CN106244570B - A kind of ribalgilase and its derivative and/or variant and its application - Google Patents
A kind of ribalgilase and its derivative and/or variant and its application Download PDFInfo
- Publication number
- CN106244570B CN106244570B CN201610693891.2A CN201610693891A CN106244570B CN 106244570 B CN106244570 B CN 106244570B CN 201610693891 A CN201610693891 A CN 201610693891A CN 106244570 B CN106244570 B CN 106244570B
- Authority
- CN
- China
- Prior art keywords
- rna
- c19orf43
- protein
- albumen
- ribalgilase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
Abstract
The present invention relates to biochemistry, molecular biology, field of biotechnology, specifically, it is related to a kind of ribalgilase and its derivative and/or variant, the ribalgilase and its derivative and/or variant are wider to adaptation ranges such as temperature, pH and ionic conditions, and RNA cleavage activity is higher, the deficiency of some RNase digestion condition harshnesses is compensated for, and reaction condition is mild, there is good commercial application prospect and higher researching value.
Description
Technical field
The present invention relates to biochemistry, molecular biology, field of biotechnology, in particular to a kind of ribonucleic acid
Enzyme and its derivative and/or variant and its application.
Background technique
Ribalgilase RNase (EC3.1.26/27. -) and (EC 2.7.--), are one kind of nuclease, can urge
That changes RNA is degraded into small molecule.Ribalgilase is widely present in microorganism, among animals and plants.The ribonucleic acid of separate sources
There is also differences for its mode of action of enzyme, can be divided into endonuclease and exonuclease according to the difference of its action site.Its
Middle RNase A (EC 3.1.27.5) is widely used in the removal experiment of RNA in laboratory from the pancreas of ox, and
And it is a large amount of studies have shown that it can be used among antiviral, antitumor treatment.It can cut 3 ' end non-matching of RNA
Pyrimidine nucleotide (C and U), pass through 2 ', 3 '-cyclisation monophosphate intermediate product formed 3 '-phosphorylations product.The albumen can
With the RNA that the degradation of specificity is single-stranded, structure and specific mechanism of action have been illustrated.Hereafter there are many RNase quilts again
It was found that.Such as it can be with the RNaseH of the RNA in cutting DNA-RNA hybrid product.3 ' the ends specificity cutting single-chain RNA are non-to match
Pair G RNaseT1 etc..RNase not only has the degradation function of RNA, and a portion also takes part in the various other of cell
Physiological function, such as the generation of RNA, the formation of RNA variable sheer body are antiviral etc..It is a variety of with going deep into for scientific research
RNase is found, and the specific mechanism of its effect, site of effect etc. are all illustrated one by one, and new RNase is also by constantly
It was found that.
Since the Human Genome Project is completed, new gene is constantly found, but has its Unknown Function of many genes.Not
Know functional gene C19orf43, it is rare to be raised, only had in 7 or so documents and referred to but about the specific of the gene
Function does not do any illustrate.People C19orf43 (Chromosome 19open reading frame 43) assignment of genes gene mapping is in people 19
Number 13.2 section of the short arm of a chromosome, the homologous gene of the gene are widely present in eucaryote, the cell from insect to the mankind
In had been found that the presence of the DNA homolog gene.C19orf43 gene encodes one and contains 176 amino acid, and molecular weight is
The albumen of 18.42KDa, albumen number in UniProt are as follows: Q9BQ61 (CS043_HUMAN).It is widely present in various groups of human body
It knits in organ, its expression is found in nucleus and organelle.But not about any report of the protein function.
The purpose of the present invention is clone and the expression and purification albumen, it was demonstrated that the function of the albumen, and elaborate that the albumen is degraded in RNA
In specific mechanism of action.C19orf43 albumen in cell, can be with degradation of rna, while may also take part in other lifes
Reason process, other important purposes still require study.
In view of this, the present invention is specifically proposed.
Summary of the invention
The purpose of the present invention is to provide a kind of ribalgilases and its derivative and/or variant to solve the above problems.
In order to realize above-mentioned purpose of the invention, the following technical scheme is adopted:
A kind of ribalgilase and its derivative and/or variant, with amino acid sequence as shown in SEQ ID NO:1
Ribonuclease activity segment.
Ribonuclease activity segment shown in SEQ ID NO:1 is located away from the gene C 19orf43 of RNase albumen
One structural domain of (Chromosome 19open reading frame 43) is to play cutting RNA in C19orf43 albumen to live
The main domains of property.
In one embodiment of the invention, it provides to C19orf43 full-length proteins and its various deletion mutants
Rnase Activity determination, from wherein visible derivative with ribonuclease activity segment shown in SEQ ID NO:1 and/or
Variant all has RNase activity.
The present invention be claimed ribonuclease activity segment shown in SEQ ID NO:1 and comprising the segment, have
The active various derivatives of RNase and/or variant.
Reaction condition when ribalgilase and its derivative and/or variant cutting RNA as described above are as follows:
37 DEG C~75 DEG C, pH 6.5~12.
Ribalgilase and its derivative and/or variant provided by the invention adapt to temperature, pH and ionic conditions etc.
Range is wider, and RNA cleavage activity is higher, compensates for the deficiency of some RNase digestion condition harshnesses, and reaction condition temperature
With there is good commercial application prospect and higher researching value.
A kind of isolated nucleic acid molecules, the nucleic acid molecules are selected from following nucleic acid:
A), DNA or RNA encodes ribalgilase and its derivative and/or variant described in claim 1；
B the nucleic acid of complementary nucleic acid defined in) and A).
The claimed DNA molecular of the present invention further includes cDNA sequence related to this.
Preferably, the isolated nucleic acid molecules include nucleic acid sequence shown in SEQ ID NO:2.
Nucleic acid sequence shown in SEQ ID NO:2 is to encode ribonuclease activity segment shown in SEQ ID NO:1
Protein sequence.
A kind of carrier comprising nucleic acid molecules as described above.
A kind of host cell is converted by carrier as described above.
In one embodiment of the invention, preferably the carrier is prokaryotic expression carrier pET33b (+), and the preferably host is thin
Born of the same parents are Escherichia coli Ecoli BL21 (DE3) cell.
A method of ribalgilase and its derivative and/or variant as described above are prepared, is included the following steps:
In the medium with cultivate host cell as described above under suitable condition of culture；
Isolate and purify to obtain from the lysate for the host cell cultivated the ribalgilase and its derivative and/or
Variant.
A kind of kit, the kit include ribalgilase as described above and its derivative and/or variant.
The inhibitor of ribalgilase and its derivative and/or variant as described above.
Preferably, the inhibitor includes Zn2+、EDTA、EGTA。
Wherein EDTA and EGTA plays the role of part and inhibits the ribalgilase and its derivative and/or variant.
The present invention successfully constructs and expression and purification C19orf43 albumen, and demonstrates the cutting of C19orf43 protein rna
Function elaborates specific action site and mechanism in RNA cutting, while having inquired into RNA cutting process required for the enzyme
Condition, find the enzyme RNA degrade, synthesis etc. research fields tool has been widely used.In addition to RNA cutting function, greatly
Other physiological functions of cell may be taken part in, it is on the knees of the gods at present.Meanwhile the present invention is also discovery and the function of unknown RNase
It can study and provide new thinking and reference.
Detailed description of the invention
It, below will be to specific in order to illustrate more clearly of the specific embodiment of the invention or technical solution in the prior art
Embodiment or attached drawing needed to be used in the description of the prior art be briefly described, it should be apparent that, it is described below
Attached drawing is some embodiments of the present invention, for those of ordinary skill in the art, before not making the creative labor
It puts, is also possible to obtain other drawings based on these drawings.
Fig. 1 is that C19orf43 gene PCR expands glue figure；
Fig. 2 is the dyeing picture of the protein induced expression of C19orf43；
Fig. 3 is C19orf43 albumen warpEach component dyes picture to pure after purification；
Fig. 4 is various types RNA cutting result；
Fig. 5 is the influence of time and temperature to C19orf43 Protein cleavage RNA；
Fig. 6 is influence of the pH to C19orf43 Protein cleavage RNA；
Fig. 7 is influence of the different ions condition to C19orf43 Protein cleavage RNA；
Fig. 8 is that the building of C19orf43 protein truncation body and RNA cleavage activity are verified；
Fig. 9 is the mechanism of C19orf43 Protein cleavage RNA.
Specific embodiment
Embodiment of the present invention is described in detail below in conjunction with embodiment, but those skilled in the art will
Understand, the following example is merely to illustrate the present invention, and is not construed as limiting the scope of the invention.It is not specified in embodiment specific
Condition person carries out according to conventional conditions or manufacturer's recommended conditions.Reagents or instruments used without specified manufacturer is
The conventional products that can be obtained by commercially available purchase.
The purpose of the present invention is pass through people C19orf43 gene cloning, protein induced expression and purification, external RNA cutting experiment
The methods of, illustrate the mechanism of C19orf43 Protein cleavage RNA.And illustrate the prospect of its application.
The present invention provides people's C19orf43 gene cloning, plasmid construction, protein induced expression and purification, external RNA cuttings
The specific implementation step of experiment；
In embodiment, the present invention provides the particular contents operated as follows:
The acquisition of cDNA library: after HeLa-S3 cell culture is good, RNA is extracted, MMLV reverse transcriptase, construction cDNA are used
The specific steps in library.
The clone of C19orf43 gene: the template that the cDNA library with building is PCR expands C19orf43 segment, and glue returns
After receipts, digestion is overnight, is connected into identical prokaryotic expression carrier pET33b (+) after glue recycling segment, converts coated plate, picking monoclonal enzyme
Identification is cut, and confirmation result is sequenced.
PET33b (+)-C19orf43 expression vector built, is transformed into Escherichia coli Ecoli BL21 (DE3),
The expression of IPTG inducible protein, and provide the condition of protein expression.
Large-scale culture bacterium, is collected by centrifugation, and cracks bacterium solution, by the AKTA pure protein purification instrument of GE company, and
The HisTrap HP column of GE company, 75 column of HiTrap SP HP column and superdex, by C19orf43 protein purification and dense
Contracting measures protein concentration, after packing is quick-frozen, -80 DEG C of preservations.
Design digestion system, verify C19orf43 to different types of RNA, can be cut, inquire into cutting time,
The factor of the influence enzymatic activity such as temperature, ion concentration and pH.It was found that C19orf43 albumen, can cut different types of RNA,
And seldom limited by ion concentration and type in cutting process, pH adaptation range is wider, under pH 6.5~12, the albumen
With good cleavage activity.Temperature range adapts to extensively, show good digestion activity under the conditions of 37 DEG C~75 DEG C.
By synthesizing the cutting experiment of tiny RNA, the mechanism of C19orf43 Protein cleavage RNA is illustrated, mainly by cutting
Cut purine bases in RNA, degradation of rna.
A kind of kit is also claimed in the present invention, and the kit includes ribalgilase as described above and its derivative
Object and/or variant.
The building of embodiment 1 C19orf43 gene cloning and prokaryotic expression carrier
One, the building of people HeLa-S3 cell cdna library, is broadly divided into following steps.
1, the culture of HeLa-S3 cell, cell are grown in 90%DMEM, 10%FBS, 1% dual anti-culture medium, condition
It is 37 DEG C, 5%CO2。
2, it grows fine to cell, when convergence degree is up to 90% in culture bottle, exhausts cell culture fluid, add sterile PBS solution
Cleaning cell 2 times exhausts.
3, T25 culture dish adds 1ml Trizol (Invitrogen) to dissolve cell, is beaten repeatedly with pipettor suction, lysis at room temperature
15min is drawn to new 1.5ml without in the centrifuge tube of RNase, adding 200 μ l chloroforms acutely to mix 15s, stands 3min, 12000rpm
It is centrifuged 5min.
4, supernatant is drawn to new 1.5ml without in the centrifuge tube of RNase, adding 500 μ l isopropanols to mix, and stands 20min.
12000rpm, 4 DEG C of centrifugation 15min.
5, supernatant is abandoned, cleans precipitating with 70% ice-cold ethanol solution 1ml, 12000rpm, 4 DEG C of centrifugation 5min, in abandoning
Clearly, it dries up.
6, plus 200 μ l Nuclease-free water (Ambion) dissolve, and survey concentration.
It 7, will according to SupersciptIII Reverse Transcription protocol (Invitrogen) step
MRNA reverse transcription in total serum IgE containing poly (A) is at single stranded DNA, and construction cDNA library, -20 DEG C save backup.
Two, the building of C19orf43 gene cloning and prokaryotic expression carrier
1, according to the nucleotide sequence of C19orf43 gene (nucleotide sequence described in SEQ ID NO:3), design primer
(upstream primer: tccgaattcgatggctgcccgagggag, downstream primer: acgcgtcgactcatttcaccaggggcc),
Carry out PCR amplification C19orf43 genetic fragment, pcr amplification product glue figure such as Fig. 1.
Reaction system are as follows:
PCR amplification program are as follows:
The primer of truncate are as follows: C19orf43A (upstream primer: draw by tccgaattcgggcgtgaacttgttcgc, downstream
Object: acgcgtcgactcatttcaccaggggcc), C19orf43B (upstream primer:
Tccgaattcgggcgtgaacttgttcgc, downstream primer: ccgCTCGAGgtcacctttacttgttaatac),
C19orf43C (upstream primer: tccgaattcgatggctgcccgagggag, downstream primer:
Ccgctcgaggcccggaccgcccttcctcttc), C19orf43D (upstream primer:
Tccgaattcgtccacacttagcttcgtg, downstream primer: ccgctcgagtttcaccaggggccgag), C19orf43E
(upstream primer: tccgaattcgatggctgcccgagggag, downstream primer: acgcgtcgactcatttcaccaggggcc).
2, after being tapped and recovered PCR product race glue, using the DNA restriction enzyme EcoRI&SalI of selection by segment 37
DEG C, digestion overnight, kit recycles the good segment of digestion.
3, pET33b (+) prokaryotic expression carrier is carried out 37 DEG C using same restriction enzyme, stays overnight digestion, reagent
Box recycles the good linearized vector of digestion.
4, the linearized vector of recycling and DNA fragmentation are matched according to molar ratio 1:3-1:6 using T4DNA (NEB) ligase
Linked system is set, referring in particular to the operation manual of T4 ligase, 16 DEG C of connections overnight.
5, connection product is transferred among competent E.coli E.coli using heat shock method, 1ml LB culture medium is added,
37 DEG C, 100rpm is cultivated 1 hour.
6, the Escherichia coli of conversion are applied to the plate containing kan (kanamycins), be placed in 37 DEG C of constant incubators
Culture.
7, monoclonal is selected, bacterium is shaken, extracts plasmid, glue identification, the correct plasmid of endonuclease bamhi size are run in digestion, and sample presentation is surveyed
Sequence, correct plasmid are used for the inducing expression of albumen.
The inducing expression and purifying of 2 C19orf43 albumen of embodiment
1, pET33b (+)-C19orf43 plasmid is transferred in prokaryotic expression carrier Ecoli BL21 (DE3), chooses monoclonal
Bacterium is shaken, IPTG is added to induce, the identification of SDS-Page glue is run, determines final inductive condition, as shown in Fig. 2, inductive condition is 16 DEG C,
Protein expression effect is best within 16 hours.
2, picking monoclonal shakes bacterium, expands culture to 100ml OD600=1,4 × 1L LB culture medium is added as seed
In, additional amount is adjusted, makes OD600=0.05 in LB culture medium, 37 DEG C, 200rpm culture, different periods take bacterium solution to survey OD value.When
When OD600=0.6, it is room temperature that culture bottle, which is taken out cooling,.IPTG to final concentration 0.4mM is added, 16 DEG C of 200rpm cultures 16 are small
When induce C19orf43 protein expression.6000rpm, 4 DEG C of centrifugation 10min collection thallus, addition lysate (300mM NaCl,
50mM Tris pH 7.5,10mM imidazole, 0.02% (w/v) NaN3, 20% (v/v) glycerol, 0.22 μm
Filtered) -80 DEG C of preservations afterwards.
3, bacterium solution is led after 14,500psi (ATS Engineering Ltd.) broken 3-5 recycles through high pressure homogenizer
Enter and add NP-40 in small beaker, until final concentration of 0.1% (v/v), low speed mixes 20min, bacterial cell disruption, and protein purification etc. owns
Operating procedure is completed in 4 DEG C of rooms.After broken, 4 DEG C of centrifugation 80min of 14000rpm.Take supernatant, 0.22 μm of filtering.Upper 5ml
HiTrap His column (GE) purifying, through 5%, 10% elutriant (300mM NaCl, 50mM Tris pH7.5,500mM
Imidazole, 0.02% (w/v) NaN3, 20% (v/v) glycerol, 0.22 μm of filtered) elution after, elutriant is dense
Degree rises to 60%, elutes 5 column volumes, collects each pipe containing 280nm absorption peak.With low salt solutions (50mM NaCl,
50mM Tris pH 7.5,0.02% (w/v) NaN3, 20% (v/v) glycerol, 0.1mM EDTA (pH 8.0), 0.22 μm
Filtered it) is diluted to when NaCI concentration is 75mM and stops, DTT to final concentration of 1mM is added.Upper 5ml HiTrap SP after mixing
HP column is purified, by the way of branch's elution, the first step elutes the high level salt solution that foreign protein is 10%, second step elution
The high level salt solution that foreign protein is 25%, high level salt solution (1M NaCl, 50mM Tris pH7.5,0.02% (w/v) NaN3, 20%
(v/v) glycerol, 0.1mM EDTA (pH 8.0), 0.22 μm of filtered) elution 3 column volumes of foreign protein after, use
60% high level salt solution elutes 5 column volumes of albumen.Each pipe eluate containing 280nm absorption peak is collected, millipore is used
Protein concentration to volume is 1ml by the concentration tube of the 10KDa cut-off of company's production.Upper superdex 75 (GE) column, into
The separation of row molecule sieve classification, eluent are (250mM NaCl, 5mM Tris pH 7.5,0.02% (w/v) NaN3, 20% (v/
V) glycerol, 0.22 μm of filtered).Each pipe eluate containing 280nm absorption peak is collected, protein concentration is concentrated into
Molar extinction coefficient for 10mg/ml, albumen is pre- with reference to (http://www.expasy.ch/tools/protparam.html)
Survey numerical value.Liquid nitrogen wink freezes after albumen is dispensed, -80 DEG C of preservations, spare.The purification result of each component refers to Fig. 3, wherein every swimming
Road indicates the eluted product obtained by different purification columns, and crude is the lysate of bacterium, and Ft of His is His column stream river
Liquid, His E8 are His column the, and No. 8 pipe eluted products, SP E4 is No. 4 pipe eluted product, SP E18 after SP column purification
For No. 18 pipe eluted product after SP column purification, GF E8 is No. 8 pipe eluted product, GF E11 after molecular sieve purification
For the o.11 pipe eluted product after molecular sieve purification, after GF group is divided into molecular sieve classification separation, the concentration of protein purification final product
The sample saved backup, C19orf43 albumen warpPure purifies instrument three-step column after purification, and purity is greater than 99%.
The 3 different types of RNA of C19orf43 Protein cleavage of embodiment
1, the cutting experiment of total serum IgE, the extraction of total serum IgE is referring to Trizol method above.It is each anti-in total serum IgE cutting experiment
2 μ g RNA are added in Ying Guanzhong, and different amounts of C19orf43 protein dissolution is in 2 μ l gel buffer (250mM NaCl, 5mM
Tris pH 7.5,0.02% (w/v) NaN3, 20% (v/v) glycerol, 0.22 μm of filtered) in, Nuclease-
Free water is added to 20 μ l, is placed in 37 DEG C, reacts 30min.After loading buffer is added, 1%agarose glue point
From as a result as shown in A figure in Fig. 4.When C19orf43 albumen additional amount is 1 μ g, total serum IgE amount is significantly reduced, such as Fig. 4 A
Middle lane 4, when C19orf43 albumen additional amount is 2 μ g, total serum IgE is almost all degraded, such as lane 5 in Fig. 4 A.
2, in the cutting experiment of single RNA, that has used T7 (Thermo) transcription contains ɑ-32P-GTP(PerkinElmer)
The RNA of label, RNA additional amount is equal in each reaction, and reaction system is 20 μ l, and reaction condition is 37 DEG C, 30min.Phenol chloroform
Extract RNA, ethyl alcohol and Glycogen precipitate 20min, and -40 DEG C, centrifugation abandons supernatant, adds 1 × loading, 95 DEG C of denaturation 5min,
6% polyacrylamide urea glue separates for 550V 2 hours, and after running glue, phosphorus screen, after 24 hours, scanner are pressed in sealing
(PerkinElmer), scanning result.When the additional amount of C19orf43 albumen is 0.1 μ g, the amount of RNA has significantly for experiment discovery
Property reduce, such as lane 2 and lane 5 in Fig. 4 B, when the additional amount of C19orf43 albumen is 1 μ g, RNA amount has extremely significant drop
It is low, such as lane 3 and lane 6 in Fig. 4 B.T7 transcription system and transcription are needed what condition was provided referring to Thermo company
Laboratory Manual.C19orf43 albumen can cut the RNA with neck ring structure as the result is shown, and normally without special
The RNA of structure, as shown in B figure in Fig. 4.
3, in the cutting experiment of tiny RNA, tiny RNA length is 31nt, and synthesizing cleavage reaction system by biotech firm (IDT) is
20 μ l, RNA additional amounts are 2pmoles, and C19orf43 albumen additional amount is 1 μ g, and reaction condition is 37 DEG C, 30min.Addition 2 ×
Stop solution terminates reaction, 20% polyacrylamide urea glue, and RNA fuel stain- is used in 200V 30min separation afterwards
All dyeing.C19orf43 albumen can cut chemically synthesized tiny RNA, such as lane 2 in Fig. 4 C figure.
The exploration of 4 C19orf43 Protein cleavage RNA condition of embodiment
1, the influence of time and temperature to C19orf43 Protein cleavage RNA, cutting body refer in embodiment 3 the 2nd article.It is real
Result is tested as shown in figure 5, the amount of RNA has conspicuousness reduction after cutting 5min, such as lane2 in Fig. 5 A, RNA has pole after 10min
It significantly reduces, the results showed that C19orf43 cutting RNA efficiency is very high, referring to Fig. 5 A and Fig. 5 B.Temperature cuts C19orf43 albumen
The influence cut, referring to Fig. 5 C and 5D temperature up to lane 5 in such as 5C figure after 37 DEG C, RNA amount has extremely significant reduction, it is contemplated that 95 DEG C
When, there are signs of degradation by RNA, do not consider the cutting condition of the temperature.37 DEG C to 75 DEG C, C19orf43 albumen is with higher
RNA cleavage activity.Illustrate that C19orf43 albumen temperature range adaptability is wider.The feature can be very good extension C19orf43 egg
The white application in terms of RNA degradation.
2, influence of the pH condition to C19orf43 Protein cleavage RNA, cutting body refer in embodiment 3 the 2nd article.PH is from 6-
Under the conditions of 12, influence of the different pH to C19orf43 Protein cleavage RNA is had detected respectively, when pH=6 affects C19orf43 egg
The white cutting to RNA, such as lane 2 in Fig. 6 A, C19orf43 has degradation, and the reduction of RNA amount to RNA when 6.5~12 pH
With conspicuousness, such as lane 3-lane 15 in Fig. 6 A.RNA can voluntarily degrade when pH=13, such as 5 He of lane in 6C figure
Lane 6 does not consider the pH value.Fig. 6 illustrates that C19orf43 albumen pH range accommodation is wider, in 12 difference pH of pH 6.5-pH
Under the conditions of all there is good cleavage activity to RNA, the feature can be very good expand C19orf43 albumen in terms of RNA degradation
Application.
3, influence of the different ions condition to C19orf43 Protein cleavage RNA, cutting body refer in embodiment 3 the 2nd article.
Only contain NaCl, Tris and glycerol among the Gel buffer of protein dissolution, whether other ionic conditions can influence
Cutting of the C19orf43 albumen to RNA? the present invention has chosen the K of monovalence+, the Mg of divalent2+, Mn2+, Ca2+, Zn2+And metal from
Sub- chelating agent EDTA and EGTA studies the influence of different ion pair C19orf43 Protein cleavage RNA, as a result as in Fig. 7 A and B
Shown, various ions and EDTA and EGTA have different degrees of influence to C19orf43 cutting RNA, wherein Zn2+It is right
C19orf43 Protein cleavage RNA is significantly inhibited, such as Lane 7 in Fig. 7 A, for terminate enzyme reaction EDTA and
EGTA chelating agent has certain inhibitory effect, but unobvious.Other ion pair C19orf43 cutting RNA are not significant
It influences.The enzymatic activity of C19orf43 does not need bivalent ions auxiliary, in the presence of chelating agent EDTA and EGTA, still has very
Good cleavage activity, it was demonstrated that C19orf43 can have relatively broad application.
The building of 5 C19orf43 different mutants of embodiment
The building of C19orf43 different mutants in order to probe into the albumen which section region have RNA cleavage activity,
C19orf43A (55-176), C19orf43B (55-148), C19orf43C (1-110), C19orf43D (111-176),
The building of C19orf43E (1-176,146K-A) different mutants is referring to step 2 in embodiment 1, protein induced and purified reference
Embodiment 2；The amino acid sequence of C19orf43 (1-176) is as shown in SEQ ID NO:4.By the different truncation body proteins of purifying
RNA is respectively cut, detects the RNA cleavage activity which section truncation body protein contains as full-length proteins and is as a result sent out such as Fig. 8 C
Now in addition to C19orf43C does not have RNA cleavage activity, other truncates all have RNA cleavage activity, and activity is higher, such as scheme
Shown in 8A and Fig. 8 B, the active structure domain for thus obtaining its RNA cutting is located in 39, the area C-terminal 111-148 amino acid, the section
Amino acid sequence as shown in SEQ ID NO:1, the nucleic acid sequence of the section is as shown in SEQ ID NO:2.C19orf43 albumen
Truncate all has good RNA cleavage activity.C19orf43D only contains 66 amino acid of C-terminal, but RNA with higher
Cleavage activity can be widely used in RNA removal experiment, with good development and application prospects.
After the reaction was completed, each group is remaining for the degradation of rna that Ratio and Digestion Ratio refers in Fig. 5~Fig. 8
RNA amount and Initial R NA amount ratio.
The molecular mechanism of 6 C19orf43 Protein cleavage RNA of embodiment
The tiny RNA containing both ends methylation signature synthesized using BIONEER company is inquired into as illustrated in figure 9 a
The molecular mechanism of C19orf43 Protein cleavage RNA.The tiny RNA length wherein synthesized is 10 nucleotide, and cutting condition is 37 DEG C,
30min, reaction system is 20 μ l, referring to 3 step 3 of embodiment.According in Fig. 9 B and Fig. 9 C shown in 8 result of lane 2 and lane,
C19orf43D can cut 1A, 1G, A1 and G1, and cannot cut U and C pyrimidine bases, it was demonstrated that C19orf43D cuts point of RNA
Handset system is that RNA is degraded by purine bases in cutting RNA.It is simultaneously from RNA to determine that C19orf43D cuts RNA
The end 5' or 3' or middle position.Three RNA have been synthesized, such as Fig. 9 D, have been carried out 3 RNA according to identical digestion condition
Cutting experiment finds experimental group RNA in lane 3,5 and 7, by C19orf43 Protein cleavage, referring to Fig. 9 E.This RNA of 5R5
Both ends are all methylated, and cannot be cut by RNase from both ends, C19orf43 can cut the RNA, illustrate C19orfr43
Protein cleavage RNA be by RNA molecule inside purine bases, therefore the present invention propose C19orf43 Protein cleavage RNA point
Handset simulation, such as Fig. 9 F.C19orf43 Protein cleavage RNA, be by RNA molecule inside purine bases realize.
The above are embodiment cited by specific explanations is made to the content of present invention, all are based on expression matter of the invention
Grain, C19orf43 truncate the building of body protein, the molecular mechanism etc. of protein expression and purification and C19orf43 Protein cleavage RNA
Belong to the scope that the present invention protects.
Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention., rather than its limitations；To the greatest extent
Present invention has been described in detail with reference to the aforementioned embodiments for pipe, but those skilled in the art should understand that: its
It is still possible to modify the technical solutions described in the foregoing embodiments, or to some or all of the technical features
It is equivalently replaced；And these are modified or replaceed, various embodiments of the present invention skill that it does not separate the essence of the corresponding technical solution
The range of art scheme.
Claims (1)
1. the amino acid sequence application of active fragment as ribalgilase as shown in SEQ ID NO:1；
Reaction condition when the ribalgilase cutting RNA are as follows:
37 DEG C~75 DEG C, pH6.5~12.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610693891.2A CN106244570B (en) | 2016-08-18 | 2016-08-18 | A kind of ribalgilase and its derivative and/or variant and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610693891.2A CN106244570B (en) | 2016-08-18 | 2016-08-18 | A kind of ribalgilase and its derivative and/or variant and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106244570A CN106244570A (en) | 2016-12-21 |
| CN106244570B true CN106244570B (en) | 2019-09-24 |
Family
ID=57591665
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610693891.2A Active CN106244570B (en) | 2016-08-18 | 2016-08-18 | A kind of ribalgilase and its derivative and/or variant and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106244570B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109655608B (en) * | 2018-12-13 | 2020-02-21 | 杭州多泰科技有限公司 | Exosome protein for osteosarcoma diagnosis and instant detection method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1351162A (en) * | 2000-10-26 | 2002-05-29 | 上海博德基因开发有限公司 | Polypeptide-ribonuclease P4030.69 and polynucleotide for coding it |
| US9254311B2 (en) * | 2012-04-02 | 2016-02-09 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins |
-
2016
- 2016-08-18 CN CN201610693891.2A patent/CN106244570B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1351162A (en) * | 2000-10-26 | 2002-05-29 | 上海博德基因开发有限公司 | Polypeptide-ribonuclease P4030.69 and polynucleotide for coding it |
| US9254311B2 (en) * | 2012-04-02 | 2016-02-09 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins |
Non-Patent Citations (3)
| Title |
|---|
| ACCESSION: BC001840;NCBI Database;《GenBank》;20060804;BC001840 * |
| ACCESSION: CAE89426.1;NCBI Database;《GenBank》;20031217;CAE89426.1 * |
| 猪后腿肉中亮氨酰氨肽酶的纯化与酶学特性研究;赵改名等;《南京农业大学学报》;20131231;第36卷(第5期);摘要 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106244570A (en) | 2016-12-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105732816B (en) | Modified cascade ribonucleoproteins and uses thereof | |
| JP2020078330A (en) | Materials and methods for synthesizing nucleic acid molecules with minimum error | |
| US9005935B2 (en) | Methods and compositions for DNA fragmentation and tagging by transposases | |
| CN116096876A (en) | Class II V-type CRISPR system | |
| ES2716619T3 (en) | Yeast promoters for protein expression | |
| CN110499305A (en) | Expression vector, construction method and its expression and purification of nuclease protein Cas9 | |
| CN106244570B (en) | A kind of ribalgilase and its derivative and/or variant and its application | |
| CN109468334A (en) | A kind of tobacco protein kinase gene NtCIPK25-1 and its cloning process and application | |
| JP2018514231A (en) | Separation of growth and protein production | |
| JP2022522397A (en) | How to Regularly Build Circular and Linear DNA Molecules | |
| CN108424943B (en) | Method for producing 2 '-deoxy-2' -fluoro-beta-D-arabinosyladenylate | |
| EP1539945B1 (en) | Recombinant type ii restriction endonucleases, mmei and related endonucleases and methods for producing the same | |
| CN102703400A (en) | Hot start DNA (Deoxyribose Nucleic Acid) polymerase and application thereof | |
| KR101841264B1 (en) | Recombinant Vector Including Gene of Autopahgy Activation Protein and Crystallizing Method for Recombinant Protein Using Thereof | |
| JP6349309B2 (en) | New DNA-cleaving enzyme | |
| CN103898131A (en) | DNA of coded DNA polymerase separated from thermophilic bacteria | |
| EP2718430A2 (en) | Sequence-specific engineered ribonuclease h and the method for determining the sequence preference of dna-rna hybrid binding proteins | |
| WO2023019832A1 (en) | Expression and purification method for main protease of coronavirus | |
| KR20130141001A (en) | A novel vector system for isolation and purification of target proteins | |
| CN115029333A (en) | Endonuclease and its purification method and use | |
| CN110157695A (en) | A kind of system and method for plant RNA m5C methylation modification | |
| RU2774120C1 (en) | Escherichia coli bl21(de3)plyss/pet15b-hiscpf1 strain: producer of rna-guided endonuclease crispr/cpf1 | |
| Alias et al. | Isolation and Molecular Cloning of Carbohydrate Binding Module (CBM40) From Vibrio cholerae Non-O1 Neuraminidase. | |
| CN111088235B (en) | Double-stranded DNA peptide ligase dDPlaseI and use method thereof | |
| RU2333956C1 (en) | STRAIN E coli BL21(DE3)/pET-hHSP70 - PRODUCENT OF PROTEIN OF HEAT SHOCK IN HUMANS HSP70 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |