CN106222080A - Pulmonary carcinoma prognoses system - Google Patents
Pulmonary carcinoma prognoses system Download PDFInfo
- Publication number
- CN106222080A CN106222080A CN201610664342.2A CN201610664342A CN106222080A CN 106222080 A CN106222080 A CN 106222080A CN 201610664342 A CN201610664342 A CN 201610664342A CN 106222080 A CN106222080 A CN 106222080A
- Authority
- CN
- China
- Prior art keywords
- pulmonary carcinoma
- methylation
- cpg site
- mark
- chr3
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Abstract
The open a kind of pulmonary carcinoma prognoses system of the present invention, including: acquisition module, in order to obtain the methylation of mark in SHOX2 gene, described mark is the CpG site in SHOX2 gene between chr3:157821233 157821604；And, it is judged that module, in order to methylation and the setting threshold value of relatively described mark, when the methylation of described mark is less than described setting threshold value, it is judged that pulmonary carcinoma occurs.It is convenient that the present invention proposes a kind of prediction, pulmonary carcinoma prognoses system with low cost.
Description
Technical field
The present invention relates to gene technology field, particularly to a kind of pulmonary carcinoma prognoses system.
Background technology
2013, subordinate's international cancer research institution of World Health Organization (WHO) issued report, point out atmospheric pollution for universal and
Main environmental carcinogen, causes the mankind to occur the risk of pulmonary carcinoma to increase.In order to take corresponding prophylactico-therapeutic measures as early as possible, need to be to lung
First the generation of cancer is predicted.But, by traditional tissue biopsy system prediction pulmonary carcinoma, it was predicted that process is complex and high cost
High.
Summary of the invention
The main object of the present invention is to propose a kind of pulmonary carcinoma prognoses system, it is intended to propose one prediction convenient, with low cost
Pulmonary carcinoma prognoses system.
For achieving the above object, the pulmonary carcinoma prognoses system that the present invention proposes, including:
Acquisition module, in order to obtain the methylation of mark in SHOX2 gene, described mark is SHOX2 gene
CpG site between middle chr3:157821233-157821604 position；And,
Judge module, in order to methylation and the setting threshold value of relatively described mark, when the methyl of described mark
When change degree is less than described setting threshold value, it is judged that pulmonary carcinoma occurs.
Preferably, during described mark is SHOX2 gene between chr3:157821233-157821604 position the 50th,
60, the CpG site of 68,86,106,116,120,126,223,227 and 235.
Preferably, described set threshold value asWherein,
ai(i=1,2 ..., 11) be respectively in SHOX2 gene between chr3:157821233-157821604 position the 50th,
60, the methylation threshold value in the single CpG site of 68,86,106,116,120,126,223,227 and 235, a1It is 0.04
～0.1, a2It is 0.011～0.016, a3It is 0.08～0.16, a4It is 0.065～0.12, a5It is 0.11～0.3, a6Be 0.15～
0.4, a7It is 0.13～0.28, a8It is 0.04～0.14, a9It is 0.11～0.16, a10It is 0.1～0.17, a11It is 0.01～0.4；
Xi(i=1,2 ..., 11) respectively in corresponding SHOX2 gene between chr3:157821233-157821604 position the
50, the CpG site of 60,68,86,106,116,120,126,223,227 and 235, when the methylation in a certain CpG site
When participation is compared, the X in corresponding described CpG siteiValue is 1, and otherwise value is 0.
Preferably, CpG position between chr3:157821303-157821353 position during described mark is SHOX2 gene
Point.
Preferably, during described mark is SHOX2 gene between chr3:157821303-157821353 position the 86th,
106, the CpG site of 116,120 and 126.
Preferably, described set threshold value asWherein,
ai(i=1,2 ..., 5) be respectively in SHOX2 gene between chr3:157821233-157821604 position the 86th,
106, the methylation threshold value in the single CpG site of 116,120 and 126, a1It is 0.065～0.12, a2It is 0.11～0.3,
a3It is 0.15～0.4, a4It is 0.13～0.28, a5It is 0.04～0.14；
Xi(i=1,2 ..., 5) respectively in corresponding SHOX2 gene between chr3:157821303-157821353 position the
86, the CpG site of 106,116,120 and 126, when the methylation in a certain CpG site participates in comparing, corresponding described
The X in CpG siteiValue is 1, and otherwise value is 0.
Preferably, described acquisition module also includes detecting device, and described detection device is in order to detect described in SHOX2 gene
The methylation of mark.
Preferably, described detection device includes:
Extraction unit, in order to extract the DNA sample including described SHOX2 gene；
Conversion unit, in order to the C of methylated CpG site non-in DNA is converted into U by sulphite, obtains converting and produces
Thing；
Amplification unit, in order to expand described converted product by polymerase chain reaction PCR, it is thus achieved that amplified production；
Digestion unit, in order to digest described amplified production by shrimp alkaline phosphotase SAP, it is thus achieved that digestion product；
Transcribe and enzyme action unit, in order to transcribe and digestion product described in enzyme action, it is thus achieved that include transcribing and enzyme action of Short interfering RNA
Product；
Determination unit, in order to measure described Short interfering RNA by mass spectrometry method, it is thus achieved that mark in described SHOX2 gene
Methylation.
Preferably, described amplification unit includes containing the primer in mark CpG site in described SHOX2 gene.
Preferably, described primer includes primer pair, and the forward primer of described primer pair is selected from SEQ ID NO.2, accordingly
Reverse primer is selected from SEQ ID NO.3；Or,
The forward primer of described primer pair is selected from SEQ ID NO.4, and corresponding reverse primer is selected from SEQ ID NO.5；Or,
The forward primer of described primer pair is selected from SEQ ID NO.6, and corresponding reverse primer is selected from SEQ ID NO.7.
Preferably, described detection device also includes:
Purification unit, in order to by transcribing described in resin purification and digestion products, Short interfering RNA described in purification.
Preferably, described mass spectrometry method is flight mass spectrum method.
Preferably, described pulmonary carcinoma prognoses system also includes:
Output module, for exporting the operation result of described acquisition module and/or judge module.
In technical solution of the present invention, acquisition module obtain in SHOX2 gene chr3:157821233-157821604 position it
Between the methylation in CpG site, it is judged that module compares the methylation of mark and sets threshold value, when the first of mark
Base degree is less than when setting threshold value, it is judged that pulmonary carcinoma occurs, by the acquisition of mark methylation in related gene and
Judge to realize prediction to pulmonary carcinoma, it is proposed that a kind of predict conveniently, pulmonary carcinoma prognoses system with low cost.
Accompanying drawing explanation
In order to be illustrated more clearly that the embodiment of the present invention or technical scheme of the prior art, below will be to embodiment or existing
In having technology to describe, the required accompanying drawing used is briefly described, it should be apparent that, the accompanying drawing in describing below is only this
Some embodiments of invention, for those of ordinary skill in the art, on the premise of not paying creative work, it is also possible to
Other accompanying drawing is obtained according to the structure shown in these accompanying drawings.
Fig. 1 is the module diagram of pulmonary carcinoma prognoses system in one embodiment of the invention；
Fig. 2 is the schematic diagram of the detection device of pulmonary carcinoma prognoses system in one embodiment of the invention；
Fig. 3 is that in one embodiment of the invention, in pulmonary carcinoma prognoses system, the methylation state in example site is being cancer crowd and just
Distribution schematic diagram in ordinary person group；
Fig. 4 is the methylation in experimenter's blood DNA example site in pulmonary carcinoma prognoses system in one embodiment of the invention
The ROC curve figure of meansigma methods.
The realization of the object of the invention, functional characteristics and advantage will in conjunction with the embodiments, are described further referring to the drawings.
Detailed description of the invention
Below in conjunction with the accompanying drawing in the embodiment of the present invention, the technical scheme in the embodiment of the present invention is carried out clear, complete
Describe, it is clear that described embodiment is only a part of embodiment of the present invention rather than whole embodiments wholely.Base
Embodiment in the present invention, those of ordinary skill in the art obtained under not making creative work premise all its
His embodiment, broadly falls into the scope of protection of the invention.
The present invention proposes a kind of pulmonary carcinoma prognoses system.
Pulmonary carcinoma is that M & M increases the soonest, one of malignant tumor maximum to population health and life threat,
Day by day serious in particular with atmospheric pollution, lung cancer morbidity rate increases further.Epigenetics confirms, DNA methylates
The risk that degree occurs with some cancer has high correlation, along with the development of gene technology, by obtaining experimenter's body fluid
The methylation of middle gene marker, can effectively predict the risk that associated cancer occurs.
In embodiments of the present invention, as it is shown in figure 1, pulmonary carcinoma prognoses system includes:
Acquisition module 10, in order to obtain the methylation of mark in SHOX2 gene, mark is in SHOX2 gene
CpG site between chr3:157821233-157821604 position；And,
Judge module 20, in order to compare methylation and the setting threshold value of mark, when the methylation of mark
Less than when setting threshold value, it is judged that pulmonary carcinoma occurs.
Gene is the DNA (deoxyribonucleic acid) DNA fragmentation with hereditary effect, and DNA is a kind of long-chain polymer, and it forms single
Position is four kinds comprises the Deoxydization nucleotide of different base, and wherein, four kinds of bases are respectively adenine A, thymus pyrimidine T, cytosine C
With guanine G.In DNA, C and G connected by phosphoric acid p forms CpG site.Catalysis at DNA methyl transfer catalysis enzyme is made
Under with, the deoxycytidylic acid in CpG site is converted into 5-methylcytosine, i.e. DNA methylates.Methylation is
Refer to that a certain CpG site occurs methylated probability or a certain CpG site that methylated ratio has occurred.The change of methylation
The expression of gene can be changed by change chromatin Structure and the mode such as stability, change transcription factor combination activity.One
For as, hypomethylation degree is conducive to the expression of gene, the expression of hyper-methylation degree suppressor gene.The risk that pulmonary carcinoma occurs
With in SHOX2 gene between chr3:157821233-157821604 position the methylation in CpG site relevant, low-level
In SHOX2 gene, between chr3:157821233-157821604 position, the methylation in CpG site causes gene expression to enliven,
Thus cause pulmonary carcinoma occurrence risk to increase.Wherein, the 3rd article of dye during chr3:157821233-157821604 position refers to SHOX2 gene
On colour solid the 157821233rd, to the 157821604th, has 372 bases between the two position, its sequence table is such as
Shown in SEQ ID NO.1.Obtain in SHOX2 gene between chr3:157821233-157821604 position by acquisition module 10
The methylation in CpG site, compares methylation and the setting threshold value of mark, when mark by judge module 20
Methylation is less than when setting threshold value, it is judged that pulmonary carcinoma occurs.
Wherein, the methylation information of mark during acquisition module 10 can directly obtain known SHOX2 gene；Also may be used
By detecting the body fluid of experimenter, obtain the methylation of SHOX2 gene marker, hereinafter will be apparent from.Obtain mould
Block 10 and judge module 20 can be hardware device and/or software program, are arranged on and fix or on mobile terminal, by wired company
Connect, be wirelessly transferred or receive the modes such as hand input-data and obtain the methylation of mark, and judge accordingly, real
Reality time or remotely predicting pulmonary carcinoma.
In technical solution of the present invention, acquisition module 10 obtains mark in SHOX2 gene, i.e. chr3:157821233-
The methylation in CpG site between 157821604, it is judged that module 20 is according to the journey that methylates of mark in SHOX2 gene
Degree prediction pulmonary carcinoma, when in SHOX2 gene, the methylation of mark is less than when setting threshold value, and gene expression enlivens, it is judged that send out
Raw pulmonary carcinoma.Pass through gene technology, it is proposed that a kind of predict conveniently, pulmonary carcinoma prognoses system with low cost.
In the preferred embodiment of the present invention, chr3:157821233-157821604 during mark is SHOX2 gene
The CpG site of the 50th, 60,68,86,106,116,120,126,223,227 and 235 between Wei, i.e. in SHOX2 gene
Article 3, on chromosome between the 157821233rd to the 157821604th the 50th, 60,68,86,106,116,120,126,
223, the CpG site of 227 and 235.The methylation in above-mentioned CpG site is obtained, for judge module by acquisition module 10
20 prediction pulmonary carcinoma.
In the preferred embodiment, set threshold value asWherein,
ai(i=1,2 ..., 11) be respectively in SHOX2 gene between chr3:157821233-157821604 position the 50th,
60, the methylation threshold value in the single CpG site of 68,86,106,116,120,126,223,227 and 235, a1It is 0.04
～0.1, a2It is 0.011～0.016, a3It is 0.08～0.16, a4It is 0.065～0.12, a5It is 0.11～0.3, a6Be 0.15～
0.4, a7It is 0.13～0.28, a8It is 0.04～0.14, a9It is 0.11～0.16, a10It is 0.1～0.17, a11It is 0.01～0.4；
Xi(i=1,2 ..., 11) respectively in corresponding SHOX2 gene between chr3:157821233-157821604 position the
50, the CpG site of 60,68,86,106,116,120,126,223,227 and 235, when the methylation in a certain CpG site
When participation is compared, the X in corresponding described CpG siteiValue is 1, and otherwise value is 0.
Above-mentioned threshold value ai(i=1,2 ..., 11) experimental statistical analysis determines.Judge module 20 is comparing
When the acquired value of methylation and threshold value, may select some in above-mentioned CpG site, certain several combination or whole site
Methylation acquired value judge.When selecting the methylation acquired value in some CpG site, with SHOX2 base
In Yin as a example by the CpG site of between chr3:157821233-157821604 position the 223rd (hereinafter referred to example site),
Methylation threshold value corresponding to this example site is a9, the most only consider the methylation in this example site, work as judge module
20 by comparing the acquired value drawing methylation less than a9Time, it is judged that pulmonary carcinoma occurs.a9Span be 0.11～
0.16, the value in above-mentioned scope all can be as threshold value, and the specificity predicted and sensitivity have with selected concrete threshold value
Close.The threshold value selected is the lowest, it was predicted that specificity the highest, sensitivity is the lowest, and the loss i.e. predicted the outcome is the highest, false positive
Rate is the lowest；And the threshold value selected is the highest, it was predicted that sensitivity the highest, specificity is the lowest, and the false positive rate i.e. predicted the outcome is more
Height, loss is the lowest.Consider Sensitivity and Specificity, preferred threshold value a9It it is the intervening value in the range of 0.11～0.16
0.14.In like manner, consider Sensitivity and Specificity, methylation threshold value a in other CpG siteiPreferred value be corresponding
Intervening value in threshold range, i.e. a1It is preferably 0.07, a2It is preferably 0.014, a3It is preferably 0.12, a4It is preferably 0.09, a5Excellent
Elect 0.21, a as6It is preferably 0.25, a7It is preferably 0.21, a8It is preferably 0.09, a10It is preferably 0.14, a11It is preferably 0.23.
When selecting the combination in a few CpG sites, the X that selected CpG site is correspondingiValue value is 1, not selected
X corresponding to CpG siteiValue value is 0, according toCalculate the threshold value of methylation, and then
Compare with the acquired value of methylation.Such as, when considering in SHOX2 gene between chr3:157821233-157821604 position
The CpG site of the 50th, 60,86, i.e. Xi=1 (i=1,2,4), Xi=0 (i=3,5,6,7,8,9,10,11), then M=(a1
+a2+a4)/3, wherein, a1、a2、a4Be respectively in SHOX2 gene between chr3:157821233-157821604 position the 50th,
60, the methylation threshold value in the CpG site of 86.
When selecting whole CpG sites to judge, Xi=1 (i=1,2 ..., 11), the threshold of corresponding methylation
Value is
In another preferred embodiment of the present invention, mark is chr3:157821303-in SHOX2 gene
CpG site between 157821353.Chr3:157821303-in SHOX2 gene is obtained by acquisition module 10
The methylation in CpG site between 157821353, the 157821303rd on i.e. the 3rd article chromosome to
157821353, the CpG site between the two position, compare the methylation of mark by judge module 20 and set
Determine threshold value, when the methylation of mark is less than when setting threshold value, it is judged that pulmonary carcinoma occurs.
In the another preferred embodiment of the present invention, mark is chr3:157821303-in SHOX2 gene
The CpG site of the 86th, 106,116,120 and 126 between 157821353.Accordingly, set threshold value asWherein,
ai(i=1,2 ..., 5) be respectively in SHOX2 gene between chr3:157821233-157821604 position the 86th,
106, the methylation threshold value in the single CpG site of 116,120 and 126, a1It is 0.065～0.12, a2It is 0.11～0.3,
a3It is 0.15～0.4, a4It is 0.13～0.28, a5It is 0.04～0.14；
Xi(i=1,2 ..., 5) respectively in corresponding SHOX2 gene between chr3:157821303-157821353 position the
86, the CpG site of 106,116,120 and 126, when the methylation in a certain CpG site participates in comparing, corresponding described
The X in CpG siteiValue is 1, and otherwise value is 0.
In like manner, considering Sensitivity and Specificity, the preferred value of threshold value is the intervening value of respective threshold span, i.e.
a1It is preferably 0.09, a2It is preferably 0.21, a3It is preferably 0.25, a4It is preferably 0.21, a5It is preferably 0.09.
In above preferred embodiment, as it is shown in figure 1, acquisition module 10 also includes detecting device 11, in order to detect SHOX2 base
The methylation of mark in Yin.
There is multiple detection device 11, to detect the methylation of mark in SHOX2 gene.At a specific embodiment
In, chr3:157821233-in detection device 11 methylation analysis methods based on restricted enzyme detection SHOX2 gene
The methylation in CpG site between 157821604, including methylation sensitive restriction restriction endonuclease-PCR/Southern method,
I.e. by using methylation sensitive restriction restriction endonuclease that DNA is cut into the fragment varied in size, go forward side by side performing PCR/Southern
Analysis detects.In another specific embodiment, detection device 11 is based on analyzing the sample that processed through bisulfite
The method of methylation detects, including bisulfite order-checking, methylation status of PTEN promoter, Manganic pyrophosphate complex initiation and knot
Close the restriction enzyme enzyme process etc. of bisulfite.In still another embodiment, detect device 11 first based on full-length genome
Base fractional analysis method, i.e. methylation profiles analysis, the methylation of mark in detection SHOX2 gene, thus realize full-page proof
This amount, the detection in multiple site, specifically include can realize multiple CpG detection flight mass spectrum based on MassARRAY technology divide
Analysis method, analytic process based on high-flux sequence or methylation profiles analytic process based on chip etc..
In the preferred embodiment of the present invention, the flight mass spectrum method that detection device 11 provides based on Sequenom company
The methylation of detection mark, as in figure 2 it is shown, detection device 11 includes:
Extraction unit 111, in order to extract the DNA sample including described SHOX2 gene；
Conversion unit 112, in order to the C of methylated CpG site non-in DNA is converted into U by sulphite, is converted
Product；
Amplification unit 113, in order to expand described converted product by polymerase chain reaction PCR, it is thus achieved that amplified production；
Digestion unit 114, in order to digest described amplified production by shrimp alkaline phosphotase SAP, it is thus achieved that digestion product；
Transcribe and enzyme action unit 115, in order to transcribe and digestion product described in enzyme action, it is thus achieved that include Short interfering RNA transcribe and
Digestion products；
Determination unit 116, in order to measure described Short interfering RNA by mass spectrometry method, it is thus achieved that mark in described SHOX2 gene
Methylation.
In a concrete example, randomly selecting totally 18 experimenters, wherein 9 entitled patients with lung cancer, 9 is entitled the most tested
Person, and gather its blood and saliva sample, detect the methylation of mark in SHOX2 gene by detection device 11.
First, extracted from the blood and saliva sample of experimenter by extraction unit 111 and include the DNA of SHOX2 gene
Sample, and the DNA sample extracted is carried out quality inspection, to ensure being smoothed out of subsequent detection.Extraction unit 11 includes Wuhan
" saliva DNA extraction purification kit (tube method) QT-275 " of Chang Mei Bioisystech Co., Ltd, to extract subjects saliva
In DNA, and " QIAGEN hemocyte DNA extraction kit 51104 ", to extract the DNA in experimenter's blood.Extraction completes
After, whether extraction unit 111 detects the purity of extracted DNA by agarose gel electrophoresis and degrades, or passes through ultramicron
Spectrophotometer NanoDrop detects concentration and the purity of extracted DNA.
Secondly, by conversion unit 112, the C in CpG site unmethylated in DNA sample is converted into U, and methylated
C keeps constant.Specifically can use " the EZ DNA Methylation-Kit test kit D5001 " of ZYMO company, by therein
Sulphite reacts with C, it is achieved the conversion processing to unmethylated CpG site, obtains converted product.
Then, amplification unit 113 expands above-mentioned converted product by polymerase chain reaction PCR, to obtain enough marks
Will thing, it is simple to follow-up detection.Amplification unit 113 includes PCR instrument " ABI GeneAmp9700 384 Dual ", concrete PCR
Reaction system is as shown in the table:
| Reactant | Volume (μ L) |
| ddH2O | 1.42 |
| 10 × PCR Buffer, containing 20mmol MgCl2 | 0.50 |
| dNTP | 0.04 |
| Enzyme | 0.04 |
| Forward primer/reverse primer | 2 |
| Converted product | 1 |
| Amount to | 5 |
Wherein, including the primer of forward primer/reverse primer to being respectively selected from SEQ ID NO.2 and SEQ ID NO.3, should
Primer is to using the synthesis of high performance liquid chromatography HPLC.It should be noted that amplification unit 113 can also include containing SHOX2
Other primer in mark CpG site in gene, such as, the forward primer/reverse primer of primer centering also can be respectively selected from SEQ
ID NO.4 and SEQ ID NO.5, or it is respectively selected from SEQ ID NO.6 and SEQ ID NO.7.In this concrete example, use SEQ
ID NO.2 and SEQ ID NO.3 is forward primer/reverse primer, and corresponding PCR reaction condition is as shown in the table:
Wherein, primer annealing temperature and the T of selected primermValue, i.e. two sections complementary base sequences unwind 50% time
Temperature value is relevant, when using other primer, need to be adjusted correspondingly it according to primer.Reacted by PCR, to examine
The mark surveyed expands, and obtains amplified production.In PCR course of reaction, unmethylated C the U being transformed enters one
Step is converted into T.
Then, above-mentioned amplified production is digested, to remove unnecessary dNTPs and primer, it is to avoid right by digestion unit 114
Subsequent detection interferes.In this concrete example, the reaction system of digestion unit 114 is as shown in the table:
Corresponding reaction condition is as shown in the table:
| Temperature | Time |
| 37℃ | 20min |
| 85℃ | 5min |
| 25℃ | Insulation |
Then, transcribe and with enzyme action unit 115, above-mentioned digestion product is transcribed and enzyme action, transcribe and make in digestion product
Double-stranded DNA is changed into single stranded RNA, thus avoids during follow-up Mass Spectrometer Method, and double-stranded DNA is opened and affected mensuration knot
Really.Enzyme action makes the RNA of long-chain be changed into small fragment RNA, on the one hand meets the mass spectrometry method restrictive condition to tested molecular size；
On the other hand make each CpG site separately, in order to analyze the methylation in each CpG site one by one.Concrete reaction system
As shown in the table:
| Reactant | Volume (μ L) |
| RNase-free ddH2O | 3.21 |
| 5×T7 Polymerase buffer | 0.89 |
| T Cleavage Mix | 0.22 |
| DTT | 0.22 |
| T7 RNA&DNA Polymerase | 0.40 |
| RNase A | 0.06 |
| Amount to | 5 |
Corresponding reaction condition is 37 DEG C of incubations 3 hours.
Finally, determination unit 116 measures Short interfering RNA by mass spectrometry method, due to the C in unmethylated CpG site
It is converted into T eventually, and the C in methylated CpG site keeps constant, thus create the difference of molecular weight, this by detection
The difference of molecular weight, calculates the methylation in a certain CpG site, and then draws methylating of mark in SHOX2 gene
Degree.In this concrete example, use flight mass spectrum method, especially by Matrix Assisted Laser Desorption ionization time of flight mass spectrometry method
Obtain mass spectra peak, draw methylation according to mass spectra peak figure further.Determination unit 16 includes mass spectrum point sample instrument MassARRAY
Nanodispenser RS1000, mass spectrometer MassARRAY Compact System, related reagent EpiTYPERRT
Complete Reagent Set and relevant Epityper software.
In order to improve the precision of detection further, detection device 11 also includes purification unit 117, is turned by resin purification
Record and digestion products, purification Short interfering RNA, it is specially 384 orifice plates of product add 20 μ L tri-distilled waters, in centrifuge
It is centrifuged 3min with 2000r/min, adds resin, reversion well distributing rocker carries out resin purification reaction 15min, desalination, has reacted
In centrifuge, it is centrifuged 3min with 2000r/min after one-tenth；By the sample spot after desalting processing on sample target, spontaneous nucleation, obtains
Obtain purified product.Purification unit 11 7 process transcribe with digestion products after, then measured its methylation by determination unit 116.
Analyze the judged result that this pulmonary carcinoma prognoses system draws, as it is shown on figure 3, with the example site in SHOX2 gene be
Example.Wherein, vertical coordinate represents the methylation in example site of detection gained, the most corresponding cancer patient of two casees, left and right figure and
The data value statistical conditions of normal subjects.Total sample number N is 18, the data value statistical p of cancer patient and normal subjects
Value is 0.030416, and this statistical p value is less than 0.05, shows methylating of example site between cancer patient and normal subjects
There is significant difference in level, i.e. this example site can distinguish cancer crowd and normal population well.
As shown in Figure 4, bent for the ROC of example site methylation meansigma methods in the SHOX2 gene of experimenter's blood DNA
Line chart, wherein, threshold value a9It is taken as preferred 0.14.Abscissa represents that false negative rate, vertical coordinate represent true negative rate, total sample number
N is 18, and area under curve AUC (Area Under Curve) value is 0.78125.The teachings of AUC is 0～1, along with
The increase of AUC, specificity and the sensitivity of detection are the highest, and the AUC drawn in Fig. 4 shows that this pulmonary carcinoma prognoses system has relatively
Good specificity and sensitivity.
In sum, in 18 experimenters of this concrete example, example site methylation in patients with lung cancer
Meansigma methods is all substantially less than normal subjects 25-45%, and is statistically significant.
In the preferred embodiment of the present invention, as it is shown in figure 1, pulmonary carcinoma prognoses system also includes:
Output module 30, for exporting acquisition module 10 and/or the operation result of judge module 20.
The operation result of each module in pulmonary carcinoma prognoses system running is exported, for analyzing and sentencing by output module 30
Disconnected, provide corresponding tutorial message for follow-up pulmonary carcinoma preventing and treating.
The foregoing is only the preferred embodiments of the present invention, not thereby limit the scope of the claims of the present invention, every at this
Under the inventive concept of invention, utilize the equivalent structure transformation that description of the invention and accompanying drawing content are made, or directly/indirectly use
The technical field relevant at other is included in the scope of patent protection of the present invention.
Sequence table
SEQ ID NO.1:
CGAGGATCGCGAATATTCCGCTTGAACCTGTTGATCTCTGTGGGTTAAGCGTTTAGGGTCGAGTCTGCG
TTTCCACGAGGGAGGGCGAAGAGAGAACAGAAAGAGCGGTTGCTTTCGCCCGCCACCGGAGGCTGGTTTTCCGCCTC
CTGCCTTCTGGCCCGGCTTGGGCGGCGAGCCCTTTGGGCAGCCAACATGGCGTGGGCGCCTGTGCTCGTGCGACCCC
GGTCGGGCAGGCGGGACGGAGATTACCTGGCTGTCCAGGGGACCTTATGCAGGGTTTGGCCCGAGCCCAGGGGCAGC
GAGGGGCGTCTGCGGATGCGGCTCCCTGTGCGGCACAACACCGGGGTCTGTTGCTCTCGCTGATACCTTTCG
SEQ ID NO.2:
AGGAAGAGAGATTTGTTGATTTTTGTGGGTTAAG
SEQ ID NO.3:
CAGTAATACGACTCACTATAGGGAGAAGGCTCCCTACATAAAATCCCCTAAACAA
SEQ ID NO.4:
GGTTAAATTTTGTATAAGGTTTTT
SEQ ID NO.5:
ATTTGTTGATTTTTGTGGGRRAAG
SEQ ID NO.6:
TAAGGTTTTTTGGATAGTTAGGTA
SEQ ID NO.7:
AATATTTTGTTTGAATTTGTTGA
Claims (13)
1. a pulmonary carcinoma prognoses system, it is characterised in that including:
Acquisition module, in order to obtain the methylation of mark in SHOX2 gene, described mark is in SHOX2 gene
CpG site between chr3:157821233-157821604 position；And,
Judge module, in order to methylation and the setting threshold value of relatively described mark, when the journey that methylates of described mark
When degree is less than described setting threshold value, it is judged that pulmonary carcinoma occurs.
2. pulmonary carcinoma prognoses system as claimed in claim 1, it is characterised in that described mark is chr3 in SHOX2 gene:
The CpG of the 50th, 60,68,86,106,116,120,126,223,227 and 235 between 157821233-157821604 position
Site.
3. pulmonary carcinoma prognoses system as claimed in claim 2, it is characterised in that described set threshold value as
Wherein,
ai(i=1,2 ..., 11) be respectively in SHOX2 gene between chr3:157821233-157821604 position the 50th, 60,68,
86, the methylation threshold value in the single CpG site of 106,116,120,126,223,227 and 235, a1It is 0.04～0.1,
a2It is 0.011～0.016, a3It is 0.08～0.16, a4It is 0.065～0.12, a5It is 0.11～0.3, a6It is 0.15～0.4, a7
It is 0.13～0.28, a8It is 0.04～0.14, a9It is 0.11～0.16, a10It is 0.1～0.17, a11It is 0.01～0.4；
Xi(i=1,2 ..., 11) respectively in corresponding SHOX2 gene between chr3:157821233-157821604 position the 50th,
60, the CpG site of 68,86,106,116,120,126,223,227 and 235, when the methylation in a certain CpG site is joined
With when comparing, the X in corresponding described CpG siteiValue is 1, and otherwise value is 0.
4. pulmonary carcinoma prognoses system as claimed in claim 1, it is characterised in that described mark is chr3 in SHOX2 gene:
CpG site between 157821303-157821353 position.
5. pulmonary carcinoma prognoses system as claimed in claim 4, it is characterised in that described mark is chr3 in SHOX2 gene:
The CpG site of the 86th, 106,116,120 and 126 between 157821303-157821353 position.
6. pulmonary carcinoma prognoses system as claimed in claim 5, it is characterised in that described set threshold value as
Wherein,
ai(i=1,2 ..., 5) be respectively in SHOX2 gene between chr3:157821233-157821604 position the 86th, 106,
116, the methylation threshold value in the single CpG site of 120 and 126, a1It is 0.065～0.12, a2It is 0.11～0.3, a3For
0.15～0.4, a4It is 0.13～0.28, a5It is 0.04～0.14；
Xi(i=1,2 ..., 5) respectively in corresponding SHOX2 gene between chr3:157821303-157821353 position the 86th,
106, the CpG site of 116,120 and 126, when the methylation in a certain CpG site participates in comparing, corresponding described CpG position
The X of pointiValue is 1, and otherwise value is 0.
7. pulmonary carcinoma prognoses system as claimed in claim 1, it is characterised in that described acquisition module also includes detecting device, institute
State detection device in order to detect the methylation of mark described in SHOX2 gene.
8. pulmonary carcinoma prognoses system as claimed in claim 7, it is characterised in that described detection device includes:
Extraction unit, in order to extract the DNA sample including described SHOX2 gene；
Conversion unit, in order to the C of methylated CpG site non-in DNA is converted into U by sulphite, obtains converted product；
Amplification unit, in order to expand described converted product by polymerase chain reaction PCR, it is thus achieved that amplified production；
Digestion unit, in order to digest described amplified production by shrimp alkaline phosphotase SAP, it is thus achieved that digestion product；
Transcribe and enzyme action unit, in order to transcribe and digestion product described in enzyme action, it is thus achieved that include that transcribing of Short interfering RNA is produced with enzyme action
Thing；
Determination unit, in order to measure described Short interfering RNA by mass spectrometry method, it is thus achieved that the methyl of mark in described SHOX2 gene
Change degree.
9. pulmonary carcinoma prognoses system as claimed in claim 8, it is characterised in that described amplification unit includes containing described SHOX2
The primer in mark CpG site in gene.
10. pulmonary carcinoma prognoses system as claimed in claim 9, it is characterised in that described primer includes primer pair, described primer pair
Forward primer selected from SEQ ID NO.2, corresponding reverse primer is selected from SEQ ID NO.3；Or,
The forward primer of described primer pair is selected from SEQ ID NO.4, and corresponding reverse primer is selected from SEQ ID NO.5；Or,
The forward primer of described primer pair is selected from SEQ ID NO.6, and corresponding reverse primer is selected from SEQ ID NO.7.
11. pulmonary carcinoma prognoses systems as claimed in claim 8, it is characterised in that described detection device also includes:
Purification unit, in order to by transcribing described in resin purification and digestion products, Short interfering RNA described in purification.
12. pulmonary carcinoma prognoses system as claimed in claim 8, it is characterised in that described mass spectrometry method is flight mass spectrum method.
13. pulmonary carcinoma prognoses systems as claimed in claim 1, it is characterised in that also include:
Output module, for exporting the operation result of described acquisition module and/or judge module.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610664342.2A CN106222080A (en) | 2016-08-12 | 2016-08-12 | Pulmonary carcinoma prognoses system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610664342.2A CN106222080A (en) | 2016-08-12 | 2016-08-12 | Pulmonary carcinoma prognoses system |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106222080A true CN106222080A (en) | 2016-12-14 |
Family
ID=57547282
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610664342.2A Pending CN106222080A (en) | 2016-08-12 | 2016-08-12 | Pulmonary carcinoma prognoses system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106222080A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109055554A (en) * | 2018-08-24 | 2018-12-21 | 深圳市天元印科技有限公司 | Intestinal cancer DNA methylation detects genetic chip and preparation method thereof and application |
| CN109097472A (en) * | 2018-08-24 | 2018-12-28 | 深圳市天元印科技有限公司 | It can be used for the DNA methylation marker and its detection method, primer pair and kit of intestinal cancer liquid biopsy |
| CN111440866A (en) * | 2019-01-17 | 2020-07-24 | 中山大学附属第六医院 | Application of DUSP3 gene methylation detection reagent in preparation of colorectal cancer prognosis diagnosis reagent |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008087040A2 (en) * | 2007-01-19 | 2008-07-24 | Epigenomics Ag | Methods and nucleic acids for analyses of cell proliferative disorders |
| CN104131071A (en) * | 2014-05-22 | 2014-11-05 | 苏州工业园区为真生物医药科技有限公司 | Gene methylation detection method |
| WO2016071477A1 (en) * | 2014-11-07 | 2016-05-12 | Rheinische Friedrich-Wilhelms-Universität Bonn Institut Für Rekonstruktive Neurobiologie | Methods for assessing the treatment response of cancer patients and for treating cancer patients by analysing cpg methylation |
| WO2016097319A1 (en) * | 2014-12-19 | 2016-06-23 | Epigenomics Ag | METHODS FOR DETECTING CpG METHYLATION AND FOR DIAGNOSING CANCER |
-
2016
- 2016-08-12 CN CN201610664342.2A patent/CN106222080A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008087040A2 (en) * | 2007-01-19 | 2008-07-24 | Epigenomics Ag | Methods and nucleic acids for analyses of cell proliferative disorders |
| CN104131071A (en) * | 2014-05-22 | 2014-11-05 | 苏州工业园区为真生物医药科技有限公司 | Gene methylation detection method |
| WO2016071477A1 (en) * | 2014-11-07 | 2016-05-12 | Rheinische Friedrich-Wilhelms-Universität Bonn Institut Für Rekonstruktive Neurobiologie | Methods for assessing the treatment response of cancer patients and for treating cancer patients by analysing cpg methylation |
| WO2016097319A1 (en) * | 2014-12-19 | 2016-06-23 | Epigenomics Ag | METHODS FOR DETECTING CpG METHYLATION AND FOR DIAGNOSING CANCER |
Non-Patent Citations (2)
| Title |
|---|
| KNEIP ET AL: "SHOX2 DNA Methylation Is a Biomarker for the Diagnosis of Lung Cancer in Plasma", 《JOURNAL OF THORACIC ONCOLOGY》 * |
| SCHNEIDER ET AL: "Correlation of SHOX2 Gene Amplification and", 《BMC CANCER》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109055554A (en) * | 2018-08-24 | 2018-12-21 | 深圳市天元印科技有限公司 | Intestinal cancer DNA methylation detects genetic chip and preparation method thereof and application |
| CN109097472A (en) * | 2018-08-24 | 2018-12-28 | 深圳市天元印科技有限公司 | It can be used for the DNA methylation marker and its detection method, primer pair and kit of intestinal cancer liquid biopsy |
| CN111440866A (en) * | 2019-01-17 | 2020-07-24 | 中山大学附属第六医院 | Application of DUSP3 gene methylation detection reagent in preparation of colorectal cancer prognosis diagnosis reagent |
| CN111440866B (en) * | 2019-01-17 | 2023-08-11 | 中山大学附属第六医院 | Application of DUSP3 gene methylation detection reagent in preparation of colorectal cancer prognosis diagnosis reagent |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11091796B2 (en) | Systems and methods to detect rare mutations and copy number variation | |
| US20240102101A1 (en) | Systems and methods to detect rare mutations and copy number variation | |
| JP6664025B2 (en) | Systems and methods for detecting rare mutations and copy number variations | |
| US10894974B2 (en) | Systems and methods to detect rare mutations and copy number variation | |
| EP2971168B1 (en) | Method of detecting cancer | |
| CN110982907B (en) | Thyroid nodule-related rDNA methylation marker and application thereof | |
| CN110257494B (en) | Method and system for obtaining individual ages of Chinese population and amplification detection system | |
| CN105861644A (en) | DNA methylation marker for prediction of generation risks of lung cancer and detection method and kit thereof | |
| EP2977467A2 (en) | Method, use of marker, and determination device for obtaining information on plural types of cancers | |
| US11913065B2 (en) | Systems and methods to detect rare mutations and copy number variation | |
| US20210355542A1 (en) | Methods and systems for identifying methylation biomarkers | |
| CN106222080A (en) | Pulmonary carcinoma prognoses system | |
| KR102637032B1 (en) | Composition for diagnosing bladder cancer using CpG methylation status of specific gene and uses thereof | |
| IL302988A (en) | Detecting methylation changes in dna samples using restriction enzymes and high throughput sequencing | |
| CN102732516B (en) | Multiplex nested methylation specific PCR (polymerase chain reaction) amplification primer and use method and application thereof | |
| CN102732637B (en) | Multiplex nested methylation specific PCR (Polymerase Chain Reaction) detection kit, using method and application thereof | |
| CN107151708B (en) | Application of DNA binding site CTCF-13 of multifunctional transcription regulatory factor CTCF | |
| CN109097472A (en) | It can be used for the DNA methylation marker and its detection method, primer pair and kit of intestinal cancer liquid biopsy | |
| CN104928370A (en) | Saliva DNA (Deoxyribose Nucleic Acid) methylation marker reflecting cumulative effect of inhalable particles in air and kit | |
| CN107164532B (en) | Application of DNA binding site CTCF-94 of multifunctional transcription regulatory factor CTCF | |
| Kakumani et al. | Identification of CpG islands in DNA sequences using matched filters |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20161214 |