exclusion column Ethyl phosphine.Change 200mmol compound 26 to be dissolved in 50mL DMF, together with eluate under ice bath After cultivating 12 hours, concentration reversed-phase high-performance liquid chromatography purifies lyophilizing and obtains product 27.MS is theoretical Calculating 17499.21, actually detected to 17499.94.

Embodiment 6

Aptamer-butanimide alkyl acyl-sulfur sulfide linkage-substituted sulfhydryl butyryl-triptolide structure Synthesis (be called for short " purpose product 32).

1. the preparation of intermediate product 29

By 10.4g (28.8mmol) triptolide 2,9.5g dicyclohexylcarbodiimide (46mmol), 7.4g compound 28 (29mmol) and 1.0g DMAP (8.2mmol) are dissolved in dichloromethane, Being stirred at room temperature, TLC tracks to reaction to be terminated, and is cooled to 0 DEG C and is filtered to remove DCU, and filtrate decompression is steamed Solvent, residue chromatography over CC is gone to obtain product 29.MS Theoretical Calculation 599.20, actually detected To 599.24.

2. the preparation of intermediate product 30

4.4g compound 29 (7.4mmol) and 0.6g 2-MEA (7.8mmol) are dissolved in DMF In, it being stirred at room temperature, TLC tracks to raw material point and substantially disappears, and decompression boils off solvent, residue post Chromatography purity obtains product 30.MS Theoretical Calculation 565.22, actually detected to 565.24.

3. the preparation of intermediate product 31

By 203.7mg compound 25 (0.36mmol) and 123.3mg MC-OSu (0.40mmol) Being dissolved in 5mL NMP, be stirred at room temperature, TLC tracks to reaction to be terminated.Decompression boils off solvent, past The grease obtained adds ether, has Precipitation, filters, and the filter cake ether washing obtained obtains Product 31.MS Theoretical Calculation 758.29, actually detected to 758.37.

4. the preparation of the product 32 of mesh

The LC5 of 300nmol sulfur-bearing sulfide linkage is dissolved in PBS buffer solution (pH 7.4), adds tricarboxylic Ethyl phosphine reductase 12 hour, removes the tricarboxylic of excess with G-25 Sephadex size-exclusion column Ethyl phosphine.200mmol compound 31 is dissolved in 50mL DMF, together with eluate under ice bath After cultivating 12 hours, concentration reversed-phase high-performance liquid chromatography purifies lyophilizing and obtains product 32.MS is theoretical Calculating 17464.25, actually detected to 17463.97.

Embodiment 7

Aptamer-butanimide alkyl acyl-sulfur sulfide linkage-sulfydryl carbethoxyl group-triptolide structure Synthesis (is called for short " purpose product 36 ").

1. intermediate product 33

30.8mg (0.0854mmol) triptolide 2 is dissolved in dichloromethane, adds in system 50.7mg triphosgene (0.171mmol), dropping 55mL pyridine (0.68mmol), it is stirred at room temperature 30 minutes Rear decompression boils off solvent.Add dichloromethane to dissolve, add 48.0mg pyridyldithiol ethanol (0.256 Mmol), stirred overnight at room temperature, add saturated ammonium chloride solution cancellation reaction, dichloromethane extracts, has Machine anhydrous magnesium sulfate is dried.Filtering, decompression boils off solvent.Residue chromatography over CC obtains Product 33.MS Theoretical Calculation 573.15, actually detected to 573.18.

2. intermediate product 34

4.2g compound 33 (7.4mmol) and 0.6g 2-MEA (7.8mmol) are dissolved in In DMF, being stirred at room temperature, TLC tracks to raw material point and substantially disappears, and decompression boils off solvent, residue Product 34 is obtained with chromatography over CC.MS Theoretical Calculation 539.16, actually detected to 539.21.

3. the preparation of intermediate product 35

By 194.3mg compound 34 (0.36mmol) and 123.3mg MC-OSu (0.40mmol) Being dissolved in 5mL NMP, be stirred at room temperature, TLC tracks to reaction to be terminated.Decompression boils off solvent, past The grease obtained adds ether, has Precipitation, filters, and the filter cake ether washing obtained obtains Product 35.MS Theoretical Calculation 732.24, actually detected to 732.31.

4. the preparation of the product 36 of mesh

The LC6 of 300nmol sulfur-bearing sulfide linkage is dissolved in PBS buffer solution (pH 7.4), adds tricarboxylic Ethyl phosphine reductase 12 hour, removes the tricarboxylic of excess with G-25 Sephadex size-exclusion column Ethyl phosphine.200mmol compound 35 is dissolved in 50mL DMF, at ice bath together with eluate After lower cultivation 12 hours, concentration reversed-phase high-performance liquid chromatography purifies lyophilizing and obtains product 36.MS manages Opinion calculating 17626.14, actually detected to 17626.87.

Embodiment 8

Aptamer-butanimide alkylamine diacyl-polypeptide linkers-p-aminophenyl methoxycarbonyl group-Thunder God The synthesis (being called for short " purpose product 39 ", the dipeptides connected with valine and citrulline) of rattan A prime structure.

1. the preparation of intermediate product 38

By 44.1mg compound 13 (0.0576mmol), 19.0mg dicyclohexylcarbodiimide (0.092 Mmol), 7.4mg compound 37 (0.0288mmol) and 2.0g DMAP (0.0164mmol) are dissolved in In dichloromethane, being stirred at room temperature, TLC tracks to reaction to be terminated, and is cooled to 0 DEG C and is filtered to remove DCU, Filtrate decompression boils off solvent, and residue chromatography over CC obtains product 38.MS Theoretical Calculation 1750.77, actually detected to 1750.86.

2. the preparation of the product 39 of mesh

The LC6 of 300nmol sulfur-bearing sulfide linkage is dissolved in PBS buffer solution (pH 7.4), adds tricarboxylic Ethyl phosphine reductase 12 hour, removes the tricarboxylic of excess with G-25 Sephadex size-exclusion column Ethyl phosphine.400mmol compound 38 is dissolved in 50mL DMF, at ice bath together with eluate After lower cultivation 12 hours, concentration reversed-phase high-performance liquid chromatography purifies lyophilizing and obtains product 39.MS Theoretical Calculation 18644.73, actually detected to 18644.35.

Embodiment 9

The synthesis (being called for short " purpose product 41 ") of aptamer-succinyl-triptolide structure.

The synthesis of target product 41

The LC6 of 1.6eq is dissolved in the sodium carbonate of pH=9.0 and the buffer of sodium bicarbonate, once The DMT-MM of add the 1.0eq. being dissolved in DMSO 40 and the 1.0eq. being dissolved in DMSO, Reaction system keeps reaction 12 hours at ambient temperature, after reaction terminates, purifies with RP HPLC Target product 41 is obtained after crude product.MS Theoretical Calculation 17336.06, actually detected to 17336.87.

Embodiment 10

The synthesis (being called for short " purpose product 43 ") of aptamer-carbonyl ethenyl-triptolide structure.

The synthesis of target product 43

The LC6 of 1.6eq. is dissolved in the sodium carbonate of pH=9.0 and the buffer of sodium bicarbonate, once adds Enter to be dissolved in DMSO the 42 of 1.0eq. and be dissolved in the DMT-MM of 1.0eq., reactant in DMSO System keeps reaction 12 hours at ambient temperature, after reaction terminates, purifies after crude product with RP HPLC Obtain target product 43.MS Theoretical Calculation 17304.11, actually detected to 17304.93.

Embodiment 11

Aptamer-butanimide alkyl acyl-polypeptide linkers-p-aminophenyl methoxycarbonyl group-Radix Tripterygii Wilfordii first The synthesis (being called for short " purpose product 48 ") of element 18-position conjugates

1. the synthesis of intermediate product 45

Under blanket of nitrogen, 109.17mg 44 (0.23mmol) is dissolved in dry oxolane, at-78 DEG C It is slowly added to slight excess of LDA, after stirring one hour at this temperature, drips 273.8mgization The dichloromethane solution of compound 1 (1.27mmol) ,-50 DEG C of stirrings after dropping, after 12 hours, Reactant mixture dchloromethane, the potassium hydrogen sulfate solution washing of gained material 0.5N, saturated Brine It, collects organic facies anhydrous sodium sulfate and is dried, after filtration, and decompression and solvent recovery, Residue pillar layer separation obtains product 45.MS Theoretical Calculation 653.27, actually detected to 653.31.

2. the synthesis of intermediate product 46

Under blanket of nitrogen, 58.8mg compound 45 (0.09mmol) is dissolved in dry oxolane- In the mixed solvent 5mL of dichloromethane 1: 1, add 51.5mg compound 4 (0.09mmol) and 25mg N, N-diisopropyl ethyl amine (0.19mmol), stir 48 hours under room temperature, adds acetic acid Ethyl ester, organic facies washs with 10% citric acid solution, and saturated aqueous common salt washs, washing, anhydrous slufuric acid Sodium is dried, and filters, decompression and solvent recovery, and it is theoretical that residue pillar layer separation obtains product 46.MS Calculating 1072.52, actually detected to 1072.65.

2. the synthesis of intermediate product 47

The compound 46 (0.10mmol) of 107.3mg is dissolved in dry oxolane, in room temperature Under the conditions of, adding the tetrabutyl ammonium fluoride (0.12mmol) of 31.3mg, stirring at normal temperature is reacted 3 hours After, concentrating, then extract with dichloromethane, saturated aqueous common salt washs, and anhydrous sodium sulfate is dried, and filters, Being evaporated, residue pillar layer separation obtains product 47.MS Theoretical Calculation 958.43, actually detected arrives 958.56。

4. the synthesis of target product 48

The LC4 of 300nmol sulfur-bearing sulfide linkage is dissolved in PBS buffer solution (pH 7.4), adds tricarboxylic Ethyl phosphine reductase 12 hour, removes the tricarboxylic of excess with G-25 Sephadex size-exclusion column Ethyl phosphine.200mmol compound 47 is dissolved in 50mL DMF, at ice bath together with eluate After lower cultivation 12 hours, concentration reversed-phase high-performance liquid chromatography purifies lyophilizing and obtains purpose product 48. MS Theoretical Calculation 16393.38, actually detected to 16393.96.

Experimental example 1 triptolide derivant-osteosarcoma aptamer conjugates activity in vivo is investigated

1. experiment material:

Experimental drug and reagent: triptolide (hereinafter referred to as " TP "), triptolide derivant (intermediate product 5 of preparation in embodiment 1, hereinafter referred to as " TP-D ", triptolide-aptamer is even Compound (uses embodiment 1 target product compound 6, hereinafter referred to as " A-TP-D "), and DMEM trains Support base, hyclone, Pen .-Strep, matrigel, dehydrated alcohol, normal saline, acetic acid second Ester, acetonitrile etc..

Cell: human osteoblast cell MG63.

Laboratory animal: Female nude mice.

Experimental apparatus: superclean bench, CO2 incubator, inverted microscope, high speed centrifuge is super Speed centrifuge, vacuum desiccator, high performance liquid chromatograph.

2. test method:

2.1 osteosarcoma model constructions:

2.1.1 human osteoblast cell MG63 cultivates: human osteoblast cell MG63 is purchased from Chinese Academy of Sciences Shanghai Cell bank.Cell with containing 10% hyclone (purchased from sigma company) and 1.2ml/1000ml The DMEM culture medium (purchased from sigma company) of Pen .-Strep (purchased from sigma company), in 5%CO2, cultivates in the incubator of 37 DEG C.Inverted microscope carries out morphologic observation and counting to cell, The take the logarithm cell of growth stage of all of experiment is carried out.

2.1.2 the foundation of human osteoblast cell MG63 model of nude mice bearing tumor in situ: female nude mice is by Hong Kong Chinese medicine institute of Hong Kong Baptist University Animal House provides and raises.Take the logarithm the MG63 cell of trophophase, use The matrigel of 50: 50 and serum-free medium resuspended to concentration be 2 × 10⁷Individual/ml.Choose body weight 20g left The right side, the female nude mice of 6-8 week old, inoculate in right side dorsal sc injection 100 μ l cell suspension. Every day, individual gross tumor volume formula was as follows by the size of two-way vernier caliper measurement tumor: V=is (long X is wide by 2)/2, length takes the diameter that tumor is the longest, and wide taking is perpendicular to the shortest long diameter, tumor growth To 200mm³Time, carry out follow-up test.

2.2 laboratory animal packet and administrations

2.2.1 test medicine configuration: triptolide, triptolide derivant (intermediate product 5), Triptolide-osteosarcoma aptamer conjugates (target product 6).Weigh respectively triptolide and in Between product 5 be dissolved in 50: 50 ethanol/normal saline solution, be configured to the medicine that concentration is 0.6mg/ml Solution, is placed in 4 DEG C of refrigerators standby；

Weighing target product 6 to be dissolved in 50: 50 ethanol/normal saline, being configured to concentration is 22.0mg/ml Drug solution, be placed in 4 DEG C of refrigerators standby.

2.2.2 experiment packet and process: tumor growth to 200mm³Time, by 30 tumor-bearing mices, with Machine is divided into A, B group.Wherein A group press the ethanol of 0.6mg/kg dosage tail vein injection triptolide/ Normal saline solution；B group presses the ethanol/physiology of 22.0mg/kg dosage tail vein injection target product 6 Saline solution.It is administered volume and is 1ml/kg.Respectively at 0.5,2,6,12, and during 24h, to often organizing 3 Mouse uses the anesthesia of lumbar injection pentobarbital sodium, uses heart puncturing extracting blood, win the heart, liver, Spleen, lung, kidney, solid tumor etc. are organized.Blood sample is centrifuged 20min in 4 DEG C with 3000rpm, takes serum standby With；The heart, liver, spleen, lung, kidney, solid tumor etc. are organized in-80 DEG C and save backup.

In 2.3 HPLC detection tissues, triptolide/triptolide-osteosarcoma aptamer conjugates contains Amount

Weigh the tissue (heart, liver, spleen, lung, kidney, tumor) of constant weight, add a certain proportion of PH7.5PBS solution, homogenate.Take 0.2ml to be homogenized in eppendorf pipe, 1.2ml ethyl acetate whirlpool Stream extraction 3 minutes, 8000rpm is centrifuged 5min.Take upper strata organic solution layer (1ml) and transfer to another Vacuum drying treatment in individual eppendorf pipe, residue dissolves in 0.1ml ethanol, 20000rpm at 4 DEG C again Centrifugal 10min.Take supernatant (10 μ l) and inject Agilent 1100 type high performance liquid chromatograph.Chromatograph Condition is: detached dowel Symmetry ShieldTM RP18 column (4.6mm × 250mm, 5um), Guard column ODS guid column (3.9mm × 20mm, 5um)；Flowing phase: acetonitrile-water (23: 77)； Flow velocity 1.0mL/min；Column temperature 35 DEG C；Detection wavelength 219nm；Sampling volume 20.0uL.

Study on the stability in 2.4 triptolides-osteosarcoma aptamer conjugates body

Take B group sample in 2.2.2.Detect each respectively by the built HPLC erecting method in 2.3 Triptolide derivant and triptolide derivant-osteosarcoma that time point dissociates in respectively organizing are adaptive The concentration of son, and calculate release rate (release rate=(triptolide concentration)/(triptolide concentration+thunder Tripterygium wilfordii A prime-osteosarcoma aptamer concentration)), monitoring-quantitative expedition medicine is in in-house stability.

2.5 triptolides-osteosarcoma aptamer conjugates tissue distribution is investigated

Take A in 2.2.2, B group sample.By well-established HPLC method in 2.3 be monitored- Quantitative expedition medicine is in normal organ, the distribution situation of tumor tissues.

2.6 triptolides-osteosarcoma aptamer conjugates anti-tumor in vivo activity research: tumor growth To 200mm³Time, 24 tumor-bearing mices are divided into 4 groups (often organizing n=6): C:PBS group； D: free triptolide derivant group (TP-D, intermediate product 5)；E: free triptolide group (TP)；F: triptolide-osteosarcoma aptamer conjugates group (A-TP-D, target product 6).PBS group Blank group as this experiment.Other the three groups difference corresponding medicines of tail vein injection, D, E group Drug dose be 0.6mg/kg, F group drug dose be that 22.0mg/kg is administered twice for mono-week.Continue every four It measures a tumor size and volume.It is administered latter first day, every nude mice abdominal cavity injection 3% penta bar ratio Appropriate sodium is anaesthetized, and cardiac puncture collects blood sample, the chemoresistance correlation factor in detection serum The expression of NF-κ B.After being administered 8 weeks, put to death all nude mices, separate tumor tissues ,-80 DEG C of guarantors Deposit standby.

2.7 statistical analysis

Experimental data uses mean+SD (SD) to represent, data process and use Graphpad Prism 6.0 statistical software.Significance test of difference uses t inspection and method of analysis of variance to carry out.

3. experimental result:

3.1. the release rate during triptolide-osteosarcoma aptamer conjugates is respectively organized

Each time point triptolide-osteosarcoma aptamer conjugates solution release rate in each tissue by HPLC method determines.Investigation result is as follows.Triptolide-osteosarcoma aptamer conjugates is little through 24 At blood plasma and the heart time after, liver, spleen, lung, dissociates hardly in the normal structure such as kidney or dissociates seldom； And in tumor tissues, triptolide-osteosarcoma aptamer conjugates dissociates in a large number, and along with time Between accumulation, degree of dissociation is continuously increased.Above results proved that for connecting triptolide and kindred The alkene ehter bond of the acid-sensitive of tumor aptamer the most also has effect.Conjugates is the most continuous Split, protect C-14 position group, reduce toxicity；Tumor tissues ruptures, discharges Radix Tripterygii Wilfordii first Element derivant, plays therapeutical effect and sees table 1 and Fig. 1.

Table 1

3.2. selective distribution in triptolide-osteosarcoma aptamer conjugates body

Use HPLC detection by quantitative medicine in normal organ, the distribution situation of tumor tissues.Investigate knot Fruit sees Fig. 2.It is administered in latter 0.5 hour, control group A and experimental group B blood medicine in being administered 0.5 hour Concentration quickly rises to peak, but experimental group B release rate in blood is slower than control group A.Real Testing group B to compare with control group A, medicine becomes in heart, spleen, the distribution of three tissue sites of pulmonary Gesture is in investigating the full time period the most similar (being all scaled the concentration of triptolide).0.5-2 upon administration In hour, triptolide derivant is the most centripetal, spleen, and three tissue distribution of lung, after administration, 4 is little Time start eliminate.On the contrary, experimental group B compares with control group A, medicine is at liver, and kidney is with swollen The distribution trend of three tissue sites of tumor is very different (concentration being all scaled triptolide). Experimental group B is distributed in liver, and the concentration of the triptolide of nephridial tissue is substantially low than control group A, and The concentration of the triptolide being distributed in tumor locus exceeds much than control group A.Result above is said The modification of shark bone sarcoma aptamer can promote triptolide selectivity to gather to tumor locus, and Avoid at other tissue, especially hepatic and renal tissue accumulation.See table 2 and Fig. 2.

Table 2

3.3. triptolide-osteosarcoma aptamer conjugates anti-tumor in vivo activity research:

3.3.1 the measurement of gross tumor volume: increase as it is shown on figure 3, PBS group nude mouse tumor volume is Progressive symmetric erythrokeratodermia Greatly, intermediate product 5 (TP-D) group gross tumor volume after starting to inject medicine is slow reduction trend, with trip Comparing from triptolide group (TP) group, gross tumor volume reduction becomes apparent from, target product 6 (A-TP-D) group Gross tumor volume reduces the fastest.

3.3.1 the mrna expression level of NF-κ B in nude mouse serum: as shown in Figure 4, PBS group is naked In Mus serum, the prolongation over time of the mrna expression level of NF-κ B gradually rises, free Radix Tripterygii Wilfordii A prime derivant group (TP-D) group and free triptolide group (TP) group are after third time injection medicine The mrna expression of NF-κ B begins to decline, and two groups at same time point without significant difference.Radix Tripterygii Wilfordii The mRNA level in-site of NF-κ B in A prime derivant-osteosarcoma aptamer conjugates group (A-TP-D) group serum After third time injection medicine, reach maximum, but low compared with TP-D and TP group level, hereafter NF-κ B MRNA level in-site begins to decline, and the most substantially reduces in same time point relatively TP-D and TP group.

4. experiment conclusion:

Triptolide derivant-osteosarcoma aptamer conjugates has internal osteosarcoma selectivity targeting and makees With；Triptolide derivant-osteosarcoma aptamer conjugates is the most continuous at conjugates Splitting, toxicity is little；Triptolide derivant-aptamer conjugates anti-tumor activity in vivo is higher than Thunder God Rattan A prime derivant and triptolide.

Claims

The newest triptolide derivant, it is characterised in that described derivant is such as following formula (I) Conjugates:

Wherein, R₁=for H or OH；R₂=for H or OH；R₃=for H or OH；R₄=for H or OH；R₅=for H or OH；R₆=for H or OH；R₇=for H or OH；G is O or NH；M For O or OH；X is O or OH；

Substituent group S₁For to amino aryl methoxycarbonyl group, to amino aryl methoxyl group, N, N '-dimethyl-N-carbonyl Base ethylenediamine, to hydroxyl virtue methoxycarbonyl group, to hydroxyl virtue methoxyl group, to sulfydryl virtue methoxycarbonyl group, right Sulfydryl virtue methoxyl group, substituted sulfhydryl bytyry, substituted sulfhydryl valeryl, sulfydryl carbethoxyl group or sulfydryl Third oxygen carbonyl；

Substituent group L is sulfur sulfur connecting key, polypeptide linkers or glucosides connecting key；

Substituent group S₂For butanimide alkyl acyl, alkyl bisacyl, or butanimide alkyl Amino diacyl；

A is aptamer；

Wherein S₁It is connected with M or X；Wherein work as S₁When being connected with M, M be O, X be O, X With C₁₈Between be double bond and C₃-C₄Between be double bond, or work as S₁When being connected with M, M be that O, X are OH, X and C₁₈Between be singly-bound and C₁₈-C₃Between and C₁₉-C₄Between be double bond；Wherein work as S₁With X phase Lian Shi, M be OH, X be O, X and C₁₈Between be singly-bound and C₁₈-C₃Between and C₁₉-C₄Between be double Key.
Derivant the most according to claim 1, it is characterised in that described L is sulfur sulfur connecting key Structure is as follows :-S-S-.
Derivant the most according to claim 1, it is characterised in that described L is that polypeptide links key Time, polypeptide linkers is the polypeptide that two to four aminoacid connect.
Derivant the most according to claim 3, it is characterised in that described L is valine and melon Propylhomoserin, phenylalanine and lysine, alanine and lysine, valine and lysine, phenylalanine And arginine, phenylalanine and citrulline, leucine and citrulline, isoleucine and citrulline, or The dipeptides that tryptophan and leucine are formed.
Derivant the most according to claim 1, it is characterised in that described L is glucosides connecting key Time, described glucosides connecting key is β-Artogicurol.
Derivant the most according to claim 1, it is characterised in that described S2 has following knot Structure: butanimide alkyl acyl, alkyl bisacyl or butanimide alkyl amino diacyl:

N is the integer of 1-10, the integer of prioritizing selection 4-6；M is the integer of 1-10, prioritizing selection The integer of 4-6.
Derivant the most according to claim 1, it is characterised in that described aptamer A has SEQ ID NO.1, SEQ ID NO.2 or the nucleotide sequence shown in SEQ ID NO.3, wherein

SEQ ID NO.1:

GTACTTCCGACTTGGGGCGGGTTTGTTGCTGGCTGTCGGCAAAAGTGC A；

SEQ ID NO.2:

GTACTTCCGGCGGGTTCTATGGGCCCTGTCTCCCTTCCCAAAAGTGCA CGCTAC；Or

SEQ ID NO.3:

GTACTTCCCGCGTGTGTGTGTTTGTCGGAGTGTTATCGCAAAAGTGCA CGCTAC。
The newest triptolide derivant, it is characterised in that described derivant is such as following formula (I) Conjugate is:

Wherein, S₁When being connected with M, X and C₁₈Between be double bond and C₃-C₄Between be double bond, or S₁With X When being connected, X and C₁₈Between be singly-bound and C₁₈-C₃Between and C1_9-C₄Between be double bond.
9. the preparation method of triptolide derivant described in claim 1, it is characterised in that described Method comprises the following steps:

One) S1 and L is passed through in polar aprotic solvent or halogenated hydrocarbon solvent condensation reaction or takes Generation reaction, obtains intermediate one；

Two) in halogenated hydrocarbon solvent and triptolide or its analog are by different work for intermediate one Change reagent and be condensed to yield intermediate two；

Three) intermediate two and S2 is condensed to yield intermediate in polar aprotic solvent or halogenated hydrocarbons Three；

Four) intermediate three and aptamer A are anti-by additive reaction or condensation in aqueous buffer Coupling should be carried out and obtain conjugates.
Preparation method the most according to claim 9, it is characterised in that described step one) in, Described polar non-solute be dimethyl sulfoxide, DMF, N,N-dimethylacetamide, N-Methyl pyrrolidone, ether, oxolane, methyl tertiary butyl ether(MTBE), acetone or their mixing Thing；Described halogenated hydrocarbons be dichloromethane, chloroform, tetrachloromethane, dichloroethanes, sym-tetrachloroethane or Their mixture.
11. preparation methoies according to claim 9, it is characterised in that described step 2) in, Described halogenated hydrocarbon solvent be dichloromethane, chloroform, tetrachloromethane, dichloroethanes, sym-tetrachloroethane or Their mixture；Described activating reagent is Arylmethoxycarbonyl acyl chlorides, such as p-nitrophenyl methoxy acyl chlorides, benzene Methoxy acyl chlorides, to methylbenzene methoxy acyl chlorides, benzenyl trichloride methoxy acyl chlorides, to chlorobenzene methoxy acyl chlorides, To fluorobenzene methoxy acyl chlorides, Tritox, trifluoro acetonitrile or DCC.
12. preparation methoies according to claim 9, it is characterised in that described step 3) in, Described polar non-solute is N,N-dimethylacetamide, N-Methyl pyrrolidone, ether, tetrahydrochysene Furan, methyl tertiary butyl ether(MTBE), acetone or their mixture；Described halogenated hydrocarbons be dichloromethane, Chloroform, tetrachloromethane, dichloroethanes, sym-tetrachloroethane or their mixture.
13. preparation methoies according to claim 9, it is characterised in that described step 4) in, Described aqueous buffer is phosphate buffered solution or sodium carbonate/bicarbonate buffer solution.