CN1062001A - Utilize the method for silkworm efficient expressing protein of Chinese trichosanthes root and other useful proteins - Google Patents
Utilize the method for silkworm efficient expressing protein of Chinese trichosanthes root and other useful proteins Download PDFInfo
- Publication number
- CN1062001A CN1062001A CN 91110465 CN91110465A CN1062001A CN 1062001 A CN1062001 A CN 1062001A CN 91110465 CN91110465 CN 91110465 CN 91110465 A CN91110465 A CN 91110465A CN 1062001 A CN1062001 A CN 1062001A
- Authority
- CN
- China
- Prior art keywords
- gene
- silkworm
- virus
- fragment
- trichosanthin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The present invention has cloned the fragment that contains polyhedron gene by genetic engineering technique from silkworm nuclear-polyhedrosis virus HB strain isolated, utilize the PCR fixed-point mutation method, has made up new and effective silkworm nuclear-polyhedrosis virus metastasis transplanting physique grain.5 of this plasmid ' and 3 ' hold homologous sequence area less than common metastasis transplanting physique grain, be suitable for engineered operation.The structural integrity of polyhedrin gene promoter helps efficiently expressing.3 ' end has been introduced three cover TAA termination codons, can stop the translation of foreign gene effectively.The intermediary poly-cloning site is suitable for the insertion of foreign gene.The Trichosanthin gene is inserted into this plasmid, and has made up the recombinant bombyx mori nuclear polyhedrosis virus that contains the Trichosanthin gene by a little, and has expressed this gene in the living silkworm of being in.
Description
Utilize the method for silkworm efficient expressing protein of Chinese trichosanthes root and other useful proteins
Genetic engineering technique.The present invention utilizes genetic engineering technique, by novel metastasis transplanting physique grain and the isolating Bombyx mori nuclear polyhydrosis virus HB strain that makes up, and efficient expressing protein of Chinese trichosanthes root in the silkworm body, and then can be used for producing other useful proteins.
Genetically engineered makes utilizes recombinant DNA technology, and producing needed protein of people and medicine etc. in intestinal bacteria, Bacillus subtilus, yeast and mammalian cell becomes possibility.
The baculovirus vector expression system of Jian Liing in recent years, with two kinds of insect viruses, promptly alfalfa californica nuclear polyhedrosis virus and Bombyx mori nuclear polyhydrosis virus are that carrier has in vivo been expressed tens of kinds of foreign genes at insect cell culture and insect.And the foreign protein that confirms this system expression possesses natural character, can be used as detection reagent, medicine, vaccine etc.
Existing result of study shows that though be subjected to influence of various factors in the efficient of silkworm expression in vivo foreign gene, production useful proteins, wherein most critical is the structure that is used for construction of recombinant virus, supplies the metastasis transplanting physique grain of foreign gene insertion.In metastasis transplanting physique grain, the integrity of polyhedrin promotor gene can make expression efficiency differ several times even tens times.And the sequence in polyhedron gene downstream is also influential to the termination of transcription of foreign genes and translation.The metastasis transplanting physique grain of particularly existing Bombyx mori nuclear polyhydrosis virus carrier is not perfect.
The present invention adopts emerging round pcr, oligonucleotide primer by synthetic has carried out fixed point transformation to the flanking sequence of the polyhedron gene of being cloned, volume is except the entire infrastructure Gene Partial, complete 5 ' end and 3 ' terminal sequence have been kept, and inserted suitable poly joint, make the transfer vector of new structure be in perfect condition, guaranteed foreign gene under the control of this complete promotor, can obtain to efficiently express.And in 3 ' end downstream sequence, introduced three cover terminator codon TAA, no matter whether foreign gene contains termination codon, expresses all can stop effectively in this carrier.
Thereby the present invention is intended to improve and utilize Bombyx mori nuclear polyhydrosis virus in silkworm expression in vivo expression of exogenous gene efficient by making up the ideal metastasis transplanting physique grain.
Bombyx mori nuclear polyhydrosis virus is the pathogenic agent of silkworm blood type pus illness, and this virus belongs to the A subgroup of Rhabdoviridae.In the open air should a virus infected silkworm, a few insect such as wild silkworm, Semen Ricini silkworm.Wild-type bombyx mori nuclear polyhedrosis virus has many strain isolateds, and their polyhedron form is different with restriction endonuclease map.It is material that the present invention selects to form the polyhedrosis HB strain isolated of square, this strain isolated not only polyhedron greater than general sexangle polyhedron, and expansion very, these characteristics provide the foundation for making up efficient expression vector.The constructing plan of its expression vector is as follows:
The polyhedrin structural gene of known Bombyx mori nuclear polyhydrosis virus is positioned at this viral genome EcoR I 10.6kb fragment.This fragment can be by making up the gene library of Bombyx mori nuclear polyhydrosis virus, and screening obtains from the library.
By bacterium colony in situ hybridization, experimental methods of molecular biology commonly used such as Southern hybridization can be analyzed, identify resulting purpose fragment.And then, carry out agarose gel electrophoresis with behind a series of digestion with restriction enzyme, can draw out this segmental restriction enzyme mapping.(5 ' end) has an Xho I site in the polyhedrin structural gene upstream, and downstream (3 ' end) has a BamH I site.Lay respectively at upstream 1.8Kb and downstream 1.3Kb.Comprise structure gene, this Xho I-segmental size of BamH I is 3.8Kb.From EcoR I 10.6Kb fragment, can further be cloned into this Xho I-BamH I 3.8Kb fragment.
Utilize chain termination method that polyhedrin structural gene and zone, upstream and downstream are carried out sequential analysis, the encoding sequence that records the polyhedrin structural gene of HB strain isolated is 738bp, in addition from upstream-196bp to the downstream+the 750bp scope in the base sequence of total 4bp variation has taken place.
With the above-mentioned Xho I-BamH I 3.8Kb fragment that is cloned in Xho I/BamH I site of vector plasmid Bluescript is template, according to polyhedron gene structure gene upstream of measuring and the synthetic a pair of primer of downstream sequence, and with universal primer T
7And T
3Match with it, increase respectively 5 of polyhedrin structural gene ' end 1.8Kb and 1.3Kb zone, downstream, in the primer of synthetic, introduced Hind III and Xba I point of contact respectively, and made the atg start codon ATG of former polyhedron gene change AAGCTT(Hind III point of contact into); And added three cover terminator codon TAA in the downstream of 3 ' end primer Xba I.30 round-robin amplifications obtain polyhedron gene upstream 1.8Kb fragment a and downstream 1.3Kb fragment b respectively through the polymerase chain reaction.Fragment a and b are cut with Xho I, Hind III enzyme; Fragment b cuts with Xba I and Sac I enzyme, clones respectively in the Xho of Bluescript I/Hind III and Xba I/Sac I point of contact.
Xho I/Hind III 1.8Kb the fragment of amplification contains complete polyhedrin gene promoter, and Xba I/Sac I 1.3Kb fragment contains the polyhedron gene transcription termination signal and overlaps translation stop codon by three of the synthetic introducing of primer.Then, the Xba I point of contact from the Xho I to Bluescript (contains fragment and a) downcuts, be cloned into upstream Xho I/Xba I site of fragment b, be complete Bombyx mori nuclear polyhydrosis virus metastasis transplanting physique grain.This carrier possesses:
(1) complete promoter sequence
(2) 3 ' end Transcription Termination and translation termination signal
(3) can clone joint for Hind III, EcoR V, EcoR I, Pst I, Sma I, BamH I, Spe I, Xba I poly that foreign gene inserts.
(4) polyhedron gene 5 ' end and 3 ' end flanking sequence can be made homologous recombination.
This metastasis transplanting physique grain is optimal Bombyx mori nuclear polyhydrosis virus metastasis transplanting physique grain, can be for inserting the various foreign genes that contain restriction enzyme sites such as Hind III, EcoR V, EcoR I, Pst I, Sma I, BamH I, Spe I, Xba I in the gene both sides.
Being cloned in vector plasmid PGEM3z(f-) the Trichosanthin gene at Hinc II point of contact downcuts with Hind III, Xba I, is connected to Hind III, the Xba I site of above-mentioned metastasis transplanting physique grain, and its direction is consistent with the transcriptional orientation of polyhedrin gene promoter.
After inserting the recombinant transfer vector plasmid amplification of Trichosanthin gene, available cesium chloride density gradient centrifugation, DNA purification process commonly used such as sepharose (Sepharose-4B) column chromatography purification or PEG-8000 precipitation carry out purifying.The recombinant plasmid dna of purifying and silkworm nuclear-polyhedrosis virus HB strain DNA are by the method cotransfection silkworm cultured cell Bm-N of calcium phosphate precipitation, enter intracellular wild-type virus DNA in reproduction process, with the homologous viral DNA sequence generation homologous recombination on the recombinant plasmid, can obtain to contain the recombinant virus of Trichosanthin gene.The chance of this reorganization is very low, and 0.1-1% is only arranged.Recombinant virus and wild virus can be according to having or not this form sign of polyhedron, with the plaque method screen, purifying, obtain recombinant virus.Recombinant virus is identified with methods such as dot hybridization, Southern hybridization, pcr amplification Trichosanthin genes.
Silkworm passage cell or tame living silkworm with recombinant virus infection is cultivated are infecting later stage, the foreign gene of insertion (Trichosanthin gene) great expression under the control of polyhedrin gene promoter.Expression product can separate with the protein method of multiple routine, purifying.
Utilize the constructed metastasis transplanting physique grain of the present invention, except that the foreign protein that can express this class plant origin of Trichosanthin, also can be used for expressing other various bacteriums, virus, animal and plant gene.
The material that the present invention selects for use is a Bombyx mori nuclear polyhydrosis virus HB strain isolated, and its polyhedron form is a square, big and expansion, and the promoter activity of this polyhedron gene is higher than common silkworm nuclear-polyhedrosis virus.
The constructed metastasis transplanting physique grain 5 ' end virus sequence of the present invention is 1.8Kb, less than common silkworm nuclear-polyhedrosis virus transfer vector.Its promotor part-structure is complete.3 ' end virus sequence is 1.3Kb, contains three cover translation termination signal TAA.The intermediary poly-cloning site has comprised 7 kinds of restriction endonuclease sites commonly used.Therefore, this carrier has expression efficiency height, easy to operate, the various expression of exogenous gene that are suitable for having or not having the translation termination signal.
Utilize tame its cost of living silkworm expression alien gene to be lower than the culturing cell system, and do not need special instrument, equipment.Silkworm is raised with a long history, technology in China and popularizes, so present technique is promoted easily, popularize.The host domain of Bombyx mori nuclear polyhydrosis virus is narrow, and the virus that contains foreign gene of reorganization can not form polyhedron, the very easy inactivation of virus of no polyhedron protection, so the good safety performance of tool in the open air.
Embodiment
(1) silkworm hemolymph of the separated and collected silkworm nuclear-polyhedrosis virus of the extraction of viral DNA and polyhedron gene infection, through low-speed centrifugal (5000 rev/mins), precipitation (for polyhedron) suspends with 0.1%SDS, centrifugal again (the same terms), so repeat 5 times, suspend with redistilled water at last.Add isopyknic 0.1mol/1 Na in the polyhedrosis suspension in above-mentioned containing
2CO
3With 0.05mol/1 NaCl, put 1 hour on ice, make the polyhedron dissolving.Then use equal-volume phenol, phenol/chloroform/different luxuriant alcohol (25: 24: 1), chloroform/each extracting of different luxuriant alcohol (24: 1) once.The 3mol/1 KAc(PH 4.8 that adds 1/10th volumes at last) and 2.5 times of volume ethanol, put-20 ℃ 30 minutes, centrifugal 10 minutes with 12000 rev/mins, abandon supernatant, add 70% ethanol and wash once, vacuum is drained, precipitation is dissolved in TE, and the content that makes viral DNA is 0.1 μ g/ μ l.This viral DNA solution can be used for that enzyme is cut or the infection of silkworm cultured cell.
With above-mentioned viral DNA restriction enzyme complete degestion, be connected with the Bluescript that same enzyme is cut then, transformed into escherichia coli DH5 α contains on selective medium and inserts the formed bacterium colony of segmental recombinant plasmid for white.White colony is done bacterium colony in situ hybridization, with
32The common silkworm nuclear-polyhedrosis virus polyhedron gene of P-dATP mark is a probe, and the polyhedrosis virus of screening acquisition HB strain system contains the EcoR I fragment of polyhedron gene.To hybridize the male bacterium colony and choose, and prepare plasmid DNA fast, EcoR I enzyme is cut inspection, confirms that it inserts clip size is 10.6Kb.Recombinant plasmid is cut with EcoR I enzyme, done Southern hybridization, adopt identical probe, further confirm in the insertion fragment of 10.6Kb, to contain polyhedron gene.To contain 10.6Kb and insert segmental recombinant plasmid called after pOCU102.
(2) location of polyhedron gene and structural analysis with plasmid pOCU102 with EcoR I, BamH I, Xho I, Pst I, Xba I, Hind III make single enzyme, two enzyme enzyme is cut, and draw to insert segmental physical map.Result's (seeing accompanying drawing 1) compares with the respective segments that has common Bombyx mori nuclear polyhydrosis virus, has increased an Xho I point of contact in this sheet.Further use Xho I/BamH I double digestion pOCU102, and connect, get the plasmid pOCUXB that only contains Xho I-BamH3.8Kb.Further utilize Xba I, Nde I, the Hind III point of contact of this fragment internal memory, make subclone, get subclone pXUB2, pSUB22, pSUB40, pSUB-62, pSUB80, pSUB71, they are carried out sequential analysis, and its result obtains complete sequence and 5 ' end and the 3 ' end flanking sequence (seeing accompanying drawing 2) of polyhedron gene.In 5 ' end promotor gene scope, there are 2 Nucleotide that variation has taken place, structure gene also has 2 Nucleotide to change, but has only a change that causes amino acid sequence coded.
(3) the upstream and downstream sequence of pcr amplification polyhedron gene is according to the result of sequential analysis, synthetic a pair of oligonucleotide primer a and b, its sequence is respectively:
a:5′TAAGCTTATTTATAGGTTTTTTTATT3′
b:5′TTCTGAGTGATTAAAACACTATACATTG3′
Make up polyhedron gene 5 ' end and 3 ' terminal sequence of amplification pOCUXB respectively with a and b with universal sequencing primer thing T7 and T3 in addition.The pcr amplification condition is: template DNA 1 μ g, primer 2 5pmol, dNTP 2.4mmol/l, 300mmol/l KCl, 1mmol/l DTT, 0.1mmol/l EDTA, 67mmol/l TrisHCl(PH8.8) and 6.7mmol/l MgCl
2, temperature of reaction for annealing 45 ℃ 45 seconds; 65 ℃ of extensions 2 minutes; 93 ℃ of sex change 30 seconds.Through 30 round-robin amplifications, each get the upstream sequence a of 1.8Kb and the downstream sequence b of 1.3Kb.
(4) will increase resulting two fragment a and b of the structure of transfer vector uses restriction enzyme Xho I/Hind III and Xba I/Sac I enzyme to cut respectively, and is cloned into the corresponding site of Bluescript, two middle interstitial granules pBma and pBmb.Do the sequence analysis then, confirm that amplified production is consistent with the sequence of designed primer, and all the other are viral original sequence.The insertion fragment of pBma is downcut with Xho I and Xba I, be connected, promptly get pBmAB with the pBmb that same enzyme is cut.This plasmid possesses upstream and downstream sequence and restriction endonuclease sites Hind III, EcoR V, EcoR I, Pst I, Sma I, BamH I, Spe I and the Xba I (seeing accompanying drawing 3) of polyhedron gene.
(5) the insertion Trichosanthin gene of Trichosanthin gene is with the fragment of PCR method isolating 815bp from draw together the building genomic dna, is cloned in pGEM3Z(f-) Hind II site.This gene is downcut with Hind III and Xba I, and directed cloning is to Hind III/Xba I site of pBmAB.Method therefor has recovery, the connection of dna fragmentation, transforms etc., is the molecular biology ordinary method.Recombinant plasmid is identified the existence that confirms the Trichosanthin gene through digestion with restriction enzyme, and direction is consistent with the transcriptional orientation of promotor gene.Extract recombinant plasmid then in a large number, adopt the alkaline process extracting, with column chromatography (Shepharose-4B) plasmid DNA purification, TE wash-out.The plasmid DNA of purifying is used for the cotransfection insect cell culture.
(6) the aforementioned viral HB strain isolated DNA of the transfection of silkworm cultured cell mixes with molecular ratio with recombinant plasmid dna at 1: 100, disposes following solution:
I, redistilled water 2.1ml
Silkworm nuclear-polyhedrosis virus DNA 50 μ l(5 μ g)
Recombinant plasmid dna 50 μ l(50 μ g) 2mol/l CaCl
2300 μ l
II, 50mmol/l HEPES damping fluid (PH7.1) contain
0.28mol/l NaCl
Phosphoric acid buffer (35mmol/l Na
2HPO
4, 35mmol/l NaH
2PO
4) 50 μ l
Above-mentioned solution I and II are mixed, and visible oyster white calcium phosphate precipitation joins in the silkworm cultured cell then, and its viral DNA and plasmid DNA are imported in the cell simultaneously.In 28 ℃ of maintenances 4 hours, wash once with nutrient solution TC100, the nutrient solution that renews then (TC100 contains 10% foetal calf serum), in 28 ℃ of cultivations 4~6 days, cell was by virus infection death, and the formation polyhedron.
(7) dilution of the nutrient solution of plaque select and the above-mentioned transfectional cell of plaque purifying 10
4, infect the silkworm cultured cell of monolayer culture, and cultivate with the solid medium that contains 1% low melting point agarose, form plaque after 5 days, select no polyhedrosis plaque at microscopically, and use and carry out 4 with quadrat method and take turns the plaque purifying, must pure recombinant virus.
Breed recombinant virus in culturing cell, differential centrifugation gets virus particle, handles and phenol extracting viral DNA with Proteinase K, identifies with PCR method whether recombinant virus contains the Trichosanthin gene.The primer is 5 of Trichosanthin gene ' end and 3 ' end primer, is contrast with aforementioned Bombyx mori nuclear polyhydrosis virus DNA also, increases, and recombinant virus can amplify the fragment of 0.8Kb as a result, and wild virus does not have this fragment.Confirm that recombinant virus contains the Trichosanthin gene.
(8) the Trichosanthin gene is in expression in the living silkworm with 10
5PFU(plaque forming unit) recombinant virus injection silkworm plays silkworm 5 ages, collects the polypide hemolymph after 5 days, and is contrast with the wild virus.The hemolymph 5 μ l of recombinant virus and wild virus infection silkworm do the gel electrophoresis of SDS-PAGE(polyacrylamide) analyze, in the recombinant virus infection silkworm hemolymph Trichosanthin specific band is arranged as a result.Make Western blotting with the rabbit anti-serum of Trichosanthin, confirm that the band that is increased is an expression product.Through the UV scanning integral and calculating, the expression amount of Trichosanthin accounts for about 5% of silkworm body hemolymph total protein concentration.
Description of drawings
Fig. 1, I: the segmental physical map of Bombyx mori nuclear polyhydrosis virus EcoR I 10.6kb that contains polyhedron gene
II: the physical map of Xho I in the above-mentioned fragment-BamH I 3.8kb
III: the structure that contains each subclone of polyhedron gene and flanking sequence thereof
Letter r I among the figure: EcoR I; Ph: polyhedron gene;
H:HindⅢ;X:XhoⅠ;P:PstⅠ;Xb:XbaⅠ;Hp:HpaⅠ;N:NdeⅠ
Fig. 2, Bombyx mori nuclear polyhydrosis virus HB strain isolated polyhedrin structural gene and part flanking sequence thereof
Fig. 3, I: the Xho I of the pcr amplification-segmental zone of BamH I
II: the structure of clonal expansion product pBma and pBmb
III: the structure of the metastasis transplanting physique grain pBmAB of Bombyx mori nuclear polyhydrosis virus, capitalization are virus figure row, and lowercase is the sequence of poly-cloning site in the carrier
Claims (5)
- The invention belongs to the genetically engineered field, be a kind of be carrier with the Bombyx mori nuclear polyhydrosis virus, utilize silkworm expression Trichosanthin and other method of useful proteins.It is characterized in that utilizing the novel Bombyx mori nuclear polyhydrosis virus vector plasmid of structure, by in culturing cell, carrying out homologous recombination with the wild-type silkworm nuclear-polyhedrosis virus, obtain recombinant virus, be difficult to a large amount of Trichosanthins that obtain at silkworm expression in vivo nature.Present method is suitable for utilizing expresses other foreign genes with quadrat method.Claim is:1, the EcoRI10.6kb fragment and the XhoI-BamHI3.8kb fragment that contain Bombyx mori nuclear polyhydrosis virus HB strain isolated polyhedron gene, and extend and a series of subclone fragments of coming by the XhoI-BamHI fragment.
- 2, two the fragment a that contain polyhedron gene 5 ' terminal sequence and 3 ' terminal sequence and the b of pcr amplification.
- 3, Bombyx mori nuclear polyhydrosis virus metastasis transplanting physique grain pBmAB.
- 4, inserted the recombinating silkworm nucleus multiple the body of angle virus metastasis transplanting physique grain of Trichosanthin gene.
- 5, the recombinating silkworm nucleus multiple the body of angle virus that contains the Trichosanthin gene.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 91110465 CN1062001A (en) | 1991-11-12 | 1991-11-12 | Utilize the method for silkworm efficient expressing protein of Chinese trichosanthes root and other useful proteins |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 91110465 CN1062001A (en) | 1991-11-12 | 1991-11-12 | Utilize the method for silkworm efficient expressing protein of Chinese trichosanthes root and other useful proteins |
Publications (1)
Publication Number | Publication Date |
---|---|
CN1062001A true CN1062001A (en) | 1992-06-17 |
Family
ID=4910107
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 91110465 Pending CN1062001A (en) | 1991-11-12 | 1991-11-12 | Utilize the method for silkworm efficient expressing protein of Chinese trichosanthes root and other useful proteins |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN1062001A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1053700C (en) * | 1994-01-24 | 2000-06-21 | 南京大学 | Recombination of human macrophage colony stimulating factor by domestic silkworm gene engineering |
-
1991
- 1991-11-12 CN CN 91110465 patent/CN1062001A/en active Pending
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1053700C (en) * | 1994-01-24 | 2000-06-21 | 南京大学 | Recombination of human macrophage colony stimulating factor by domestic silkworm gene engineering |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5194376A (en) | Baculovirus expression system capable of producing foreign gene proteins at high levels | |
CN86102277A (en) | Cloning restriction gene and modification property gene | |
WO1990010078A1 (en) | Improved baculovirus expression system capable of producing foreign gene proteins at high levels | |
CN111849979B (en) | sgRNA for targeted knockout of RPSA gene and construction method of RPSA gene knockout cell line | |
CN106987560B (en) | Construction method of RK-13 cell HBB gene knockout stable strain | |
CN102031263B (en) | Method for preparing human DNA polymerase delta by using bombyx mori bioreactor | |
CN113430181B (en) | Bacterial laccase derived from Asian elephant intestinal metagenome and gene thereof | |
Idriss et al. | Biotypes of the castor bean whitefly Trialeurodes ricini (Misra)(Hom., Aleyrodidae) in Egypt: biochemical characterization and efficiency of geminivirus transmission | |
KR930000273B1 (en) | Method for producing useful substances | |
CN102286534B (en) | Insect bioreactor capable of expressing multiple exogenous genes, and construction method and application thereof | |
CN1062001A (en) | Utilize the method for silkworm efficient expressing protein of Chinese trichosanthes root and other useful proteins | |
WO2023045682A1 (en) | Method for increasing soluble expression quantity of polypeptide | |
CN102086450B (en) | Immunoaffinity chromatography column and method for separating and purifying high-enzyme living human DNA polymerase delta | |
LEE et al. | Properties and capsid protein gene sequence of a Korean isolate of barley mild mosaic virus | |
CN108998435A (en) | A kind of preparation method of thermal stability chitosan enzyme | |
CN1239699C (en) | Method for construction of bombyx mori virus fast gene expression system utilizing bacterium transposon | |
CN112661818A (en) | Canine and cat parvovirus VP2350-420Protein and preparation method and application thereof | |
CN104894115A (en) | Aspergillus terreus strain with efficient homologous recombination capacity, and construction method and application thereof | |
Seal et al. | Isolation of caliciviruses from skunks that are antigenically and genotypically related to San Miguel sea lion virus | |
CN105018452B (en) | Streptokinase QK genes and recombinant expression carrier, recombinant bacterium and application containing the gene | |
Wu et al. | An innovative technique for inoculating recombinant baculovirus into the silkworm Bombyx mori using lipofectin | |
CN1093175C (en) | New structured L-asparaginase engineering bacterium and its production culture | |
CN114854778B (en) | Fucoidan gene Fcn1 and application thereof | |
CN1016796B (en) | Process of producing useful substances | |
CN100453648C (en) | The pET15b-PEP-1-Cat plasmid and its construction and PEP-1-CAT fusion protein and its expression |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C06 | Publication | ||
PB01 | Publication | ||
C01 | Deemed withdrawal of patent application (patent law 1993) | ||
WD01 | Invention patent application deemed withdrawn after publication |