CN106222278A

CN106222278A - A kind of primer special combination for quickly detection willow polyploid and detection method thereof

Info

Publication number: CN106222278A
Application number: CN201610648273.6A
Authority: CN
Inventors: 尹佟明; 郭炜; 李淑娴
Original assignee: Nanjing Forestry University
Current assignee: Nanjing Forestry University
Priority date: 2016-08-09
Filing date: 2016-08-09
Publication date: 2016-12-14
Anticipated expiration: 2036-08-09
Also published as: CN106222278B

Abstract

The invention discloses a kind of primer special combination for quickly detection willow polyploid and detection method thereof.Utilizing the primer that the present invention provides, the DNA profiling of willow to be detected is carried out PCR amplification, by the electrophoresis detection of amplified production, if the number of alleles that sample detects on the amplification site of any pair of primers is more than 2, then this sample is polyploid.Compared with existing willow polyploid detection method, the primer utilizing the present invention to provide carries out the screening of willow polyploid and has operational approach simply, fast, the advantage of result reliability, can detect a large amount of sample at short notice, provides the technological means of high efficient and reliable for screening willow polyploid.The present invention is that willow polyploid breeding provides important technical support, has good actual application value, it is possible to produce preferable economic benefit and social benefit, have a extensive future.

Description

A kind of primer special combination for quickly detection willow polyploid and detection method thereof

Technical field

The invention belongs to biological technical field, relate to a kind of primer special combination for quickly detection willow polyploid and Its detection method.

Background technology

Willow refers generally to sallow, is subordinate to Angiospermae (Magnoliophyta) Dicotyledoneae (Magnoliopsida) Dilleniidae (Dilleniidae) Salicales (Salicales) Salicaceae (Salicaceae).Entirely World willow there are about kind more than 500, the most much has and grows rapid, strong adaptability and be prone to excellent characteristics such as nourishing and generating, There is in China's production of forestry highly important status.Willow is of many uses, is important ornamental plantation seeds, the most also Play an important role in phytoremediation and ecosystem are restored；Additionally, due to it there is the highest biomass yield, also by with Make important Tree Species as Bio-energy (Tu Zhongyu, 1989；Tang Guimei etc., 2007；Kiser etc., 2013；Zamora etc., 2014).

Polyploid breeding is one of important means of plant breeding.Polyploid plant contains the chromosome set that 3 sets are above, In plant relatively conventional, can to plant individual produce active influence.As compared with diploid, polyploid plant cell volume becomes Greatly, individual growth amount increases, the adaptability enhancing etc. to environment.The varied in ploidy scope of willow is relatively big, from diploid (2n= 38) all existing to the dodecaploid (2n=228), the most of the same race also have varied in ploidy.Polyploid breeding is to willow rearing new variety Play an important role.

For willow, belong to together with it willow of Salicaceae as far back as last century the '30s just carried out polyploid and educated Kind of work, till now achieved with good effect, especially triploid willow is in growth in volume, lumber fibre, disease-resistant degeneration-resistant Have outstanding performance etc. in character.Einspahr (1984) and Weisgerber et al. (1980) once utilized tetraploid Populus tremula and two The hybridization of times body Populus tremuloides carries out the selection-breeding of triploid mountain poplar, obtains hybridization Populus davidiana and the growth being suitable to pulping and paper-making respectively Rapidly, strong adaptability, and the Populus davidiana new lines " Astria " of Resistant Gene To Rust, and spread aborning.China opens to keep and attacks The research of people shows, is all triploid in kinds such as " middle forests 46 ", " poplar in silver " that China extensively plants, and therefore, polyploid is educated Plant new varieties of poplar is cultivated and have the highest using value.In recent years, polyploid breeding means also begin to select in willow new varieties It is applied in educating.Such as (2014) reports such as Serapiglia, the Biomass of diploid shrub willow unit are is about 8.29Mg ha^-1yr^-1, and triploid has reached 12.65Mg ha^-1yr^-1, exceed diploid more than 50%, up to 16Mg ha^-1yr^-1.Three Times body shrub willow is all substantially better than Diploid and Tetraploid at aspects such as the height of tree, stem sectional area (stem area) and density.

One of key carrying out willow polyploid breeding has sought to reliable Ploidy Identification means.Traditional Ploidy Identification Mainly by observing the morphological differences of plant organ, measuring physiological and biochemical index, side such as detection pore opening and POLLEN MORPHOLOGY etc. Method speculates, but accuracy the highest (Tao etc., 2009)；Although and to carrying out chromosome counting after plant tissue cell's tabletting Can directly, accurately obtain ploidy data, but this method step is loaded down with trivial details, and technology requires height, and willow chromosome quantity is many (2n=38 to 228, Thibault, 1998), Single chromosome size is minimum, in point-like, contaminates willow by this method Colour solid counting extremely difficult (Tao etc., 2009；Field new people etc., 2011).The eighties in last century, Galbraith is thin by streaming first Born of the same parents' instrument (Flow cytometer, FCM) successfully determines plant cell nuclear dna content (Galbraith, 1983).Hereafter, streaming Cell art quickly grows, become plant cell nuclear dna content measure and ploidy differentiate prefered method (Deng, 2005, 2007；Tao etc., 2009).But plant cell contains cell wall, Sample Preparation Procedure is complex, and difficulty increases, and effect is the most not As zooblast is good, therefore flow cytometry be not particularly suited for polyploid willow Large-scale Screening and detection (Vr á na etc., 2014)。

Summary of the invention

Goal of the invention: for the deficiencies in the prior art, it is an object of the invention to provide a kind of for quickly detection The primer special combination of willow polyploid, has simple to operate, and efficiency is high, is suitable for the features such as extensive detection, for accelerating willow Polyploid breeding process provides crucial detection technique to support.It is a further object of the present invention to provide the combination of a kind of above-mentioned primer special The method quickly detecting willow polyploid

Technical scheme: in order to realize foregoing invention purpose, the technical solution used in the present invention is as follows:

A kind of primer special combination for quickly detection polyploid willow, 10 pairs of primers pair including in following table:

A kind of method for quick of polyploid willow, with the DNA of sample to be screened as template, all primers of table in utilization To carrying out PCR amplification, the product obtained is carried out electrophoresis detection, if the allele number that any of which primer pair amplifies goes out is big In or equal to 3, then counter sample may be polyploid.Wherein primer is to for the primer special described in claim 1.

In said method, PCR reaction system is: template DNA 25ng, each 10ng of upstream and downstream primer, and concentration is 2.5mM's DNTP 0.4 μ L, with fluorescently-labeled 1mM Fluorescein-12-dUTP (Roche Diagnostics) 0.01 μ L, Taq Polymerase 0.5U, 10 × buffer (Tris-HCl, 500mM KCl, 20mM MgCl containing 100 μMs of pH 8.3₂And 10.0g/L BSA) 1.5 μ L, adds sterilizing deionized water and supplements reaction volume to 15 μ L.

PCR reaction condition is: 94 DEG C of denaturations 5min；94 DEG C of degeneration 30s, 55 DEG C of annealing 30s, 72 DEG C extend 30s, carry out 35 circulations；72 DEG C extend 10min.

Gene type assay is carried out on ABI3730 sequenator as follows: product pressed with sterilizing deionized water 1:20 dilutes；Take the product after 1 μ L dilution, with 9 μ L sample-loading buffers (containing 91% deionized formamide, in 9%500ROX Mark) mixing；After 95 DEG C of degeneration 5min, being placed in and cool down the most rapidly, machine of going up afterwards runs.

The primer special for the detection of willow polyploid of the present invention, need to meet following condition: (1) this primer mark is at base Because group should be single copy；(2) primer sites sequence variations enriches；(3) primer sequence high conservative；(4) amplified production bands of a spectrum Clearly.

Beneficial effect: compared with the technology of existing screening willow polyploid, the invention have the advantages that

(1) utilize 10 pairs of primer specials to carry out willow polyploid screening, there is advantage simple to operate, that efficiency is high, especially Applicable chromosome is little, number is many, the willow that varied in ploidy is complicated.

(2) amount of samples is few, can carry out Non-destructive sampling, not be subject to seasonal restrictions.

(3) present invention is specifically directed to willow and establish polyploid screening experiment system, improve detection efficiency, many for willow Times body tag assisted selection provides reliable technological means.

Accompanying drawing explanation

Fig. 1 is the fingerprint image that the amplification of willow family full-sibs is produced by primer WSSR_100；In figure, the first two sample in figure Being respectively female parent and the male parent of cross combination, remaining sample is hybrid generation.The corresponding different equipotential base in peaks different in figure Cause, abscissa indicates allelic electrophoresis position, vertical coordinate instruction Fluorescent signal intensity；

Fig. 2 is that primer WSSR_100 treats sample and originally carries out the fingerprint image of Ploidy detection generation；Figure shows 8 parts to be checked The fingerprint image of willow sample, the corresponding different allele in different peaks, abscissa indicates allelic electrophoresis position, vertical seat Mark instruction Fluorescent signal intensity.Sample Sma-1, Sba-10 and Sba-15 have amplified 4 allele on this site respectively； Sample Ssu-90 has amplified 3 allele on this site；Other 4 samples have all amplified 2 etc. on this site Position gene.

Detailed description of the invention

Below in conjunction with specific embodiment, the method for the present invention is described in further detail.

Experimental technique in following embodiment if no special instructions, is conventional method, and primer used is by Shanghai JaRa Bioisystech Co., Ltd synthesizes.

Embodiment 1

This method the primer is to be developed by willow genomic dna sequence, utilizes Primer Premier5.0 software Having designed and developed 192 pairs of primers, by Shanghai, JaRa Bioisystech Co., Ltd is synthesized.

Common willow is divided into arbor willow and shrub willow.In order to verify the versatility of primer, the present embodiment have chosen common Two kinds of arbor willows and two kinds of shrub willows, wherein arbor willow includes Salix babylonica L. (Salix babylonica) and dry land willow (S.matsudana), shrub willow includes Salix suchowensis (S.suchowensis) and purple willow (S.integra).The cutting gathered is existed Carry out cottage propagation under greenhouse experiment, take the young leaflet tablet of new sprouting, extract DNA by CTAB method.Use trace dna Protein Detection The concentration of instrument Detection and Extraction DNA, is diluted to DNA concentration 10ng/ μ L afterwards, saves backup in-20 DEG C.From above-mentioned 4 kinds of willows In each select a sample, utilize the primer of synthesis to expand at Veriti type thermal cycler (American AB I company) enterprising performing PCR, Amplified production detects with the agarose gel electrophoresis of 1%, determines whether different primers can expand in above-mentioned different willows Merit.Result shows, has 174 to expanding successfully in the 4 kinds of different willows surveyed in the primer of synthesis, and success rate is 90.5%.

Utilize diplontic Salix suchowensis family full-sibs material that primer is tested afterwards, filter out amplification broadband number with Number of alleles is corresponding, and is the labelling of single copy.Owing to the PCR primer of many primers often exists " shadow " spectrum Band, sometimes one allele can corresponding a plurality of electrophoretic band, so when carrying out natural population material analysis, very difficult according to expansion Increase the broadband number equipotential number gene is accurately judged.And in diploid willow family full-sibs, parent can only be by it One in two allele in codominance site passes to filial generation, and each filial generation obtains one of them at random.By this The most just can filter out the list copy labelling that amplification broadband number is corresponding with number of alleles.Utilize this labelling to natural population Material detects, and can judge the ploidy of tested sample according to the broadband number of amplification.Additionally, due to the heterozygosis feelings of different loci Condition is different, has two allele to isozygoty if expanding site in tested sample, is then only able to display bands of a spectrum, it is impossible to just Really reflect the ploidy information of tested sample.It is thus desirable to detect multiple different loci could relatively accurately judge that ploidy is believed simultaneously Breath.

The present embodiment uses the family full-sibs of a Salix suchowensis, utilizes the primer filtered out two parents to this family PCR amplification has been carried out with 6 filial generations.PCR reaction system is: template DNA 25ng, each 10ng of upstream and downstream primer, and concentration is The dNTP 0.4 μ L of 2.5mM, with fluorescently-labeled 1mM Fluorescein-12-dUTP (Roche Diagnostics) 0.01 μ L, Taq polymerase 0.5U, 10 × buffer (Tris-HCl, 500mM KCl, 20mM MgCl containing 100 μMs of pH 8.3₂ With 10.0g/L BSA) 1.5 μ L, add sterilizing deionized water and supplement reaction volume to 15 μ L；PCR reaction condition is: 94 DEG C of denaturations 5min；94 DEG C of degeneration 30s, 55 DEG C of annealing 30s, 72 DEG C extend 30s, carry out 35 circulations；72 DEG C extend 10min.Genotype is divided Analysis is carried out on ABI3730 sequenator as follows: product diluted by 1:20 with sterilizing deionized water；Take 1 μ L dilute Product after releasing, mixes with 9 μ L sample-loading buffers (containing 91% deionized formamide, 9%500ROX internal standard)；In 95 DEG C of changes Property 5min after, be placed in and cool down the most rapidly, go up afterwards machine run.Fig. 1 show willow primer WSSR_100 at willow full sib The fingerprint image that amplified production in family produces with ABI-3730 electrophoresis.According to different primers allele on amplification site Separation situation, have chosen altogether 10 pairs of amplified production electrophoretic fingerprints clear, in codominant inheritance and in willow genome for single The primer (table 1) of copy.

Table 1 is for screening the primer special of willow polyploid

Embodiment 2

Embodiment 1 is utilized to screen the 10 pairs of primers the obtained Salix babylonica L. to being saved in Nanjing Forestry University's willow Germplasm Resources (Salix babylonica), dry land willow (S.matsudana), Salix suchowensis (S.suchowensis) and purple willow (S.integra) 4 Planting willow, totally 48 parts of sample materials have carried out genotype detection.Concrete grammar is as follows:

Each sample DNA extracts from willow blade according to CTAB method.Afterwards as template, utilize 10 couple that screening obtains Primer expands at the enterprising performing PCR of ABI-9700 thermal cycler.The overall reaction system of PCR is 15 μ L, including: template DNA25ng, each 10ng of upstream and downstream primer, concentration is the dNTP 0.4 μ L of 2.5mM, with fluorescently-labeled 1mM Fluorescein-12-dUTP (Roche Diagnostics) 0.01 μ L, Taq polymerase 0.5U, 10 × buffer are (containing 100 μMs Tris-HCl, 500mM KCl, 20mM MgCl of pH 8.3₂With 10.0g/L BSA) 1.5 μ L, add sterilizing deionized water and supplement anti- Answer volume to 15 μ L；PCR reaction condition is: 94 DEG C of denaturations 5min；94 DEG C of degeneration 30s afterwards, 55 DEG C of annealing 30s, 72 DEG C are prolonged Stretch 30s, carry out 35 circulations；After loop ends, 72 DEG C extend 10min.

Gene type assay is carried out on ABI3730 sequenator as follows: product pressed with sterilizing deionized water 1:20 dilutes；Take the product after 1 μ L dilution, with 9 μ L sample-loading buffers (containing 91% deionized formamide, in 9%500ROX Mark) mixing；After 95 DEG C of degeneration 5min, being placed in and cool down the most rapidly, machine of going up afterwards runs.Fig. 2 is willow primer WSSR_100 48 parts of willow samples are carried out the fingerprint image of Ploidy detection generation.This patent utilizes different primers to produce amplification in 48 parts of samples Raw allele is shown in Table 2.Utilize GeneMapper genotyping software that the electrophoretic band obtained is carried out gene type assay, In 10 pairs of primers used, sample Sin_270 is 4 pairs of different primers (WSSR_33, WSSR_89, WSSR_100 and WSSR_173) Amplification site on detect 4 allele；Sample Sma_1, Sma_3, Sma_5 3 pairs of different primers (WSSR_88, WSSR_94 and WSSR_100) amplification site on detect 4 allele；And sample Sba_1, Sba_2, Sba_4, Sba_5、Sba_7、Sba_9、Sba_10、Sba_11、Sba_13、Sba_14、Sba_15、Sba_17、Sma_6、Sma_9、Sma_ 18, Sma_21, Sma_26 the most respectively 1 to or the amplification site of 2 pairs of primers on detect 4 allele, these are described Sample is all tetraploid.And with remaining primer, these samples are expanded, the number of alleles that corresponding positions point detects is the fewest In 4, this causes owing to there being part to isozygoty in 4 allele.Utilize codominant molecular marker that tetraploid is expanded During increasing, if 4 allele detected in a certain site, illustrate that this site allele is heterozygosis；If detecting 3 equipotential bases Cause, illustrates that this site has 3 allele to isozygoty, and another is heterozygosis；If detecting 2 allele, illustrate that this site has 2 right Homozygous alleles；If only 1 allele of detection, illustrates that 4, this site allele all isozygotys.In measuring samples, Ssu_ 90 at most detect 3 allele on the amplification site of 4 pairs of primers, and detect on the amplification site of other primers Number of alleles be respectively less than 3, show that Ssu_90 is triploid.Remaining sample at most can only be examined in the amplification site of all primers Measure 2 allele, illustrate that they are diploid, above testing result, be all consistent with the actual multiple of material selected.

Table 2 utilizes the allele (sample 1-12) that 48 parts of willow sample detection of 10 pairs of primer amplifications arrive

Table 2 continuous (sample 13-24)

Table 2 continuous (sample 25-36)

Table 2 continuous (sample 37-48)

In actually detected, 10 pairs of primers that available this patent provides, according to the equipotential detected on its amplification site Number gene judges the ploidy of tested willow, and carries out willow polyploid screening.As long as wherein any pair primer amplification goes out Number of alleles more than or equal to 3, i.e. show that sample is polyploid.

Being experimentally verified that, these 10 pairs of primers can rapidly and efficiently detect the polyploid of willow.

Visible, use the method for this patent can batch samples be used for quickly detecting, therefore the primer of this patent exploitation Provide Markers for Detection technology reliable, efficient for the screening of willow polyploid, provide important for willow polyploid breeding Technical support, have a extensive future.But willow sample to be detected should be derived from natural population or be produced by cross-breeding. And the polyploid produced by method artificial induction physically or chemically, owing to being not result in that number of alleles purpose increases, and Polyploid screening can not be carried out by this method.

SEQUENCE LISTING

<110>Nanjing Forestry University

<120>a kind of primer special combination for quickly detection willow polyploid and detection method thereof

<130> 100

<160> 20

<170> PatentIn version 3.3

<210> 1

<211> 20

<212> DNA

<213> Artificial

<220>

<223>WSSR_11 forward primer

<400> 1

tttataatgg ccatgagctt 20

<210> 2

<211> 20

<212> DNA

<213> Artificial

<220>

<223>WSSR_11 downstream primer

<400> 2

tcactaggtc ctggaacatc 20

<210> 3

<211> 20

<212> DNA

<213> Artificial

<220>

<223>WSSR_33 forward primer

<400> 3

gtcatttaca ggtctggcat 20

<210> 4

<211> 20

<212> DNA

<213> Artificial

<220>

<223>WSSR_33 downstream primer

<400> 4

gaggttgatg tttggtaagg 20

<210> 5

<211> 20

<212> DNA

<213> Artificial

<220>

<223>WSSR_34 forward primer

<400> 5

ccctagaaag gaaggacaat 20

<210> 6

<211> 20

<212> DNA

<213> Artificial

<220>

<223>WSSR_34 downstream primer

<400> 6

caatgagttt gtgatggtga 20

<210> 7

<211> 20

<212> DNA

<213> Artificial

<220>

<223>WSSR_88 forward primer

<400> 7

cacaaatctt attggaaaac 20

<210> 8

<211> 18

<212> DNA

<213> Artificial

<220>

<223>WSSR_88 downstream primer

<400> 8

ttactactga tgctgttc 18

<210> 9

<211> 18

<212> DNA

<213> Artificial

<220>

<223>WSSR_89 forward primer

<400> 9

ttggcagtta tgtctcca 18

<210> 10

<211> 18

<212> DNA

<213> Artificial

<220>

<223>WSSR_89 downstream primer

<400> 10

agtttgtcca agtgtccc 18

<210> 11

<211> 18

<212> DNA

<213> Artificial

<220>

<223>WSSR_91 forward primer

<400> 11

catcgtgccc agtaagga 18

<210> 12

<211> 18

<212> DNA

<213> Artificial

<220>

<223>WSSR_91 downstream primer

<400> 12

acataggaag cgggtggt 18

<210> 13

<211> 19

<212> DNA

<213> Artificial

<220>

<223>WSSR_94 forward primer

<400> 13

acaaggcatc aaagtagca 19

<210> 14

<211> 19

<212> DNA

<213> Artificial

<220>

<223>WSSR_94 downstream primer

<400> 14

ctccaggaga tccaagacg 19

<210> 15

<211> 18

<212> DNA

<213> Artificial

<220>

<223>WSSR_100 forward primer

<400> 15

gcaaaagcca aaaggaga 18

<210> 16

<211> 18

<212> DNA

<213> Artificial

<220>

<223>WSSR_100 downstream primer

<400> 16

aaccagcaga ggaaagtg 18

<210> 17

<211> 20

<212> DNA

<213> Artificial

<220>

<223>WSSR_124 forward primer

<400> 17

tgctctgaaa gatctacggt 20

<210> 18

<211> 20

<212> DNA

<213> Artificial

<220>

<223>WSSR_124 downstream primer

<400> 18

aaccacattg attcttccac 20

<210> 19

<211> 18

<212> DNA

<213> Artificial

<220>

<223>WSSR_173 forward primer

<400> 19

ttattgctgg aaaggttg 18

<210> 20

<211> 18

<212> DNA

<213> Artificial

<220>

<223>WSSR_173 downstream primer

<400> 20

ttcgtgtctt tagggtct 18

Claims

1. the primer special combination for quickly detection willow polyploid, it is characterised in that include that 10 couple in following table draws Thing:

Title Forward primer (5 '-3 ') Downstream primer (5 '-3 ') WSSR_11 TTTATAATGGCCATGAGCTT TCACTAGGTCCTGGAACATC WSSR_33 GTCATTTACAGGTCTGGCAT GAGGTTGATGTTTGGTAAGG WSSR_34 CCCTAGAAAGGAAGGACAAT CAATGAGTTTGTGATGGTGA WSSR_88 CACAAATCTTATTGGAAAAC TTACTACTGATGCTGTTC WSSR_89 TTGGCAGTTATGTCTCCA AGTTTGTCCAAGTGTCCC WSSR_91 CATCGTGCCCAGTAAGGA ACATAGGAAGCGGGTGGT WSSR_94 ACAAGGCATCAAAGTAGCA CTCCAGGAGATCCAAGACG WSSR_100 GCAAAAGCCAAAAGGAGA AACCAGCAGAGGAAAGTG WSSR_124 TGCTCTGAAAGATCTACGGT AACCACATTGATTCTTCCAC WSSR_173 TTATTGCTGGAAAGGTTG TTCGTGTCTTTAGGGTCT

2. the method for quick of a willow polyploid, it is characterised in that: with the DNA of testing sample as template, utilize right Require that all primers in 1 table carry out PCR amplification, the product obtained carried out electrophoresis, electrophoresis result is carried out gene type assay, If the allele number that any of which primer pair amplifies goes out is more than or equal to 3, then counter sample is polyploid, is not Polyploid.

The method for quick of willow polyploid the most according to claim 2, it is characterised in that: PCR reaction system is: mould Plate DNA 25ng, each 10ng of upstream and downstream primer, concentration is the dNTP 0.4 μ L of 2.5mM, with fluorescently-labeled 1mM Fluorescein-12-dUTP 0.01 μ L, Taq polymerase 0.5U, 10 × buffer1.5 μ L, add sterilizing deionized water and supplement anti- Answer volume to 15 μ L.

The method for quick of willow polyploid the most according to claim 2, it is characterised in that: PCR reaction condition is: 94 DEG C denaturation 5min；94 DEG C of degeneration 30s, 55 DEG C of annealing 30s, 72 DEG C extend 30s, carry out 35 circulations；72 DEG C extend 10min.

The method for quick of willow polyploid the most according to claim 2, it is characterised in that: described genotype is divided Analysis, is carried out on ABI3730 sequenator as follows: product diluted by 1:20 with sterilizing deionized water；Take 1 μ L dilute Product after releasing, mixes with 9 μ L sample-loading buffers；After 95 DEG C of degeneration 5min, it is placed in and cools down the most rapidly, go up machine afterwards Run.