CN106237317A - The Vaccinum Calmette-Guerini being made up of antigen of mycobacterium tuberculosis - Google Patents

The Vaccinum Calmette-Guerini being made up of antigen of mycobacterium tuberculosis Download PDF

Info

Publication number
CN106237317A
CN106237317A CN201510324548.6A CN201510324548A CN106237317A CN 106237317 A CN106237317 A CN 106237317A CN 201510324548 A CN201510324548 A CN 201510324548A CN 106237317 A CN106237317 A CN 106237317A
Authority
CN
China
Prior art keywords
tuberculosis
mycobacterium
sequence
vaccine
rv0792c
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201510324548.6A
Other languages
Chinese (zh)
Inventor
刘军
张鹭
郭沛
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CHENGDU YONG'AN PHARMACEUTICAL Co Ltd
Fudan University
Original Assignee
CHENGDU YONG'AN PHARMACEUTICAL Co Ltd
Fudan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by CHENGDU YONG'AN PHARMACEUTICAL Co Ltd, Fudan University filed Critical CHENGDU YONG'AN PHARMACEUTICAL Co Ltd
Priority to CN201510324548.6A priority Critical patent/CN106237317A/en
Priority to CN201580079653.6A priority patent/CN107531764A/en
Priority to PCT/CN2015/091068 priority patent/WO2016201825A1/en
Publication of CN106237317A publication Critical patent/CN106237317A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/04—Mycobacterium, e.g. Mycobacterium tuberculosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/35—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Mycobacteriaceae (F)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids

Abstract

The present invention relates to genetic engineering field and Vaccinum Calmette-Guerini, diagnostic field.The invention provides and a kind of comprise antigen of mycobacterium tuberculosis Rv0976c, Rv1255c, Rv3160c and/or Rv0792c or its corresponding immunogenic composition of encoding gene, vaccine or therapeutic composition.

Description

The Vaccinum Calmette-Guerini being made up of antigen of mycobacterium tuberculosis
Technical field
The invention belongs to Vaccinum Calmette-Guerini field, compositions is treated particularly to a kind of immunogenic composition, vaccine or system, it is used for preventing or treating by pathogenic mycobacterium, such as: the infection that mycobacterium tuberculosis, mycobacterium bovis BCG, mycobacterium africanum, Mycobacterium leprae, mycobacterium buruli cause.This immunogenic composition, vaccine or system treatment compositions are by antigen of mycobacterium tuberculosis Rv0976c, Rv1255c, Rv3160c and/or Rv0792c, or the code nucleic acid composition of its correspondence.
Background technology
Tuberculosis is always one of the highest infectious disease of mortality rate in world wide.The world 1/3rd population was by m tuberculosis infection according to estimates, just had 1,500,000 people to die from tuberculosis [1] in 2013.In the world, effective control lungy still faces many difficulties and challenge, including lack fast and accurately diagnostic techniques, lack effective tuberculosis vaccine and the long tubercular drugs course for the treatment of (9 to 12 months).And the concurrent infection of tuberculosis and AIDS (co-infections), and the propagation of increasing Drug-fast case (MDR-TB) and extensive drug resistance tuberculosis (XDR-TB) more aggravates to finish the sternness of core disease prevention and control.Therefore, safely and effectively tuberculosis novel vaccine it is badly in need of, it is contemplated that this kind of vaccine can reduce 800-1000 more than ten thousand every year and newly send out tuberculosis case.
Bacille Calmette-Gu é rin (BCG), i.e. bacillus calmette-guerin vaccine, as the mycobacterium tuberculosis var bovis of a kind of attenuation, is the tuberculosis vaccine the most uniquely going through to use.But, there are two main defects in bacillus calmette-guerin vaccine: one is the protected effect to adult pulmonary tuberculosis very limited [2]；Two is to cause dissemination BCG disease [3] in the low crowd of immunocompetence.Clinical study results shows, BCG tuberculosis serious to child, has the protected effect [4 of more than 80% including phthisis miliaris and tuberculous meningitis; 5]; but, limited to the protected effect of adult pulmonary tuberculosis, the protected effect uneven (0-80%) [2] of clinical research.Speculate that reason is as follows: the difference of BCG bacterial strain that uses in clinical experiment, the difference of clinical test methods, clinical experiment crowd are to different contact histories, different crowd nutritional status and the genetic background difference of environment mycobacteria, the heterogeneity [6-11] of clinical M. tuberculosis strains.It has become clear that BCG is not a kind of preferably vaccine, guard time limited [4,5,12] to human body.BCG maintains 10-20 to exempting from produced immune protective effect multipotency at the beginning of neonate, therefore to adult pulmonary tuberculosis almost without protected effect [13-15].
Currently, generally believe that maximally effective Vaccinum Calmette-Guerini of new generation is that just exempting from-strengthen strategy strengthens the immunne response [16,17] caused by BCG in employing.This " just exempt from-strengthen " strategy includes: after utilizing BCG or recombinant BCG primary immune, to not yet contacting baby and the child of tulase, is aided with subunit vaccine (proteins/peptides or DNA) booster shot；Or to teenager with the independent booster immunization of subunit vaccine；Or using subunit vaccine as the adjuvant [16,17] of chemotherapy.
In subunit vaccine exploitation, key issue is the selection of antigen.Most researchs all concentrate on [18] on several antigen that strong IFN-γ can be induced to discharge.Body anti-tubercle bacillus relies primarily on cellullar immunologic response, although mechanism is not yet fully apparent from, but containing the multiple compounding ingredients [19-21] including CD4+ and CD8+T cell, unconventional gamma delta T cells, CD1-restricted α β T cell.Up to now, there is no " biological marker " [22-24] of effectively evaluating vaccine protected effect or protective immunity.BCG is mainly by induction CD4+T emiocytosis IFN-γ, induction Th1 type cell immune response [25].IFN-γ pivotal role in terms of controlling tuberculosis is confirmed in mice [26,27] and people [28,29].Accordingly, the antigenic specificity IFN-γ mainly produced by CD4+T cell is used as the evaluation index of protective immunity widely, although be not enough to provide whole tuberculosis to protect [30] only according to IFN-γ.All the time, the main R & D Strategy of subunit vaccine is to find the proteantigen that strong IFN-γ can be induced to discharge to build subunit vaccine (albumen or DNA).The method used is to carry by tuberculoprotein mixture especially bacterium solution supernatant carries out biochemical point, the proteantigen [31-34] of screening induction IFN-γ release.Fortune have found and included Esx family protein (EsxA, B, G, H, G, N), antigen 85 complex (Ag85A, B, C), PE/PPE family protein (such as: PPE18, PPE14) is at interior several antigens [35-40].Three fusion H1 (Ag85B-ESAT-6) building according to these results of study, H4 [Ag85B-TB10.4 (EsxH)] and M72 (PPE18-Rv0125) be at present subunit vaccine based on albumen is studied the most deep.These fusion protein be used alone all demonstrate close, but the protected effect of not higher than BCG [40-43].H1, H4 and M72 have been enter into the clinical IIa phase and test [21].
In order to enhancement antigen is by CD8+T cell recognition, with replication defective virus, if adenovirus or vaccinia virus are carrier, develop DNA subunit vaccine, such as MVA85A (gland virus expression antigen 85A, Ag85A)；AERAS-402 (vaccinia virus antigen expressed 85A, 85B and TB10.4 (EsxH)).In monkey model, MVA85A can strengthen the protective efficacy [44] of BCG, comes into the AERAS-402 that the clinical IIa phase test and also is able to the t cell response [45,21] after exempting from the beginning of reinforcement BCG.MVA85A has been completed that the clinical IIb phase tests at present, and this is the subunit vaccine that the first strain completes protected effect clinical verification, but result disappointing [46].South Africa baby to bcg vaccination, MVA85A can not significantly improve the protected effect of BCG, antituberculosis morbidity ability or Killing Mycobacterium Tuberculosis infection ability [46].The experimental result of MVA85A points out us, it is necessary to continually look for novel more effective subunit vaccine candidate antigens [47-49].
Summary of the invention
The present invention relates to a kind of immunogenic composition, vaccine or system being made up of the code nucleic acid of antigen of mycobacterium tuberculosis Rv0976c, Rv1255c, Rv3160c and/or Rv0792c or corresponding and treat compositions.Meanwhile, the present invention also includes short/long overlapping produced by the method with synthesis or restructuring or nonoverlapping peptide.Moreover, it relates to use Rv0976c, Rv1255c, Rv3160c and/or Rv0792c albumen or encoding gene corresponding to these albumen, the application in the diagnosis, treatment and prevention of m tuberculosis infection.
Present invention achievement in research based on applicant.Inventor finds that Rv0976c, Rv1255c, Rv3610c and Rv0792c have the immunogenicity (Fig. 3 and Fig. 4) of height in animal model, and has the protected effect (Fig. 6 and Fig. 7) that Killing Mycobacterium Tuberculosis infects.Therefore, antigen Rv0976c, Rv1255c, Rv3610c and Rv0792c is to build the most promising candidate antigens of tuberculosis vaccine.
The open a kind of immunogenic composition of the present invention, a kind of vaccine or therapeutic composition, that they include one or more following polypeptide:
(a): the aminoacid sequence shown in table 1；
(b): (a) sequence has immunogenic fragment, such as t cell epitope；And/or
(c): there is more than 70% conforming aminoacid sequence with any sequence in (a) or (b).
The present invention also open a kind of immunogenic composition, a kind of vaccine or therapeutic composition, they are made up of any one or more following nucleic acid molecules:
(a): the nucleotide sequence shown in table 2；
(b): with the nucleotide sequence of (a) nucleotide coding same acid sequence, or its complementary series；Or
(c): the nucleotide sequence of more than 10 can hybridized with the nucleotide sequence generation in (a) or (b) under stringent hybridization condition.
Preferably, above-mentioned nucleic acid is DNA fragmentation.
Application 1, polypeptide vaccine in the present invention is applied in the mankind or other mammals or animal, with enhancing body to by pathogenic mycobacterium, such as mycobacterium tuberculosis (Mycobacterium tuberculosis), mycobacterium bovis BCG (Mycobacterium bovis), mycobacterium africanum (Mycobacterium africanum), Mycobacterium leprae (Mycobacterium leprae) or mycobacterium buruli (Mycobacterium ulcerans) The resistance of the tuberculosis infection caused.Using method including the immunogenic components being made up of polypeptide or its immunogenic fragments of purification.The immunogenicity of polypeptide or immunogenic fragments may be reinforced by the fusion with adjuvant, it is also possible to by adding other Mycobacterium polypeptide, or other biological, as antibacterial, virus, mammalian polypeptide are strengthened.The polypeptide added is also contained in being grouped in the middle of compound, is attached on polypeptide or immunogenic fragments with crosslinking or non-crosslinked forms.
Application 2, nucleic acid radom insertion in the present invention is to carrier, in adenovirus or vaccinia virus vector, it is directly used in the mankind or other mammals or animal with DNA vaccination form, antigen expressed in vivo, cause body to pathogenic mycobacterium, as: mycobacterium tuberculosis (Mycobacterium tuberculosis), , mycobacterium bovis BCG (Mycobacterium bovis), mycobacterium africanum (Mycobacterium africanum), the resistance of the tuberculosis infection that Mycobacterium leprae (Mycobacterium leprae) or mycobacterium buruli (Mycobacterium ulcerans) cause.Therefore, polypeptide and nucleic acid in the present invention may be constructed therapeutic composition, are applied in the mankind or other mammals or animal, prevent and/or treat m tuberculosis infection.
Application 3, the invention provides a kind of for the mankind or other mammals or the vaccine of animal immune, with opposing by pathogenic mycobacterium, such as mycobacterium tuberculosis (Mycobacterium tuberculosis), the tuberculosis infection that causes of mycobacterium bovis BCG (Mycobacterium bovis), mycobacterium africanum (Mycobacterium africanum), Mycobacterium leprae (Mycobacterium leprae) or mycobacterium buruli (Mycobacterium ulcerans).Effectively be grouped compound as non-pathogenic microorganisms, at least contain a copy of the DNA fragmentation of encoding such polypeptides, be integrated in microorganism (as in free plasmid or enter microbial genome), make this section of polypeptide of microbial expression.
Application 4, the compositions in the present invention, polypeptide, nucleic acid test in vivo and in vitro in for detection for the antibody response of mycobacterium tuberculosis or cell immune response, it is adaptable to the diagnosis of infection or monitoring of diseases process.Such as, polypeptide may be when skin test as in-vivo diagnostic reagent.Polypeptide also can be when ELISA or T-spot of tuberculosis patient blood sample detects for testing in vitro.Or, nucleic acid or polypeptide may be used for extracting against mycobacterium tuberculosis antibody in non-human animal, and this antibody can be used to detect target position antigen by inner or in vitro experiment.
On the basis of the above, the present invention provides a kind of expression vector or non-pathogenic microorganisms, and it includes that the nucleic acid of the present invention, described expression vector or non-pathogenic microorganisms are cowpox, adenovirus, BCG or convert cell.Described expression vector or non-pathogenic microorganisms are for expressing the antibody for mycobacteria in people or other animal body.
The present invention also provides for albumen, nucleic acid or the compositions herein application in treatment or prevention tuberculosis.
The present invention also provides for following albumen or nucleic acid and is preparing Vaccinum Calmette-Guerini or preparation for treating, prevent, diagnose and/or detect the purposes in reagent lungy:
(a) mycobacterium tuberculosis protein Rv0976c, Rv1255c, Rv3160c, Rv0792c；
B () encodes the nucleic acid of above-mentioned albumen.
The aminoacid sequence of above-mentioned albumen Rv0976c, Rv1255c, Rv3160c, Rv0792c is respectively as shown in SEQ ID NO.1～4.
Preferably, the nucleotide sequence of encoding proteins Rv0976c, Rv1255c, Rv3160c, Rv0792c is respectively as shown in SEQ ID NO.5～8.
In yet another aspect, the present invention provides a kind for the treatment of or prevents method lungy, uses the albumen of the present invention, nucleic acid or vaccine including to people or other animal.
Preferably, use described in as Intradermal, subcutaneous transdermal, muscle or mucosal delivery mode.
The albumen of present invention offer or its polypeptide fragment and code nucleic acid thereof have the high immunogenicity for tubercule bacillus, it is possible to be provided with the protectiveness of effect for organism, can be used for diagnosing and/or detect reagent lungy as vaccine candidate object or preparation.
Accompanying drawing explanation
Fig. 1, the clone of albumen, expression and the purification schemes of the present invention；
The expression of Fig. 2, Rv0976c albumen and purification；Wherein, each swimming lane represents: 1, molecular weight marker；2, the full cell induced by IPTG；3, Ni is flow through2+Affinity column；4,50mM imidazoles cleaning buffer solution；5,100mM imidazoles cleaning buffer solution；6,150mM imidazoles elution buffer；7,300mM imidazoles elution buffer；8,300mM imidazoles elution buffer；9,500mM imidazoles elution buffer.Collect the Rv0976c albumen as purification of the fragment (swimming lane 7 and 8) with the elution of 300mM imidazoles elution buffer.
The t cell response that Fig. 3, the present invention are protein induced: by the production of the Th1 cytokine (TNF, IL-2, IL-12) that ELISA measures.Data are homogenized and are included in abreast in each experiment into Ag85A, Ag85A.
The B cell response that Fig. 4, the present invention are protein induced；Wherein, A be Rv0792c, B be Rv1255c, C be Rv0976c, D be Rv3160c.
Fig. 5, by nucleic acid clone of the present invention enter mammalian expression vector pVAX1 or pcDNA3.1；Rv0976c nucleic acid clone is cloned into pcDNA3.1 to pVAX1, Rv1255c, Rv3160c and Rv0792c；Ag85A is cloned into pVAX1 and pcDNA3.1, PPE18 and is cloned into pVAX1, HspX and is cloned into pcDNA3.1.
The Vaccine effectiveness experimental result of Fig. 6, Rv0976c；With DNA vaccination immunity BALB/c mouse, and infect with M.tuberculosis H37Rv.After infecting 5 weeks, put to death mice and count mycobacterium tuberculosis quantity in lung, splenic organs.A is that in mouse lung device, mycobacterium tuberculosis plants bacterium amount count results, and B is that in mice spleen internal organs, mycobacterium tuberculosis plants bacterium amount count results.Wherein, pVAX is the mycobacterium tuberculosis count results (negative control) of the mice inoculating the empty plasmid vector for clone, pVAX:Ag85A is the mycobacterium tuberculosis count results that the mice of the plasmid DNA of Ag85A is expressed in inoculation, pVAX:PPE18 is the mycobacterium tuberculosis count results that the mice of the plasmid DNA of PPE18 is expressed in inoculation, and pVAX:Rv0976c is the mycobacterium tuberculosis count results that the mice of the plasmid DNA of Rv0976c is expressed in inoculation.
The Vaccine effectiveness experimental result of Fig. 7, Rv1255c, Rv3160c and Rv0792c；With DNA vaccination immunity BALB/c mouse, and infect with M.tuberculosis H37Rv.After infecting 9 weeks, put to death mice and count mycobacterium tuberculosis quantity in lung, splenic organs.A is spleen count results, and B is lung count results.nullWherein，Sham and pcDNA is respectively the mycobacterium tuberculosis count results (negative control) of the mice of inoculation PBS or empty plasmid vector，PcDNA:Ag85A is the mycobacterium tuberculosis count results that the mice of the plasmid DNA of Ag85A is expressed in inoculation，PcDNA:HspX is the mycobacterium tuberculosis count results that the mice of the plasmid DNA of HspX is expressed in inoculation，PcDNA:Rv1255c is the mycobacterium tuberculosis count results that the mice of the plasmid DNA of Rv1255c is expressed in inoculation，PcDNA:Rv3160c is the mycobacterium tuberculosis count results that the mice of the plasmid DNA of Rv3160c is expressed in inoculation，PcDNA:Rv0792c is the mycobacterium tuberculosis count results that the mice of the plasmid DNA of Rv0792cc is expressed in inoculation.
The selected albumen of Fig. 8, use is to active tuberculosis (TB), tuberculosis infected students of hiding (LTBI), the results of serological detection of normal healthy controls person (HC)；A be Rv0792c, B be Rv0976c, C be Rv1255c, D be Rv3160c.
Detailed description of the invention
The significant challenge that current Vaccinum Calmette-Guerini research faces just is a lack of being applicable to index or the biological marker [22-24] of protected effect evaluation that protective immunity is evaluated.1998, Cole etc. completed the genome sequencing of Mycobacterium tuberculosis H37Rv, it was predicted that have 4000 open reading frame, disclosed the protein sequence [50] of its nucleotide sequence and supposition.But, the antigenicity of the unpredictable albumen of this sequence information, moreover, it is contemplated that lack, to current, the immune indexes that protectiveness is relevant, only have this information of antigenicity being also not enough to dope/judge this with an albumen is a good vaccine candidate.Can those skilled in the art it is clear that judge that whether an albumen be unique way of a good vaccine candidate, just as being presented below, be with after this protein immunization animal, strengthen the animal body resistance to m tuberculosis infection.International Vaccinum Calmette-Guerini research field had carried out the Protection research of animal in past 20 years to more than 200 antigens; find that only having minority antigen has the potentiality as subunit tuberculosis vaccine; antigen A g85A known to including;, PPE18, HspX, Esat-6, CFP-10 etc.; these antigens are by related researcher's patent protection and build corresponding subunit vaccine and carry out clinical experiment, MVA85A described above.
Rv0976c is the conservative putative protein that in mycobacterium tuberculosis, biological function is unknown, has homologous genes in the multiple mycobacteria kinds including mycobacterium tuberculosis CDC1551, mycobacterium bovis BCG (including BCG), mycobacterium buruli, mycobacterium paratuberculosis and Mycobacterium marinum.Rv1255c, Rv3160c and Rv0792c are transcriptional regulation proteins and guard at Mycobacterium inner height.SEQ ID NO.1 to the SEQ ID NO.4 of table 1 lists the aminoacid sequence of Rv0976c, Rv1255c, Rv3160c and Rv0792c respectively, SEQ ID NO.5 to the SEQ ID NO.8 of table 2 lists corresponding nucleic acid sequence encoding respectively.The source of sequence information of Rv0976c, Rv1255c, Rv3160c and Rv0792c is in Mycobacterium tuberculosis H37Rv bacterial strain, network address: http://genodb.pasteur.fr/cgi-bin/WebObjects/GenoList.
Applicant is not yet used for building the tuberculoprotein of subunit tuberculosis vaccine and has carried out zoopery about 130; found that: Rv0976c, Rv1255c, Rv3160c and Rv0792c albumen of Mycobacterium tuberculosis H37Rv bacterial strain has the immunogenicity of height, can produce the protected effect that significant Killing Mycobacterium Tuberculosis infects.
In order to evaluate immunogenicity, Rv0976c, Rv1255c, Rv3160c and Rv0792c opening code-reading frame is cloned entrance pET28a plasmid by applicant respectively, utilizes the expression of E.coli BL21 bacterial strain, purification (Fig. 1 and 2) with standardized program.The albumen purified with 10 μ g respectively mixes with Freund ' s Freund's incomplete adjuvant, immunity C57BL/6 mice (this Leco Corp. of Shanghai every other week, SPF level, 6-8 week is female) (often group 4), immunity 3 times is to evaluate the immunogenicity of these antigens altogether.First immunisation puts to death mice separating Morr. cell after 8 weeks.Respectively with corresponding Rv0976c, Rv1255c, Rv3160c and Rv0792c antigenic stimulus splenocyte, irritaiting concentration is respectively 5 μ g/ml, 10 μ g/ml, replace antigen as nonantigenic negative control using PBS, with the Ag85A antigen of purification as positive control, under stimulation, cultivate splenocyte.Collect cells and supernatant ELISA after 3 days and detect Th1 cytokines (IFN-γ, TNF-α and IL-2) emission levels.Result shows: Rv0976c, Rv1255c, Rv3160c and Rv0792c have high degree of immunogenicity, it is possible to induce the close or Th1 cytokines (Fig. 3) of higher than Ag85A.Rv0976c, Rv1255c, Rv3160c and Rv0792c also can induce high level antigen-specific antibodies in immunized mice, produce strong B cell immunoreation (Fig. 4).
In order to evaluate the Killing Mycobacterium Tuberculosis protected effect of Rv0976c, Rv1255c, Rv3160c and Rv0792c, applicant by encode these antigens DNA sequence (table 2) be cloned into mammalian expression vector pVAX1 (Rv0976c) or comprise CMV promoter pcDNA3.1 (Rv1255c, Rv3160c and Rv0792c) in (Fig. 5).PVAX1 and pcDNA3.1 carrier is purchased from Life Technologies company.The coded sequence of Ag85A clones entrance the two carrier the most respectively as experiment contrast.With these recombinant DNies, mice is carried out immunity, carry out Mycobacterium tuberculosis H37Rv (purchased from Chinese microorganism strain preservation center, ATCC93009, Shanghai Pulmonary Hospital preserves, cultivates) afterwards and infect challenge viral dosage.Specific experiment is as follows: BALB/c mouse (Fukang company of China, SPF level, 6-8 week is female) (often group 6) with the DNA immunity every other week of 100 μ g structures once, is total to immunity 3 times.First immunisation uses mycobacterium tuberculosis (6 × 10 after 8 weeks5CFU/ Mus) by tail vein or aerosol (dosage: 100-300CFU/ lung/Mus) approach infecting mouse, after attacking 5 weeks or 9 weeks, put to death mice and count mycobacterium tuberculosis quantity in lung, splenic organs.The Ag85A DNA built tests as comparison is parallel.With in a collection of experiment; the against mycobacterium tuberculosis protected effect that Rv0976c represents is better than Ag85A; close with PPE18: in the mice of inoculation Rv0976c DNA vaccination lung after infecting mycobacterium tuberculosis 5 weeks, splenic organs, mycobacterium tuberculosis quantity is significantly lower than mycobacterium tuberculosis quantity close (Fig. 6) in mycobacterium tuberculosis quantity, with the mice of inoculation PPE18DNA vaccine in the mice of negative control (pVAX) or inoculation Ag85ADNA vaccine.PPE18 is also positive control, and the amalgamation protein vaccine M72 (PPE18-Rv0125) with it as important component comes into clinical experiment [21].In the experiment of another batch, Rv1255c, Rv3160c are proved to have the protective capability (Fig. 7) identical or close with Ag85A or HspX with Rv0792c.HspX is that mycobacterium tuberculosis is hidden related antigen, is also used for building multistage subunit vaccine, is used as positive control [51,52] in this is tested.Up to now; Rv0976c, Rv1255c, Rv3160c and Rv0792c were not the most directly evaluated as vaccine; compared with presently preferred Ag85A, PPE18 and HspX antigen; they have higher immunogenicity and more preferable or equal protected effect, show that Rv0976c, Rv1255c, Rv3160c and Rv0792c can be as the novel antigens building subunit vaccine.
In order to evaluate whether Rv0976c, Rv1255c, Rv3160c and Rv0792c can react with the specific antibody in human serum, then distinguishing healthy population and various disease crowd, Rv0976c, Rv1255c, Rv3160c and Rv0792c albumen of purification is carried out ELISA reaction with the serum from different crowd by applicant.Test and comprise 3 groups of crowd's samples: active tuberculosis group (20 patients), tuberculosis latent infection group (25 samples), normal healthy controls group (24 individualities).Active tuberculosis group includes that 11 Sputum smears positive patients and 9 x-ray inspections have the patient of clinical symptoms.The tuberculosis sense person that hides refers to that those have close contact long-term, continuous (2-8, average 4.3 years) with tuberculosis patient but do not show the crowd of active tuberculosis clinical symptoms.Healthy individuals refers to there is not tuberculosis patient close contact history, does not has the ill history of tuberculosis or the crowd of clinical tuberculosis symptoms.All individualities come from same geographic area and have BCG to inoculate history.Experimental result shows, Rv0976c, Rv1255c, Rv3160c and Rv0792c there are differences with the seroreaction ability of the crowd of various disease pattern, specifically, coming from active tuberculosis and the serum of latent infection crowd, specific recognition Rv0976c, the antibody horizontal of Rv1255c, Rv3160c antigen are significantly higher than healthy population serum (Fig. 8).On the contrary, in latent infection crowd serum, the antibody horizontal of specific binding Rv0792c is significantly higher than active tuberculosis and normal healthy controls group (Fig. 8).These results indicate that Rv0976c, Rv1255c, Rv3160c and Rv0792c are the diagnosis candidate antigens with DEVELOPMENT PROSPECT, can be used for the Differential Diagnosis between active tuberculosis, tuberculosis latent infection and healthy individuals.
The present invention relates to the use as vaccine of Rv0976c, Rv1255c, Rv3160c and Rv0792c albumen.Albumen, polypeptide or peptide in the present invention includes native protein, polypeptide or peptide, or the homologue identical with native protein, polypeptide or peptide function.These homologues include having at least 60% with the native protein, polypeptide or the peptide that comprise in table 1,70%, more than 80% (preferably), the albumen of amino acid sequence homology, polypeptide or the peptide of best more than 90% (such as 95%, 96%, 97%, 98% or 99%).One or more (such as: 1-50,1-20,1-10,1-5) albumen of individual amino acid residue, polypeptide or peptide are replaced, increase and lacked to these homologues on the basis of including the aminoacid sequence of native protein, polypeptide or peptide in Table 1.This kind of homologue especially includes albumen, polypeptide or the peptide replaced containing conserved amino acid.
" nucleotide sequence in the present invention " refers to encode the nucleotide sequence of this peptide species.Referring to long or short overlap/non-overlapped peptide in framework of the present invention further, they have the Amino acid sequence identity of at least 70% with any one of present invention polypeptide.
In application 1, the invention provides aforementioned polypeptides or nucleic acid as preparing immunogenic components, vaccine or the application of therapeutic composition, they can combine as preventative vaccine with BCG, as anti-pathogenic mycobacterium, such as mycobacterium tuberculosis (Mycobacterium tuberculosis), mycobacterium bovis BCG (Mycobacterium bovis), mycobacterium africanum (Mycobacterium africanum), Mycobacterium leprae (Mycobacterium leprae), reinforcement vaccine that mycobacterium buruli (Mycobacterium ulcerans.) infects or therapeutic vaccine.Immunogenic components, vaccine or therapeutic composition in the present invention can be as preventative vaccine for the crowd not infected by pathogenic mycobacterium or the crowd of inoculated BCG, also can be as therapeutic vaccine for the colony infected by pathogenic mycobacterium.
In application 2, the invention provides a susceptible expression vector of class, as comprised the cowpox of the nucleic acid fragment in the present invention, adenovirus or BCG, and a class contains the conversion cell of at least one such carrier.
The present invention also relates to the diagnostic method lungy caused by pathogenic mycobacterium at animal body including people.By the polypeptide intradermal injection in the present invention, the reaction of detectable positive skin can be produced in the injection site of tuberculosis diseased individuals, dermoreaction then will not be detected in the injection site being not suffering from tuberculosis individual.
In application 3, come from mixing containing monocytic blood sample (such as: T lymphocyte) of animal body including people with a polypeptide sample in invention, positive reaction is probably T cell propagation, or the release of such as IFN-γ type cytokines outside born of the same parents.
In application 4, a class serum sample mixes with a polypeptide sample in invention, can observe that in serum sample, antibody polypeptide in the present invention is combined in the individuality once or infected.
With the monoclonal of polypeptide generation specific reaction in the present invention or polyclonal antibody in immunoassay, or the specific binding fragment of above-mentioned antibody, fall within scope.The body fluid or the latent infection organ sample that come from animal including people mix with above-mentioned antibody, are able to detect that the combination of sample and antibody in infected individuality.
In code book invention, the nucleic probe of polypeptide also can be used as multiple diagnostic test, the existence of pathogen in detection specific sample.This Diagnosis of Tuberculosis method can comprise at least part of nucleotide sequence, utilizes the hybridization technique of PCR or maturation, makes to come from animal specimen including people and hybridizes with nucleic acid fragment (or full length fragment), the existence of detection sample more control sequences.
The variation of nucleic acid molecules
Modify
The common recognition that should have is, the nucleic acid molecule in the DNA sequence that the application provides may be modified.The present invention includes can be directly at the nucleotide modification of sequence (or its fragment) of antibacterial or mammalian cell expression.Modification includes the displacement of nucleotide, inserts or lack, and nucleotide changes relative to change or the order of position.
The nucleic acid molecules of the present invention includes the change of the conservative nucleic acid molecule with silent amino acid in coding schedule 1 sequence.The authentication method of conservative amino acid replacement is as shown in document: Wu, Thomas D. " Discovering Empirically Conserved Amino Acid Substitution Groups in Databases of Protein Families " (http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi？Cmd=Retrieve&db=PubMed&list_uids=8877523&dopt=Abstract).
The nucleic acid molecules of the present invention includes encoding the sequence causing the displacement of nonconserved amino acid in table 1 sequence, adding or lack.Including making the nucleic acid molecules (DNA and RNA) of the corresponding function that nonconserved amino acid sequence changes in table 1 aminoacid, the aminoacid sequence of they codings has nonconserved amino acid displacement (the especially displacement of chemistry approximation), adds or disappearance, but also retains and the same or analogous aminoacid sequence of table 1.The fragment of aminoacid sequence shown in the possible coding schedule 1 of these DNA or RNA or variant.
Fragment can be as immunogen and immunogenic composition.Such fragment or variation physical ability are identified by following method.
Sequence identity
Nucleic acid molecules (or its fragment) involved in the present invention, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% is had with the sequence of nucleic acid molecules listed in application, or, best 99% or 99.5% concordance, it is possible to express in antibacterial or mammal cell line.Concordance refers to the similarity of two nucleotide sequences, the peak that can mate after sequence alignment.Concordance calculates according to existing maturation method.Such as, if one section of nucleotide sequence (referred to as sequence A) has 90% concordance with SEQ ID NO.5's with reference to fragment, then except in the reference nucleotide sequence of every 100 SEQ ID NO.5, sequence A exists 10 point mutation displacement of other nucleotide (such as with), and outward, remaining sequence is completely the same.
The sequence identity insertion of coding nucleotide (each structure do not contain) is preferably arranged to: the SEQ ID NO.5 or its complementary series that provide in sequence and invention have at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or, best 99% or 99.5% concordance.First sequence identity carries out calculating (Wisconsin university) by GCG program in bioinformatics.Other program can be used for concordance and calculates, and such as Clustal W program is (preferably for default parameter；nullThompson，JD et al.，Nucleic Acid Res.22:4673-4680)，BLAST P，BLAST X algorithm，The Mycobacterium avium BLASTN (http:tigrblast.tigr.org/) of Joint Genome Institute，The mycobacterium bovis BCG of Wellcome Trust Sanger institute (http://www.sanger.ac.uk/Projects/Microbes/)、Mycobacterium bovis BCG BCG (Pastuer)、Mycobacterium marinum、Mycobacterium leprae、Mycobacterium tuberculosis BLASTN，The mycobacterium tuberculosis BLASTN research of Pasterur institute (Tuberculist) (http://genolist.pasteur.fr/TubercuList/)，The Mycobacterium leprae research of Pasterur institute (Leproma) (http://genolist.pasteur.fr/Leproma/)，The mycobacterium paratuberculosis BLASTN of Minnesota university (http://www.cbc.umn.edu/ResearchProjects/Ptb/ and http://www.cbc.umn.edu/ResearchProjects/AGAC/Mptb/Mptbhome.html) microbial genome plan，Study at the various BLAST of U.S. NCBI USA-(http://www.ncbi.nlm.nih.gov/BLAST/)，And the various BLAST research of GenomeNet (bioinformatics center-chemistry institute) (http://blast.genome.ad.jp/).
Due to the degeneracy of genetic codon, the nucleotide sequence gone out given in table 2 is not only the unique sequence code of polypeptide in coding schedule 1.The present invention comprises and has the nucleic acid molecules of identical basic hereditary information with table 2 nucleic acid molecule.1 or more nucleotide change (including RNA) occur compared with the nucleotide sequence in application, but creates the nucleic acid molecules of the polypeptide product identical with table 1 also within this patent protection domain.
Other can detect by conventional DNA-DNA or DNA-RNA hybridization technique, the functional nucleotide equivalent of encoding such polypeptides.
Hybridization
The DNA that the present invention relates to has enough sequence identities with the nucleic acid molecules of offer in application, it is capable of hybridizing (hybridization technique commonly used in the art) under strict hybridization conditions (use less salt cleaning mixture: about 0.2%SSC, 50-65 DEG C of reaction temperature).The present invention also comprises can be with the nucleic acid molecules of the one or more generation hybridization in the sequence in table 2 or its complementary series.This nucleic acid molecules realizes hybridizing (Sambrook et al.Molecular Cloning:A Laboratory Manual under high stringency, Most Recent Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).The most handy less salt cleaning mixture (about 0.2%SSC), about 50-65 DEG C reaction temperature.
Vaccine
The preparation of vaccine is well-known.It is typically very much, injectable liquid solution or suspension；It is prone to the solid-state form being dissolved or suspended in before the injection in liquid, may be prepared by emulsifying, proteoliposome.Immunogenic composition usually mixes with the pharmaceutically useful adjuvant compatible with active compound.Suitably adjuvant includes: water, normal saline, glucose, glycerol, ethanol or its mixture.It addition, if it is required, vaccine can contain other trace adjuvant, such as wetting agent or emulsifying agent, pH buffer and/or the adjuvant of enhancing vaccine effect.nullThe effective ingredient of adjuvant potentially includes，But it is not limited to: aluminium hydroxide，N-acetyl-muramyl-L-threonyl-D-isoglutamine(thr-MDP)，N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine(CGP 11637，It is referred to as nor-MDP)，N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1′-2′-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine(CGP 19835A，It is referred to as MTP-PE) and RIBI.RIBI is by 3 kinds of antibacterial extracting components: monophosphoryl lipid A, trehalose dimycolate and cell wall skeleton (MPL+TDM+CWS) are blended in 2% squalene/Tween 80TMThe adjuvant made in emulsion.
The antibody horizontal that the efficiency of adjuvant is directly induced by immunogenic polypeptide is evaluated, and this peptide species contains the immunogenicity sequence of mycobacterium tuberculosis, immunity inoculation after mixing from different adjuvants.Generally the vaccination ways of vaccine is subcutaneously or intramuscularly to inject, and also has suppository or formula of oral.For suppository, traditional binding agent or carrier include such as Polyethylene Glycol, triglyceride, and this kind of suppository is the mixture containing 0.5% to 10% (1% to 2% is preferable) active component.Formula of oral includes the adjuvant normally used, as the other mannitol of pharmaceutical grade, lactose, starch, magnesium stearate, saccharin sodium, cellulose, magnesium carbonate etc.These compositions constitute solution, suspension, tablet, pill, capsule, the form such as slow releasing agent or powder with 10%-95% (25%-70% is preferable) active component.
According to the preventative and/or application target of therapeutic vaccine, give suitable vaccine immunity dosage.
Vaccine can give with single dose schedule, or preferably gives with multiple dose scheme.Multiple dose scheme is such scheme, wherein primary vaccination vaccination process can be used on 1-10 individually dosage, then maintain and or booster immunization response needed for time interval subsequently give other dosage, such as gave the second dosage at 1-4 month, if it is required, give dosage subsequently after some months.Dosage regimen is at least partly determined by individuality, and depends on the judgement of practitioner.
It addition, vaccine can collaborative with other such as immunoglobulins immunomodulator use, a dependent part of the present invention is also a polyvalent vaccine formula being made up of with the mixing of other vaccines, especially BCG or recombinant BCG this vaccine.
Therapeutic ingredient
Therapeutic composition in the present invention is for mammal Killing Mycobacterium Tuberculosis, mycobacterium bovis BCG, mycobacterium africanum, Mycobacterium leprae or the treatment of mycobacterium buruli or prevention, it is also used for treating degenerative disease, abnormal physiology, such as malignant tumor.
Therapeutic composition can be with tablet, spraying, Intratracheal instillation or intravenous injection mode for the mankind or animal.
Below in conjunction with instantiation, the present invention is expanded on further.Should be understood that these examples are merely to illustrate the present invention rather than limit the scope of the present invention.It should also be understood that, after having read the content that the present invention lectures, all of publication (includes GenBank entry), patents and patent applications, those skilled in the art's change various to the present invention or amendment, these equivalent form of values fall within the application paid claims limited range equally.Such as, the albumen of the application indication, cover conventional peptide or polypeptide；Equally, the gene that the application relates to, it is also covered by nucleotide or the genetic fragment commonly used.
Embodiment
Embodiment 1: the selected clone of antigen, expression and purification
The clone of antigen protein Rv0976c, Rv1255c, Rv3160c and Rv0792c, expression and purification schemes are as shown in Figure 1.The open reading frame of Rv0976c expands by using upstream PCR primer 5 '-TAGGATCCGTGCGTATCGGAAACTGCTCG-3 ' and downstream PCR primer 5 '-TAGAAGCTTTCACAACAGGGTCTCCGGGATCT-3 '.Equally, the pcr amplification primer thing of Rv1255c, Rv3160c and Rv0792c is respectively: 5 '-CATGGATCCATGGCGGGTACCGACTGGCTG-3 ' (upstream, Rv1255c), 5 '-CTGAAGCTTTCACTCGGGTCCAGGGTGAC-3 ' (downstream, Rv1255c)；5 '-CGTGGATCCATGCCGAGGCAGGCCGGCCGCTG-3 ' (upstream, Rv3160c), 5 '-GCAAAGCTTCTAGAGCCCGCGGTCGGGGGGTGCG-3 ' (downstream, Rv3160c)；5 '-TATGGATCCATGACATCTGTCAAGCTGGACC-3 ' (upstream, Rv0792c), 5 '-GCGAAGCTTTCATGCGAAATCTCGTTTCTCG-3 ' (downstream, Rv0792c).nullComparison antigen A g85A (Rv3804c)、PPE18 (Rv1196) and HspX (Rv2031c) clones in the same way，Express and purification，PCR primer used is respectively as follows: 5 '-ATAATACTTAAGGCCGCCACCATGCAGCTTGTTGACAGGGTTCGTGGCGCC-3 ' (upstream，Ag85A)，5 '-ATAATTCTAGATCAATGGTGATGGTGATGGGCGCCCTGGGGCGCGGGCCCGGT-3 ' (downstream，Ag85A)，5 '-ATAATACTTAAGGCCGCCACCATGGTGGATTTCGGGGCGTTACCACCGGAG-3 ' (upstream，PPE18)，5 '-ATAATTCTAGATCAATGGTGATGGTGATGGCCGGCCGCCGGAGAATGCGG-3 ' (downstream，PPE18)，5 '-ATATACTTAAGGCCGCCACCATGGCCACCACCCTTCCCGTTC-3 ' (upstream，HspX)，5 '-AATATTCTAGATCAATGGTGATGGTGATGATGGTTGGTGGACCGGATCTGAATGTG CTT-3 ' (downstreams，HspX).
It is that template carries out PCR reaction (50 μ l system) with Mycobacterium tuberculosis H37Rv (ATCC93009) genomic DNA, wherein contains template DNA (10ng), each 0.5 μM of upstream and downstream primer, 0.2mMdNTPs, 1 × reaction buffer, 1.25 units PrimeSTAR HS DNA polymerase (Clontech).Cycling condition: 95 DEG C of degeneration 5min；The degeneration (98 DEG C, 10sec) of 30 circulations, annealing (65 DEG C, 20sec), extension (72 DEG C, 2min)；Last 72 DEG C extend 5min, 4 DEG C of coolings.Pcr amplification product uses gel purification kit (Qiagen) purification after agarose gel electrophoresis.With BamHI and HindIII enzyme action PCR purified product 3h at 37 DEG C, gel purification kit (Qiagen) purification of the purpose fragment after enzyme action.PET28a plasmid (Novagen) similarity condition enzyme action reclaims.Coupled reaction system (totally 10 μ l) including: 2 μ l PCR fragment, 2 μ lpET28a fragments, 1 μ l 10 × T4 ligase buffer, 1 μ l DNAT4 ligase (NEB).Connect 3h under room temperature, hatch 20min at 65 DEG C and terminate reaction.Plasmid-genetic fragment connects product pET28a-Rv0976c, pET28a-Rv1255c, pET28a-Rv3160c and pET28a-Rv0792c and converts entrance E.coli DH5 α respectively.Coupled reaction liquid mixes with E.coli DH5 α competent cell, is coated on the LB flat board containing kanamycin (50 μ g/ml), and 37 DEG C of incubated overnight, random choose monoclonal is inoculated into LB fluid medium.Extracting recombiant plasmid pET28a-Rv0976c, pET28a-Rv1255c, pET28a-Rv3160c and pET28a-Rv0792c from E.coli DH5 α thalline with Qiagen Miniprep test kit, DNA sequencing checking insertion sequence is correct.
In order to obtain recombiant protein, recombiant plasmid pET28a-Rv0976c, pET28a-Rv1255c, pET28a-Rv3160c and pET28a-Rv0792c are transformed into E.coliBL21 respectively, it is coated on the LB flat board containing kanamycin (50 μ g/ml), 37 DEG C of incubated overnight, random choose monoclonal is inoculated into LB fluid medium, spreads cultivation to 1L.Cultivate for 26 DEG C and add 1mM IPTG after 3h, 26 DEG C of overnight inducing culture.At 4 DEG C 12,000rpm is centrifuged 10min and collects thalline, is resuspended in BugBuster (Novagen) Protein Extraction liquid.
Above-mentioned E.coli lysate 12,000rpm at 4 DEG C is centrifuged 20min and collects supernatant.Cleer and peaceful Ni-NTA in absorptionResin medium (Novagen) joins in sky chromatographic column, according to workbook (Novagen company, Ni-NTAResin medium service manual) flow process purifying protein.Purity of protein judges through polyacrylamide gel electrophoresis, and concentration BCA experiment (Sigma) determines.The expression and purification of Rv0976c is as in figure 2 it is shown, Rv1255c, Rv3160c and Rv0792c same method is purified.Identified, the sequence of the purifying protein of gained is correct.
Embodiment 2, the immunogenicity of Rv0976c, Rv1255c, Rv3160c and Rv0792c albumen
50 μ l purifying proteins (10 μ g) and 50 μ l Freund ' s Freund's incomplete adjuvant (Sigma) are sufficiently mixed, subcutaneous injection immunity C57BL/6 mice (often group 4).Immunity every other week once, is total to immunity 3 times.First immunisation puts to death mice, separating spleen after 8 weeks.After obtaining spleen lymphocyte, by 1 × 106Individual lymphocyte adds to 24 porocyte culture plates, and respectively with Rv0976c, Rv1255c, Rv3160c and Rv0792c antigenic stimulus, irritaiting concentration is respectively 5 μ g/ml, 10 μ g/ml；Replace antigen as nonantigenic negative control using PBS.37 DEG C, 5%CO2, cultivate 60 hours under 100% saturated humidity.
Centrifugal collecting cell culture supernatant, detection Th1 cytokines IFN-γ, TNF-α and IL-2 emission levels, use the pre-coated ELISA kit of OptEIATM (BD Biosciences), the procedure operation recommended according to test kit.The Ag85A of purification is as reference, and different cell antigen factor expression results are done homogenization according to Ag85A result and processed.Result display Rv0976c, Rv1255c, Rv3160c and Rv0792c albumen has high degree of immunogenicity, it is possible to induce close to or be better than Th1 cytokines secretion level (Fig. 3) of Ag85A.
In order to evaluate B cell reaction, collect mice serum, detect antigen-specific antibodies level by ELISA method.Serum (1: 400 to 1: 51200) after serial dilution adds 96 orifice plates, pre-coated Rv0976c, Rv1255c, Rv3160c and Rv0792c albumen in hole.The ELISA detection of antibody subtype uses the anti-Mus IgG1 (You Ningwei company, sc2969) or IgG2c (You Ningwei company, ab97255) two of HRP labelling to resist.Result display Rv0976c, Rv1255c, Rv3160c and Rv0792c albumen goes out high-caliber antigen-specific antibodies at immune mouse Immune inducing in vivo, demonstrates strong B cell respond (Fig. 4).
Embodiment 3, candidate gene clone enters mammalian expression vector
The encoding gene of Rv0976c, Rv1255c, Rv3160c and Rv0792c is cloned into the scheme of mammalian expression vector pVAX1 or pcDNA3.1 as shown in Figure 5.Rv0792c clone enters the primer of pVAX1: 5 '-TAGAATTCGCCACCATGGGCATGCGTATCGGAAACTG-3 ' (upstream) and 5 '-TAACTGCAGCTAGTGATGGTGATGGTGATGCAACAGGGTCTCCG-3 ' (downstream).The system of PCR and reaction condition are with embodiment 1.PCR primer EcoRI and PstI being digested, the pVAX1 plasmid (Invitrogen company, article No.: V260-20) connecting into same digestions produces pVAX1-Rv0976c.Build plasmid pVAX-Ag85A and pVAX-PPE18 in the same way.
Rv1255c, Rv3160c and Rv0792c clone is entered pcDNA3.1, corresponding PCR primer is: 5 '-ATATACTTAAGGCCGCCACCATGGCGGGTACCGACTGGCTGTC-3 ' (upstream, Rv1255c), 5 '-AATATTCTAGATCAATGGTGATGGTGATGATGCTCGGGTCCAGGGTGACCGGC-3 ' (downstream, Rv1255c)；5 '-ATATACTTAAGGCCGCCACCATGCCGAGGCAGGCCGGCCG-3 ' (upstream, Rv3160c), 5 '-AATATCTCGAGTCAATGGTGATGGTGATGATGGAGCCCGCGGTCGGGGGGTG-3 ' (downstream, Rv3160c)；5 '-ATATACTTAAGGCCGCCACCATGACATCTGTCAAGCTGGACCTGGAC-3 ' (upstream, Rv0792c), 5 '-AATATTCTAGATCAATGGTGATGGTGATGATGTGCGAAATCTCGTTTCTCGATAAT TCCGGC-3 ' (downstream, Rv0792c).PCR system and reaction condition are with embodiment 1.PCR primer AflII and XbaI enzyme cutting are digested, connects into the pcDNA3.1 plasmid (Invitrogen company, article No.: V790-20) of same digestions, produce pcDNA-Rv1255c, pcDNA-Rv3160c and pcDNA-Rv0792c.Build plasmid pcDNA-Ag85A or pcDNA-HspX in the same way.
Embodiment 4, the Vaccine effectiveness of Rv0976c
With pVAX-Rv0796c, pVAX-Ag85A or pVAX-PPE18 of 100 μ g/ Mus, every other week immunity BALB/c mouse (often group 6), immunity 3 times altogether.After the most immune 8 weeks, with 105The dosage tail Intravenous Infection Mycobacterium tuberculosis H37Rv bacterial strain of CFU/ Mus.After infecting 5 weeks, putting to death mice, internal organs homogenate is after serial dilution, and coating 7H11 agar plate (adds OADC, i.e. Middlebrook OADC, mixotrophism additive, the ratio of 10% is added), counts lung, splenic organs lotus bacterium quantity.The Killing Mycobacterium Tuberculosis protected effect of result display Rv0976c is better than Ag85A, with PPE18 close to (Fig. 6).
Embodiment 5, the Vaccine effectiveness of Rv1255c, Rv3160c and Rv0792c.
With pcDNA-Rv1255c, pcDNA-Rv3160c, pcDNA-Rv0792c, pcDNA-Ag85A or pcDNA-HspX of 100 μ g/ Mus, every other week immunity BALB/c mouse (often group 6), immunity 3 times altogether.After the most immune 8 weeks, infect Mycobacterium tuberculosis H37Rv bacterial strain (100CFU/ lung) with aerosol form.After infecting 9 weeks, putting to death mice, internal organs homogenate is after serial dilution, and coating 7H11 agar plate (adds OADC, ibid), counts lung, splenic organs lotus bacterium quantity.Result proves that Rv1255c, Rv3160c have the protected effect (Fig. 7) identical or close with Ag85A or HspX with Rv0792c.
Embodiment 6, with selected antigen, active tuberculosis, tuberculosis infected students of hiding, normal healthy controls person are carried out Serologic detection
The antigen (Rv0976c, Rv1255c, Rv3160c and Rv0792c) of each purification, 0.25 μ g/ hole it is separately added in 96 orifice plates；By diluting by 1: 100 respectively from active tuberculosis, tuberculosis infected students of hiding, the serum of normal healthy controls person experimental group crowd, adding to the most antigen coated hole, antigen-specific antibodies level standard ELISA assay detects, and result is as shown in Figure 8.
The aminoacid sequence of 1: four kind of albumen of table
The coding nucleotide sequence of 2: four kinds of protein of table
Table 3: the sequence information of several reference proteins
List of references:
1.WHO(2014)Global Tuberculosis Report 2014.inWHO Report 2014.
2.Brewer TF (2000) Preventing tuberculosis with bacillus Calmette-Guerin vaccine:a meta-analysis of the literature.Clin Infect Dis 31 Suppl 3:S64-67.
3.WHO (2007) Revised BCG vaccination guidelines for infants at risk for HIV infection.Wkly Epidemiol Rec 82:181-196.
4.Colditz GA, et al. (1995) The efficacy of bacillus Calmette-Guerin vaccination of newborns and infants in the prevention of tuberculosis:meta-analyses of the published literature.Pediatrics96 (1 Pt 1): 29-35.
5.Trunz BB, Fine P ， &Dye C (2006) Effect of BCG vaccination on childhood tuberculous meningitis and miliary tuberculosis worldwide:a meta-analysis and assessment of cost-effectiveness.Lancet 367 (9517): 1173-1180.
6.Behr MA (2002) BCG--different strains, different vaccines？Lancet Infect Dis 2 (2): 86-92.
7.Brandt L, et al. (2002) Failure of the Mycobacterium bovis BCG vaccine:some species of environmental mycobacteria block multiplication of BCG and induction of protective immunity to tuberculosis.Infect Immun 70 (2): 672-678.
8.Comstock GW (1994) Field trials of tuberculosis vaccines:how could we have done them better？Control Clin Trials 15 (4): 247-276.
9.Demangel C, Garnier T, Rosenkrands I ， &Cole ST (2005) Differential effects of prior exposure to environmental mycobacteria on vaccination with Mycobacterium bovis BCG or a recombinant BCG strain expressing RD 1 antigens.Infect Immun 73 (4): 2190-2196.
10.Fine PE (1995) Variation in protection by BCG:implications of and for heterologous immunity.Lancet 346 (8986): 1339-1345.
11.Tsenova L, et al. (2007) BCG vaccination confers poor protection against M.tuberculosis HN878-induced central nervous system disease.Vaccine 25 (28): 5126-5132.
12.Brewer TF&Colditz GA (1995) Bacille Calmette-Guerin vaccination for the prevention of tuberculosis in health care workers.Clin Infect Dis 20 (1): 136-142.
13.Comstock GW, Woolpert SF, &Livesay VT (1976) Tuberculosis studies in Muscogee County, Georgia.Twenty-year evaluation of a community trial of BCG vaccination.Public Health Rep91 (3): 276-280.
14.Hart PD&Sutherland I (1977) BCG and vole bacillus vaccines in the prevention of tuberculosis in adolescence and early adult life.Br Med J 2 (6082): 293-295.
15.Sterne JA, Rodrigues LC ， &Guedes IN (1998) Does the efficacy of BCG decline with time since vaccination？Int J Tuberc Lung Dis 2 (3): 200-207.
16.Skeiky YA&Sadoff JC (2006) Advances in tuberculosis vaccine strategies.Nat Rev Microbiol 4 (6): 469-476.
17.Kaufmann SH (2011) Fact and fiction in tuberculosis vaccine research:10 years later.Lancet Infect Dis 11 (8): 633-640.
18.Aagaard C, Dietrich J, Doherty M ， &Andersen P (2009) TB vaccines:current status and future perspectives.Immunol Cell Biol 87 (4): 279-286.
19.Cooper AM (2009) Cell-mediated immune responses in tuberculosis.Annu Rev Immunol 27:393-422.
20.North RJ&Jung YJ (2004) Immunity to tuberculosis.Annu Rev Immunol 22:599-623.
21.Andersen P&Kaufmann SH(2014)Novel vaccination strategies against tuberculosis.Cold Spring Harb Perspect Med 4(6).
22.Mittrucker HW, et al. (2007) Poor correlation between BCG vaccination-induced T cellresponses and protection against tuberculosis.Proc Natl Acad Sci U S A104 (30): 12434-12439.
23.Nunes-Alves C, et al. (2014) In search of a new paradigm for protective immunity to TB.Nat Rev Microbiol 12 (4): 289-299.
24.Soares AP, et al. (2008) Bacillus Calmette-Guerin vaccination of human newborns induces T cells with complex cytokine and phenotypic profiles.J Immunol 180 (5): 3569-3577.
25.Black GF, et al. (2002) BCG-induced increase in interferon-gamma response to mycobacterial antigens and efficacy of BCG vaccination in Malawi and the UK:two randomised controlled studies.Lancet 359 (9315): 1393-1401.
26.Cooper AM, et al. (1993) Disseminated tuberculosis in interferon gamma gene-disrupted mice.J Exp Med 178 (6): 2243-2247.
27.Flynn JL, et al. (1993) An essential role for interferon gamma in resistance to Mycobacterium tuberculosis infection.J Exp Med 178 (6): 2249-2254.
28.Jouanguy E, et al. (1996) Interferon-gamma-receptor deficiency in an infant with fatal bacille Calmette-Guerin infection.N Engl J Med 335 (26): 1956-1961.
29.Newport MJ, et al. (1996) A mutation in the interferon-gamma-receptor gene and susceptibility to mycobacterial infection.N Engl J Med 335 (26): 1941-1949.
30.Hanekom WA, et al. (2008) Immunological outcomes of new tuberculosis vaccine trials:WHO panel recommendations.PLoS Med 5 (7): e145.
31.Horwitz MA, Lee BW, Dillon BJ ， &Harth G (1995) Protective immunity against tuberculosis induced by vaccination with major extracellular proteins of Mycobacterium tuberculosis.Proc Natl Acad Sci U S A 92 (5): 1530-1534.
32.Boesen H, Jensen BN, Wilcke T ， &Andersen P (1995) Human T-cell responses to secreted antigen fractions of Mycobacterium tuberculosis.Infect Immun 63 (4): 1491-1497.
33.Pal PG&Horwitz MA (1992) Immunization with extracellular proteins of Mycobacterium tuberculosis induces cell-mediated immune responses and substantial protective immunity in a guinea pig model of pulmonary tuberculosis.Infect Immun 60 (11): 4781-4792.
34.Roberts AD, et al. (1995) Characteristics of protective immunity engendered by vaccination of mice with purified culture filtrate protein antigens of Mycobacterium tuberculosis.Immunology 85 (3): 502-508.
35.Bassey EO, Life PF, Catty D, Gaston JS ， &Kumararatne DS (1996) T-cell response to mycobacterial proteins:a comparative study of tuberculous and control immunoblots of Mycobacterium tuberculosis and M.bovis BCG.Tuber Lung Dis 77 (2): 146-153.
36.Borremans M, et al. (1989) Cloning, sequence determination, and expression of a 32-kilodalton-protein gene of Mycobacterium tuberculosis.Infect Immun 57 (10): 3123-3130.
37.Brandt L, Elhay M, Rosenkrands I, Lindblad EB ， &Andersen P (2000) ESAT-6 subunit Vaccination against Mycobacterium tuberculosis.Infect Immun 68 (2): 791-795.
38.Brodin P, et al. (2004) Enhanced protection against tuberculosis by vaccination with recombinant Mycobacterium microti vaccine that induces T cell immunity against region of difference 1 antigens.J Infect Dis 190 (1): 115-122.
39.Coler RN, et al. (1998) Molecular cloning and immunologic reactivity of a novel low molecular mass antigen of Mycobacterium tuberculosis.J Immunol 161 (5): 2356-2364.
40.Dietrich J, et al. (2005) Exchanging ESAT6 with TB10.4 in an Ag85B fusion molecule-based tuberculosis subunit vaccine:efficient protection and ESAT6-based sensitive monitoring of vaccine efficacy.J Immunol 174 (10): 6332-6339.
41.Langermans JA, et al. (2005) Protection of macaques against Mycobacterium tuberculosis infection by a subunit vaccine based on a fusion protein of antigen 85B and ESAT-6.Vaccine 23 (21): 2740-2750.
42.Skeiky YA, et al. (2004) Differential immune responses and protective efficacy induced by components of a tuberculosis polyprotein vaccine, Mtb72F, delivered as naked DNA or recombinant protein.J Immunol 172 (12): 7618-7628.
43.Weinrich Olsen A, van Pinxteren LA, Meng Okkels L, Birk Rasmussen P ， &Andersen P (2001) Protection of mice with a tuberculosis subunit vaccine based on a fusion protein of antigen 85b and esat-6.Infect Immun 69 (5): 2773-2778.
44.Verreck FA, et al. (2009) MVA.85A boosting of BCG and an attenuated, phoP deficient M.tuberculosis vaccine both show protective efficacy against tuberculosis in rhesus macaques.PLoS ONE 4 (4): e5264.
45.Magalhaes I, et al. (2008) rBCG induces strong antigen-specific T cell responses in rhesus macaques in a prime-boost setting with an adenovirus 35 tuberculosis vaccine vector.PLoS ONE3 (11): e3790.
46.Tameris MD, et al. (2013) Safety and efficacy of MVA85A, a new tuberculosis vaccine, in infants previously vaccinated with BCG:a randomised, placebo-controlled phase 2b trial.Lancet381 (9871): 1021-1028.
47.Geluk A, van Meijgaarden KE, Joosten SA, Commandeur S ， &Ottenhoff TH (2014) Innovative Strategies to Identify M.tuberculosis Antigens and Epitopes Using Genome-Wide Analyses.Front Immunol 5:256.
48.Singh S, Saraav I ， &Sharma S (2014) Immunogenic potential of latency associated antigens against Mycobacterium tuberculosis.Vaccine 32 (6): 712-716.
49.Aagaard C, et al. (2011) A multistage tuberculosis vaccine that confers efficient protection before and after exposure.Nat Med 17 (2): 189-194.
50.Cole ST, et al. (1998) Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.Nature 393 (6685): 537-544.
51.Mir FA, Kaufmann SH ， &Eddine AN (2009) A multicistronic DNA vaccine induces significant protection against tuberculosis in mice and offers flexibility in the expressed antigen Repertoire.Clin Vaccine Immunol 16 (10): 1467-1475.
52.Wang X, et al. (2015) Protection against Mycobacterium tuberculosis Infection Offered by a New Multistage Subunit Vaccine Correlates with Increased Number of IFN-gamma+IL-2+ CD4+and IFN-gamma+ CD8+ T Cells.PLoS ONE 10 (3): e0122560.

Claims (10)

1. the immunogenic composition being made up of one or more polypeptide following:
A aminoacid sequence that () table 1 provides；
B () (a) sequence has immunogenic fragment, such as t cell epitope；And/or
C () has more than 70% conforming aminoacid sequence with any sequence in (a) or (b) Row analog.
2. such as the immunogenic composition in claim 1, for Intradermal, subcutaneous transdermal, muscle or The preparation method of mucosal delivery.
3., such as the immunogenic composition in claim 1, comprise adjuvant further.
4. the immunogenic composition being made up of one or more nucleic acid molecules following:
A nucleotide sequence that () table 2 provides；
B () and (a) nucleotide encode the nucleotide sequence of same acid sequence, or its Complementary series；Or
C () has at least 10 length of nucleotides, and can be with (a) under strict hybridization conditions Or the nucleotide sequence in (b) realizes the sequence of hybridization.
5. such as the immunogenic composition in claim 4, for Intradermal, subcutaneous transdermal, muscle or The preparation method of mucosal delivery.
6. a non-pathogenic microorganisms, at least a part of which integrate have one copy comprise claim 4 The DNA fragmentation (such as, be placed in free plasmid or be integrated into microbial genome) of nucleic acid molecule, And DNA fragmentation can express in microorganism with polypeptide form.
7., such as the non-pathogenic microorganisms in claim 6, non-pathogenic microorganisms therein is BCG.
8. one kind for the mankind or other mammalss or animal, by immunogenicity in claim 1 or 4 The antiphthisic immunization method of compositions composition.
9. one kind for the mankind or other mammalss or animal, by the micro-life of non-pathogenic in claim 6 The antiphthisic immunization method of thing composition.
10. for a diagnostic kit for tuberculosis sample, by the immunogenicity group in claim 1 or 4 Compound forms.
CN201510324548.6A 2015-06-15 2015-06-15 The Vaccinum Calmette-Guerini being made up of antigen of mycobacterium tuberculosis Pending CN106237317A (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN201510324548.6A CN106237317A (en) 2015-06-15 2015-06-15 The Vaccinum Calmette-Guerini being made up of antigen of mycobacterium tuberculosis
CN201580079653.6A CN107531764A (en) 2015-06-15 2015-09-29 Antigen of mycobacterium tuberculosis and its application
PCT/CN2015/091068 WO2016201825A1 (en) 2015-06-15 2015-09-29 Mycobacterium tuberculosis antigens and applications thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510324548.6A CN106237317A (en) 2015-06-15 2015-06-15 The Vaccinum Calmette-Guerini being made up of antigen of mycobacterium tuberculosis

Publications (1)

Publication Number Publication Date
CN106237317A true CN106237317A (en) 2016-12-21

Family

ID=57546635

Family Applications (2)

Application Number Title Priority Date Filing Date
CN201510324548.6A Pending CN106237317A (en) 2015-06-15 2015-06-15 The Vaccinum Calmette-Guerini being made up of antigen of mycobacterium tuberculosis
CN201580079653.6A Pending CN107531764A (en) 2015-06-15 2015-09-29 Antigen of mycobacterium tuberculosis and its application

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN201580079653.6A Pending CN107531764A (en) 2015-06-15 2015-09-29 Antigen of mycobacterium tuberculosis and its application

Country Status (2)

Country Link
CN (2) CN106237317A (en)
WO (1) WO2016201825A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110506108A (en) * 2017-04-07 2019-11-26 成都永安制药有限公司 It is overexpressed the recombinant BCG of phoP-phoR
CN110590958A (en) * 2019-09-11 2019-12-20 中国人民解放军总医院第八医学中心 Tandem polypeptide and application thereof in immune protection against mycobacterium tuberculosis
CN111655281A (en) * 2018-01-26 2020-09-11 加利福尼亚大学董事会 Intranasal delivery of vaccines containing cyclodipeptide adjuvants for tuberculosis
CN116003540A (en) * 2022-12-08 2023-04-25 中国疾病预防控制中心传染病预防控制所 Preparation and application of mycobacterium tuberculosis antigen composition PFHP010

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114272364A (en) * 2021-12-22 2022-04-05 中国人民解放军总医院第八医学中心 Mycobacterium tuberculosis tandem DNA vaccine W541 and preparation method and application thereof
CN116041541B (en) * 2022-11-30 2024-03-15 中国疾病预防控制中心传染病预防控制所 Mycobacterium tuberculosis antigen EPPA011 and application thereof

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7393539B2 (en) * 2001-06-22 2008-07-01 Health Protection Agency Mycobacterial antigens expressed under low oxygen tension
CN1342771A (en) * 2001-09-17 2002-04-03 复旦大学 Expression purification of tubercle mycobacterium Ag85B antigen and its application in vaccine
ITRM20030411A1 (en) * 2003-08-29 2005-02-28 Consiglio Nazionale Ricerche USE OF SPECIFIC GENE SEQUENCES OF MYCOBACTERIUM TUBERCOLOSIS IN ADDITIONAL PROTEINS FOR DIAGNOSIS AND PREVENTION OF TUBERCULAR INFECTION.
US8361482B2 (en) * 2007-11-27 2013-01-29 Aeras Global Tb Vaccine Foundation Recombinant BCG tuberculosis vaccine designed to elicit immune responses to mycobacterium tuberculosis in all physiological stages of infection and disease
GB0918154D0 (en) * 2009-10-16 2009-12-02 Isis Innovation Mycobacterial vaccines
CN102260328B (en) * 2010-07-15 2013-09-25 华中农业大学 Antigen proteins of Mycobacterium tuberculosis and application thereof
CN102161695A (en) * 2011-03-08 2011-08-24 复旦大学 Rv1793 recombinant protein for serodiagnosis of medicament-resistant tuberculosis
US10703784B2 (en) * 2011-09-30 2020-07-07 La Jolla Institute For Allergy And Immunology Antigens and epitopes derived from Mycobacterium tuberculosis
CN103304646B (en) * 2012-03-09 2015-02-25 中国医学科学院病原生物学研究所 Mycobacterium tuberculosis candidate antigen polypeptide and application thereof
CN104292315A (en) * 2014-10-27 2015-01-21 武汉大学 Preparation for Rv2645 protein, and application thereof on aspects of tuberculosis diagnosis and reorganized BCG vaccines

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110506108A (en) * 2017-04-07 2019-11-26 成都永安制药有限公司 It is overexpressed the recombinant BCG of phoP-phoR
CN110506108B (en) * 2017-04-07 2023-10-24 成都安永鼎业生物技术有限公司 Recombinant BCG overexpressing phoP-phoR
CN111655281A (en) * 2018-01-26 2020-09-11 加利福尼亚大学董事会 Intranasal delivery of vaccines containing cyclodipeptide adjuvants for tuberculosis
CN110590958A (en) * 2019-09-11 2019-12-20 中国人民解放军总医院第八医学中心 Tandem polypeptide and application thereof in immune protection against mycobacterium tuberculosis
CN110590958B (en) * 2019-09-11 2021-04-13 中国人民解放军总医院第八医学中心 Tandem polypeptide and application thereof in immune protection against mycobacterium tuberculosis
CN116003540A (en) * 2022-12-08 2023-04-25 中国疾病预防控制中心传染病预防控制所 Preparation and application of mycobacterium tuberculosis antigen composition PFHP010
CN116003540B (en) * 2022-12-08 2024-04-16 中国疾病预防控制中心传染病预防控制所 Preparation and application of mycobacterium tuberculosis antigen composition PFHP010

Also Published As

Publication number Publication date
CN107531764A (en) 2018-01-02
WO2016201825A1 (en) 2016-12-22

Similar Documents

Publication Publication Date Title
CN106237317A (en) The Vaccinum Calmette-Guerini being made up of antigen of mycobacterium tuberculosis
Brodin et al. ESAT-6 proteins: protective antigens and virulence factors?
Demangel et al. Differential effects of prior exposure to environmental mycobacteria on vaccination with Mycobacterium bovis BCG or a recombinant BCG strain expressing RD1 antigens
Tanghe et al. Protective efficacy of a DNA vaccine encoding antigen 85A from Mycobacterium bovis BCG against Buruli ulcer
CN102836425B (en) The Vaccinum Calmette-Guerini of antigen expressed during comprising the latent infection stage
US8747866B2 (en) Identification of virulence associated regions RD1 and RD5 leading to improve vaccine of M. bovis BCG and M. microti
Hewinson et al. Use of the bovine model of tuberculosis for the development of improved vaccines and diagnostics
Twine et al. BALB/c mice, but not C57BL/6 mice immunized with a ΔclpB mutant of Francisella tularensis subspecies tularensis are protected against respiratory challenge with wild-type bacteria: association of protection with post-vaccination and post-challenge immune responses
US20120258129A1 (en) Mycobacterium tuberculosis fusion protein and uses thereof
CN110506108B (en) Recombinant BCG overexpressing phoP-phoR
Romano et al. Immunogenicity and protective efficacy of tuberculosis subunit vaccines expressing PPE44 (Rv2770c)
Teimourpour et al. Construction of a DNA vaccine encoding Mtb32C and HBHA genes of Mycobacterium tuberculosis
CN102439134B (en) Comprise the Vaccinum Calmette-Guerini of the recombinant BCG strains of process LAN PhoP and/or PhoP regulon albumen
Fan et al. Differential immunogenicity and protective efficacy of DNA vaccines expressing proteins of Mycobacterium tuberculosis in a mouse model
Festjens et al. SapM mutation to improve the BCG vaccine: Genomic, transcriptomic and preclinical safety characterization
Xiang et al. Immunogenicity and protective efficacy of a fusion protein tuberculosis vaccine combining five Esx family proteins
Roupie et al. Immunogenicity and protective efficacy of DNA vaccines encoding MAP0586c and MAP4308c of Mycobacterium avium subsp. paratuberculosis secretome
Rashidian et al. Designing and construction of a DNA vaccine encoding tb10. 4 gene of Mycobacterium tuberculosis
Mulongo et al. Cattle immunized against the pathogenic L-α-glycerol-3-phosphate oxidase of Mycoplasma mycoides subs. mycoides fail to generate neutralizing antibodies and succumb to disease on challenge
Wang et al. Identification and evaluation of the novel immunodominant antigen Rv2351c from Mycobacterium tuberculosis
Grover et al. Expression and purification of the Mycobacterium tuberculosis complex-restricted antigen CFP21 to study its immunoprophylactic potential in mouse model
Wu et al. Latent tuberculosis infection amongst new recruits to the Chinese army: comparison of ELISPOT assay and tuberculin skin test
CN107530414B (en) Mycobacterium tuberculosis antigen for distinguishing active tuberculosis infection and latent tuberculosis infection and application thereof
CN101248084A (en) Tuberculosis vaccines comprising antigens expressed during the latent infection phase
EP2757155B1 (en) Recombinant bcg vaccine

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20161221