CN106190958A - The amyotrophy model of process LAN Dkk-3 induction and application thereof - Google Patents
The amyotrophy model of process LAN Dkk-3 induction and application thereof Download PDFInfo
- Publication number
- CN106190958A CN106190958A CN201510215820.7A CN201510215820A CN106190958A CN 106190958 A CN106190958 A CN 106190958A CN 201510215820 A CN201510215820 A CN 201510215820A CN 106190958 A CN106190958 A CN 106190958A
- Authority
- CN
- China
- Prior art keywords
- amyotrophy
- dkk
- cell
- model
- muscle
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention provides the new application of a kind of Dkk-3, and Dkk-3 is used for the transmission atrophy of induced muscle cell, successfully construct amyotrophy cell model and amyotrophy animal model.The amyotrophy cell model of the present invention and animal model have amyotrophic typical characteristic, can amyotrophic in analogue body admirably develop, it is amyotrophy basis and the preferable cell model of clinical application research and animal model, screening can be well applied to and treat amyotrophic medicine.
Description
Technical field
The present invention relates to biological technical field, be specifically related to amyotrophy model and the application thereof of process LAN Dkk-3 induction.
Background technology
Current muscular atrophy cell model is mainly prepared by serum starvation, and its simulation is the flesh in the case of malnutrition
Meat atrophy, but the amyotrophy caused due to malnutrition in modern society only accounts for ratio the least in muscular dystrophy patient,
Most amyotrophy including old and feeble related muscles atrophy are not caused by malnutrition.Prepare old and feeble phase
Close the simulation of amyotrophic cell, the muscle fiber of terminal differentiation can only be directly separated at present from mouse aging muscle.This side
Method is the longest, need at least be raised by mice 1 year.Concordance is poor, owing to mice exists individual variation, the same age
Mice, there is bigger difference in its amyotrophic degree.3 can only be cultivated in vitro from the internal muscle fiber being directly separated
-5 days, reuse and must separately take new mice and separate.And due to the individual variation between mice, it is difficult to ensure that from difference
The concordance of the myofibrillar atrophy degree being separated in individuality, thus hinder the concordance of the experiment using this system.
The most conventional amyotrophy animal model is mainly obtained by restriction feed, and its simulation is in the case of malnutrition
Amyotrophy.As described above, the amyotrophy that malnutrition causes is the lowest in modern society's incidence rate, it is impossible to simulation declines
Uneducated person closes amyotrophy.Another method obtaining old and feeble related muscles atrophy animal model is after the Animal Agings such as Long-term breeding
Use as model.This method is the longest, as described above, owing to individual variation causes concordance very poor, thus drops
The repeatability of low medicament screening experiment.
Dkk-3 is a member of Dickkopf protein family, belongs to exocytosis albumen.Current research does not the most find Dkk-3
Whether existence is occurred to associate with amyotrophic.
Summary of the invention
In order to overcome defect of the prior art, the invention provides the new application of a kind of Dkk-3, and be used for luring by Dkk-3
Lead muscle generation atrophy, successfully construct amyotrophy cell model and amyotrophy animal model.The amyotrophy of the present invention
Cell model and animal model have amyotrophic typical characteristic, can amyotrophic in analogue body admirably develop,
It is amyotrophy basis and the preferable cell model of clinical application research and animal model, screening treatment flesh can be well applied to
The medicine of meat atrophy.
The present invention is achieved by the following technical solutions:
A first aspect of the present invention, it is provided that Dkk-3 use in the medicine preparing induced muscle cell generation atrophy or preparation
On the way.
Preferably, described muscle cell is the muscle cell of terminal differentiation.
Preferably, described medicine or preparation are additionally operable to reduce diameter or the cross-sectional area of myotube in muscle cell.
Preferably, described medicine or preparation are additionally operable to raise in muscle cell the amyotrophy labelling bases such as Atroign1 and Murf1
The expression of cause.
A second aspect of the present invention, it is provided that Dkk-3 is in building amyotrophy cell model or amyotrophy animal model
Purposes.
A third aspect of the present invention, it is provided that a kind of method building amyotrophy cell model, described method includes following step
Rapid: the Dkk-3 of process LAN effective dose in muscle cell；Obtain amyotrophy cell model.
Preferably, described muscle cell is the muscle cell of terminal differentiation.
Preferably, the muscle cell of described terminal differentiation is selected from following arbitrary:
(1) formed by muscle precursor cell, primary Muscle progenitor cells or stem cell differentiation；
(2) by the myotubes of internal muscle isolated terminal differentiation.
In the preferred embodiment of the present invention, the muscle cell of described terminal differentiation is formed by muscle precursor cell differentiation.Described flesh
Meat precursor is selected from muscle precursor cell system, such as C2C12 cell.
It is furthermore preferred that the muscle cell of described terminal differentiation is that muscle precursor cell uses division culture medium cultivate 2～4 days,
Induction differentiation forms.Optimum incubation time is 3 days.
Preferably, the method for the Dkk-3 of described process LAN effective dose is: use the fresh differentiation containing Dkk-3 adenovirus
Culture medium, cultivates the muscle cell of terminal differentiation；Described Dkk-3 adenovirus can the Dkk-K3 of process LAN effective dose.
In the preferred embodiment of the present invention, the Dkk3 adenovirus final titre in division culture medium is 6x106～26x106TU；
Incubation time is 24～96 hours.The whole titre of most preferably Dkk-3 adenovirus is: 26x106TU/ml；Incubation time is 72
Hour.
A fourth aspect of the present invention, it is provided that the amyotrophy model built by preceding method purposes in screening of medicaments.
A fifth aspect of the present invention, it is provided that a kind of screen the method treating amyotrophic drug candidate, described method includes
Following steps: will test drug candidate be applied to by preceding method build obtain amyotrophy cell model, and with do not use
Test drug candidate amyotrophy cell model compare, cause after wherein using muscle wasting symptoms improve or cure
Test compound treats amyotrophic drug candidate exactly.
The above-mentioned drug candidate filtered out may make up a screening storehouse, these materials can carry out further cell experiment, move
Thing experiment and/or clinical trial, to confirm the treatment amyotrophy effect of described potential material further.
Owing to the present invention uses process LAN Dkk-K3 to induce, constructed model is more closely similar to the pathogenic process of the mankind, and one
Cause is high, it is to avoid the heterogeneity caused due to individual variation, thus the most accurate with conventional model in the screening of medicine,
In hgher efficiency.
A sixth aspect of the present invention, it is provided that a kind of method building amyotrophy animal model, described method includes following step
Rapid: to the Dkk-3 of mammal process LAN effective dose；Obtain amyotrophy animal model.
Preferably, described mammal is Mus.More preferably mice.
Preferably, the method used described in is local intramuscular injection.
Preferably, method particularly includes: continuously a couple of days, to mammal by the way of lower limb tibialis anterior local injection, use
After the Dkk-K3 adenovirus of effective dose, raise a couple of days.
In the preferred embodiment of the present invention, method particularly includes: by the way of lower limb tibialis anterior local injection, use to mice
1x109-6.5x1012The Dkk-3 adenovirus of Tu/kg body weight, often injects once, after injecting continuous 3～10 times altogether, raises
5～15 days.
It is furthermore preferred that method particularly includes: by the way of lower limb tibialis anterior local injection, use 3.5x10 to mice10Tu drips
The Dkk-3 adenovirus of degree/kg body weight, injects once, after co-continuous injection 7 times, carry out raising 7 days every day.
A seventh aspect of the present invention, it is provided that by the use in screening of medicaments of the amyotrophy animal model constructed by preceding method
On the way.
A eighth aspect of the present invention, it is provided that a kind of screen the method treating amyotrophic drug candidate, described method includes
Following steps: test drug candidate is applied to the amyotrophy animal model that built by preceding method, and with do not use test
The amyotrophy animal model of drug candidate compares, and causes the test that muscle wasting symptoms improves or cures after wherein using
Compound treats amyotrophic drug candidate exactly.
The above-mentioned drug candidate filtered out may make up a screening storehouse, these materials can carry out further cell experiment, move
Thing experiment and/or clinical trial, to confirm the treatment amyotrophy effect of described potential material further.
Owing to the present invention uses the mode of process LAN Dkk-3 to induce, constructed model is more closely similar to the morbidity of the mankind
Journey, thus the most accurate with conventional model in the screening of medicine, in hgher efficiency.
The beneficial effects of the present invention is:
(1) the invention firstly discloses process LAN Dkk-3 can induced muscle cell generation atrophy, be more closely similar to the mankind send out
Sick process.
(2) amyotrophy cell model and the animal model of the present invention has amyotrophic typical characteristic, can simulate admirably
Internal amyotrophic develop, be amyotrophy basis and the preferable cell model of clinical application research and animal model,
Thus screening can be well applied to and treat amyotrophic medicine.
Accompanying drawing explanation
Fig. 1: process LAN Dkk-3 causes amyotrophy in myotube.
Figure 1A: compared with blank group, after the process LAN Dkk-3 with Flag label, the diameter of myotube is notable
Reduce.
Figure 1B: statistical analysis shows, after process LAN Dkk-3, myotube diameter is substantially reduced.
Fig. 1 C: detect the process LAN level in myotube of the Dkk-3 with Flag label by Western blot.
Fig. 2: real-time quantitative fluorescence PCR shows, after process LAN Dkk-3, amyotrophic marker gene Atroign1 (left)
Substantially raise with the expression relatively matched group of MuRF1 (right), after showing process LAN Dkk-3, cause amyotrophy.
Fig. 3: amyotrophic degree after process LAN Dkk-3 different time in myotube.
Fig. 3 A: process LAN Dkk-3 different time is to amyotrophic influence degree in the C2C12myotube broken up:
After process LAN 2 days, experimental group myotube starts to attenuate, and after process LAN 3 days, compared with matched group, myotube is straight
Footpath substantially attenuates.
Fig. 3 B: different time statistics myotube diameter after process LAN.It will be seen that compared with matched group, first day without bright
Aobvious change；Within second day, experimental group slightly attenuates；Within 3rd day, substantially attenuate.Scale bar:200 μm.
Fig. 4: internal process LAN Dkk-3 causes amyotrophy.
After Fig. 4 A: murine TA muscle injects the adenovirus of 7 days process LAN Dkk-3 continuously, then after raising 7 days.Take TA
Muscle, does and takes pictures under frost traverse section, fluorescence microscope, and result shows compared with matched group, experimental group diameter of muscle fiber
Substantially diminish.
Fig. 4 B: by statistics diameter of muscle fiber, show that experimental group muscle fiber may be significantly smaller compared with matched group.Sacle bar:
100μm。
Detailed description of the invention
The present invention passes through extensively in-depth study, it was unexpectedly found that, process LAN Dkk-3 can be used in being successfully established flesh
Meat atrophic cells model and amyotrophy animal model.Described amyotrophy cell model and amyotrophy animal model have flesh
The typical characteristic of meat atrophy, can simulate amyotrophic development well as model.Meanwhile, described cell model
Apply also for screening choosing with animal model and treat amyotrophic drug candidate.Complete the present invention on this basis.
Described amyotrophy is the disease of a kind of mammal, and it mainly shows as following part or all of feature:
Myotube diameter substantially diminishes, and the mrna expression level of Atroign1 and Murf1 raises.
Specifically, the present inventor uses the mode of process LAN Dkk-3 to set up amyotrophy cell and animal model, to cell
Model and animal model carry out related biological test, and finishing screen is chosen a kind of Myotube diameter and substantially diminished, Atroign1
The amyotrophy cell model raised with the mrna expression level of Murf1 and animal model.
Described amyotrophy cell model phenotype is stable, and the morphological characteristic under light microscopic, Electronic Speculum and amyotrophy tissue one
Cause.Show under light microscopic, there is the feature that Myotube diameter substantially diminishes.Immunohistochemical analysis shows, Atroign1 and Murf1
MRNA high expressed.Experiment of Zoology shows, its histopathology form is consistent with amyotrophy tissue.
Dkk-3 is belonging to the member of Dickklof protein family, is intracellular generation, the protein molecular being secreted into outside born of the same parents.
The new application of Dkk-3
The present invention provides the purposes in the Dkk-3 medicine preparing induced muscle cell generation atrophy or preparation.
Described muscle cell is the muscle cell of terminal differentiation.
Described medicine or preparation are additionally operable to reduce diameter or the cross-sectional area of myotube in muscle cell.
Described medicine or preparation are additionally operable to raise the expression of Atroign1 and Murf1 in muscle cell.
Present invention also offers Dkk-3 purposes in building amyotrophy cell model or amyotrophy animal model.
Structure of amyotrophy cell model and application thereof
The amyotrophy cell model construction method of the present invention, comprises the following steps: process LAN effective dose in muscle cell
Dkk-3；Obtain amyotrophy cell model.
Described muscle cell is the muscle cell of terminal differentiation.
The muscle cell of described terminal differentiation is selected from following arbitrary:
(1) formed by muscle precursor cell, primary Muscle progenitor cells or stem cell differentiation；
(2) by the myotubes of internal muscle isolated terminal differentiation.
In the preferred embodiment of the present invention, the muscle cell of described terminal differentiation is formed by muscle precursor cell differentiation.Described flesh
Meat precursor is selected from muscle precursor cell system, such as C2C12 cell.
It is furthermore preferred that the muscle cell of described terminal differentiation is that muscle precursor cell uses division culture medium cultivate 2～4 days,
Induction differentiation forms.Optimum incubation time is 3 days.
The method of the Dkk-3 of described process LAN effective dose is: use the fresh division culture medium containing Dkk-3 adenovirus,
Cultivate the muscle cell of terminal differentiation；Described DKkk-3 adenovirus can the Dkk-3 of process LAN effective dose.
In the preferred embodiment of the present invention, the whole titre in division culture medium of Dkk-3 adenovirus is 6x106～26x106TU；
Incubation time is 24～96 hours.The final titre of most preferably Dkk-3 adenovirus is: 26x106TU/ml；Incubation time is
72 hours.
After process LAN Dkk-3 induces, the present inventor utilizes the index that muscle-wasting diseases is relevant to verify and sets up model
Success or not.Checking finds, after using process LAN Dkk-3 to induce, Myotube myotube diameter substantially diminishes, Atroign1
Raise with the mrna expression level of Murf1.These indexs comprehensive understand, after the present inventor process LAN Dkk-3 induces
Successfully construct amyotrophy cell model.
Process LAN Dkk-3 of the present invention successfully constructs amyotrophy cell model after inducing, described model has many-side
Application.
For example, it is possible to for the pathogenesis studied and illustrate on amyotrophic cell or even molecular level.
Apply also for treating the screening of amyotrophic medicine.
Screening new drug
Therefore, the invention provides a kind of method screened and treat amyotrophic drug candidate, described method includes following step
Rapid: test drug candidate to be applied to the amyotrophy cell model built by preceding method, and tests candidate's medicine with not using
The amyotrophy cell model of thing compares, and causes the test compound that muscle wasting symptoms improves or cures after wherein using
It is exactly to treat amyotrophic drug candidate.
The above-mentioned drug candidate filtered out may make up a screening storehouse, these materials can carry out further cell experiment, move
Thing experiment and/or clinical trial, to confirm the treatment amyotrophy effect of described potential material further.
Owing to the present invention uses process LAN Dkk-3 to induce, constructed model is more closely similar to the pathogenic process of the mankind, because of
And more accurate than conventional model in the screening of medicine, in hgher efficiency.
Structure of amyotrophy animal model and application thereof
The amyotrophy animal model constructing method of the present invention, comprises the following steps: to mammal process LAN effective dose
Dkk-3；Obtain amyotrophy animal model；
In the present invention, described " mammal " includes but not limited to: mice, rat, rabbit, Canis familiaris L., ape and monkey.Described suckling
Animal is close at the aspects such as the composition of gene, anatomical organ, individual growth, metabolic way, disease incidence mechanism and the mankind,
The aspect such as human diseases pathogenesis, pharmacopathology research can be well applied to.Preferably, described mammal is
Mus (such as mice).
Preferably, described in the method used, including (but being not restricted to): intramuscular injection, intravenous injection, lumbar injection etc..
In the preferred embodiment of the present invention, method particularly includes: a couple of days continuously, to mammal by tibialis anterior local injection
Mode, after using the Dkk-3 adenovirus of effective dose, raise a couple of days.
In the preferred embodiment of the present invention, method particularly includes: by the way of lower limb tibialis anterior local injection, use to mice
1x109-6.5x1012The Dkk-3 adenovirus of Tu/kg body weight, injects once, after injecting continuous 3～10 times altogether, raises every day
Support 5～15 days.
It is furthermore preferred that method particularly includes: by the way of tibialis anterior local injection, use 3.5x10 to mice10Tu titre
The Dkk-3 adenovirus of/kg body weight, injects once, after co-continuous injection 7 times, raise 7 days every day.
After utilizing process LAN Dkk-3 induction, the present inventor utilizes the index that muscle-wasting diseases is relevant to verify and sets up model
Success or not.Checking finds, after using process LAN Dkk-3 induction, Myotube diameter substantially diminishes or cross-sectional area diminishes,
The mrna expression level of Atroign1 and Murf1 raises.These indexs comprehensive understand, and the present inventor utilizes process LAN Dkk-3
Induction also successfully constructs amyotrophy animal model.
The amyotrophy animal model of the present invention, described model has many application.
For example, it is possible to for the pathogenesis studied and illustrate on amyotrophic cell or even molecular level.
Apply also for treating the screening of amyotrophic medicine.
Screening new drug
The present invention utilizes process LAN Dkk-3 to induce successfully and constructs amyotrophy model, and described model can be applicable to treat muscle
The screening of the medicine of atrophy.
Therefore, the invention provides a kind of method screened and treat amyotrophic drug candidate, described method includes following step
Rapid: test drug candidate to be applied to the amyotrophy animal model built by preceding method, and tests candidate's medicine with not using
The amyotrophy animal model of thing compares, and causes the test compound that muscle wasting symptoms improves or cures after wherein using
It is exactly to treat amyotrophic drug candidate.
The above-mentioned drug candidate filtered out may make up a screening storehouse, these materials can carry out further cell experiment, move
Thing experiment and/or clinical trial, to confirm the treatment amyotrophy effect of described potential material further.
Owing to the present invention uses the mode of process LAN Dkk-3 to induce, constructed model is more closely similar to the morbidity of the mankind
Journey, thus the most accurate with conventional model in the screening of medicine, in hgher efficiency.
The beneficial effects of the present invention is:
(1) the invention firstly discloses process LAN Dkk-3 can induced muscle cell generation atrophy, be more closely similar to the mankind's
Pathogenic process.
(2) amyotrophy cell model and the animal model of the present invention has amyotrophic typical characteristic, can simulate admirably
Internal amyotrophic develop, be amyotrophy basis and the preferable cell model of clinical application research and animal model,
Thus screening can be well applied to and treat amyotrophic medicine.
Below by way of specific instantiation, embodiments of the present invention being described, those skilled in the art can be taken off by this specification
The content of dew understands further advantage and effect of the present invention easily.The present invention can also be by the most different specific embodiment parties
Formula is carried out or applies, and the every details in this specification can also be based on different viewpoints and application, without departing from this
Various modification or change is carried out under bright spirit.
Before further describing the specific embodiment of the invention, it should be appreciated that protection scope of the present invention is not limited to following spy
Fixed specific embodiments；It is also understood that the term used in the embodiment of the present invention is specifically to be embodied as to describe
Scheme rather than in order to limit the scope of the invention；In description of the invention and claims, unless another in literary composition
Explicitly pointing out outward, singulative " ", " one " and " this " include plural form.
When embodiment provides numerical range, it should be appreciated that unless the present invention is otherwise noted, two end points of each numerical range
And any one numerical value all can be selected between two end points.Unless otherwise defined, all technology used in the present invention and section
The same meaning that technics and those skilled in the art of the present technique are generally understood that.Except in embodiment use concrete grammar, equipment,
Outside material, according to those skilled in the art's grasp to prior art and the record of the present invention, it is also possible to use and this
Any method, equipment and the material of the prior art that the method described in inventive embodiments, equipment, material are similar or equivalent comes
Realize the present invention.
Unless otherwise indicated, the experimental technique that disclosed in this invention, detection method, preparation method all use the art
Molecular biology, biochemistry, chromatin Structure and the analysis of routine, analytical chemistry, cell cultivation, recombinant DNA technology
And the routine techniques of association area.These technology have improved explanation in existing document, specifically can be found in Sambrook etc.
MOLEC μ LAR CLONING:A LABORATORY MANUAL, Second edition, Cold Spring Harbor
Laboratory Press, 1989and Third edition, 2001；Ausubel etc., CURRENT PROTOCOLS IN
MOLEC μ LAR BIOLOGY, John Wiley&Sons, New York, 1987and periodic updates；the
Series METHODS IN ENZYMOLOGY, Academic Press, San Diego；Wolffe, CHROMATIN
STRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998；METHODS
IN ENZYMOLOGY, Vol.304, Chromatin (P.M.Wassarman and A.P.Wolffe, eds.), Academic
Press, San Diego, 1999；With METHODS IN MOLEC μ LAR BIOLOGY, Vol.119, Chromatin
Protocols (P.B.Becker, ed.) Humana Press, Totowa, 1999 etc..
The foundation of the amyotrophy cell model of embodiment 1 process LAN Dkk-3 induction
The main contents of the present embodiment are for cultivate, break up and to build muscle cell atrophy mould to muscle precursor cell system C2C12
Type:
(1) configuration growth medium: DMEM high glucose medium mixes standby after adding 10% hyclone.
(2) configuration division culture medium: mix standby after adding 2% horse serum in DMEM high glucose medium.
(3) packaging can express adenovirus (titre: the 1.3x10 of Dkk-310Tu/ml), concrete grammar is as follows:
First from NCBI, obtain Dkk-K3CDS sequence (NM_015814), and design PCR primer:
Primer-F:GGGGTACCATGGACTACAAAGACCATGAC (SEQID NO.7)；
Primer-R:GCTCTAGACTAAATCTCCTCCTCTCCGCC (SEQID NO.8)；
Take the C2C12 cell of a 10cm culture dish, inhale and abandon culture fluid, add 1mlTrizol cell lysis；Add 200 μ l
Chloroform, fully shakes mixing, and 12000 revs/min 4 DEG C are centrifuged 15 minutes, take upper strata clear liquid, be transferred in new EP pipe；
Adding 500 μ l isopropanols, fully mix, 12000 revs/min 4 DEG C are centrifuged 15 minutes, abandon supernatant, add 1ml75% in precipitation
Ethanol is washed once, and after abandoning supernatant, room temperature is dried in the air 10 minutes；Add the 40 μ l water dissolution without RNase, it is thus achieved that total mRNA.Light splitting
After Spectrophotometry for Determination mRNA concentration, take 1ug total serum IgE, add 1 μ l (200units) NEB company M μ lV reverse transcription and 1x thereof
Reaction buffer, 0.5mM dNTP mixture, 4 μMs of Oligo dT, 1 μ l RNase inhibitor 42 DEG C hatch 1 hour, instead
It is transcribed into cDNA.CDNA is inactivated 10 minutes at 75 DEG C, as pcr template.By the PCR primer of design, add 1 μ l KOD
Polymerase, the dNTP, PCR of 1 μ l (10mM) obtains the gene expressing Dkk-3.(1.95℃5min；2.95 DEG C change
Property 30s；3.58 DEG C of annealing 30s；4.68 DEG C extend 2min；5.68℃10min.2-4 step circulation 30 times) PCR primer fine jade
After sepharose electrophoresis reclaims, with 37 DEG C of enzyme action of Kpn1 and Xbal1 restricted enzyme 2 hours of 1 μ lNEB, 1ug carrier
PadTrack-GFP is also with 37 DEG C of enzyme action of Kpn1 and Xbal1 restricted enzyme 2 hours of 1 μ lNEB, and agarose gel electrophoresis returns
After receipts, after connecting 5 hours by the T4DNA ligase room temperature of 1 μ lNEB, transformed competence colibacillus cell BJ5183, with Kpn1 and Xbal1
After digestion with restriction enzyme is identified, transfection DH5 α competent cell amplification plasmid, after extracting plasmid, restricted interior with Pac1
Cutting enzyme linearisation, glue i.e. can be used for transfecting the cell 293A of packaging virus after reclaiming.Take the expression plasmid that 10ug linearisation is good,
(10ug plasmid joins in 250 μ l water calcium phosphate precipitation transfection 293A cell, adds 250 μ l calcium chloride solutions, fully mixes
Standby；Take a 50ml centrifuge tube, add the 2xHBS solution of 500 μ l, the plasmid-calcium solution got ready is added dropwise to HBS
In solution, limit edged fully shakes；Add rear room temperature place 20 minutes standby；The 293A cell growing to about 60% floor space takes
Go out, inhale and abandon old culture fluid, add 10ml grown cultures (DMEM+10%FBS), the plasmid calcium deposit above got ready is hanged
Liquid is slowly added in culture medium, shakes up gently and is placed on 37 degree, cultivates in 5% CO2 gas incubator；Transfect latter 16 hours,
The growth medium more renewed, continues to cultivate.After 48 hours, every day at fluorescence microscopy Microscopic observation, until all under mirror
Cell all express green fluorescence (it is generally required to 7-10 days).Collect all of cell and cell culture fluid, 1500 revs/min
Centrifugal room temperature is centrifuged 5 minutes, abandons supernatant, stays cell to precipitate.After washing twice with PBS, it is resuspended to add 500 μ μ l PBS, uses liquid
-37 DEG C of multigelation method cell lysis of nitrogen (freeze thawing 3 times), 2000 revs/min of room temperatures are centrifuged 5 minutes, and supernatant forwards new pipe to
Standby (i.e. P1 generation virus).Cultivating 40 dishes (10cm culture dish) 293A cell to growing to 60% floor space, often dish adds 10 μ lP1
Generation virus infects, Microscopic observation every day after 24 hours, until after all cells expresses green fluorescence (it is generally required to 2-3 days),
Collect and crack releasing virus (the general 2ml PBS cell lysis that adds obtains virus) according to receiving the P1 same method of generation virus,
The most i.e. obtain P2 generation virus.Can use after surveying titre (follow-up more virus if necessary, i.e. sick according to obtaining P2 generation
The method of poison expands).
(4) cell line is cultivated: C2C12 cell is immediately placed in 37 DEG C of water-baths dissolving after taking out from liquid nitrogen, join 9ml
In growth medium, after 1500rpm/min room temperature is centrifuged 5 minutes, discards supernatant, proceed to after addition 1ml growth medium is resuspended
In 10cm culture dish, add 9ml growth medium, at 37 DEG C, cultivate under 5% carbon dioxide conditions.C2C12 cell line is divided
Turn to myotube: treat that C2C12 cell length, to after being paved with whole culture dish completely, is washed 3 times with PBS, added 10ml differentiation training
Support base, at 37 DEG C, induction differentiation 3 days under 5% carbon dioxide conditions.
(5) there is amyotrophy in the myotube that process LAN Dkk-3 induction is differentiated by C2C12: changes fresh 10ml differentiation
Culture medium, adds 2.6x10 in matched group7The GFP adenovirus (MOI:1:5) of TU, adds 2.6x10 in experimental group7TU
Dkk-3 adenovirus (MOI:1:5).37 DEG C, under 5% carbon dioxide conditions, cultivate 72h.Under Zeiss fluorescence microscope
Observation is taken pictures, and measures the diameter (result is as shown in Figure 1) of myotube.Collect cell simultaneously, extract total protein, take 40 μ g
Total protein carries out SDS-PAGE electrophoresis, with Flag antibody hybridization (1:2000 dilutes, room temperature 1 hour), detection after transferring film
Dkk-3 with the process LAN of Flag label.After PBS washes 3 times (10 minute/time), add the anti-Mus of donkey two of 1:1000 dilution
Anti-, incubated at room 1 hour.After PBS washes 3 times (10 minute/time), colour developing, the table of the Dkk-3 of detection process LAN Flag labelling
Reach (Fig. 1 C).
As a result, as shown in Figure 1A: compared with blank group, after the process LAN Dkk-3 with Flag label, myotube
Diameter be substantially reduced.Such as Figure 1B: statistical analysis shows, after process LAN Dkk-3, myotube diameter is substantially reduced.
Such as Fig. 1 C: detected by Western blot, with the Dkk-K3 of Flag label process LAN really in myotube.
(6) take experimental group and each dish cell of matched group of addition Dkk-3 adenovirus, after adding 1ml Trizol, extract total serum IgE,
Respectively take 1 μ g total serum IgE and add 1 μ l (200units) NEB company's MuLV reverse transcription and 1x reaction buffer, 0.5mM dNTP
Mixture, 4 μMs of Oligo dT, 1 μ l RNase inhibitor 42 DEG C hatch 1 hour, and reverse transcription is cDNA.By cDNA at 90 DEG C
Inactivate 10 minutes, as pcr template.Use forward listed above and reverse primer, carry out real-time fluorescence quantitative PCR detection
The expression of genes of interest.PCR condition be 95 DEG C 10 minutes, 95 DEG C 30 seconds, 60 DEG C 60 seconds, second and the 3rd step repeatedly follow
Ring 40 times.Employing GAPDH as internal reference, the primer sequence is:
GAPDH forward:ACCCAGAAGACTGTGGATGG(SEQID NO.1)
GAPDH reverse:ACACATTGGGGGTAGGAACA(SEQID NO.2)
Simultaneously detection muscle in amyotrophy specific gene Atrogin1 (NM_026346.3) and
The expression of Atrogin1 (NM_026346.3) is as amyotrophic labelling.The primer sequence is:
Atrogin-1forward:AGAGAGGCAGATTCGCAAGCGT(SEQID NO.3)
Atrogin-1reverse:TGCAAAGCTGCAGGGTGACCC(SEQID NO.4)
MuRF-1forward:acctgctggtggaaaacatc (SEQID NO.5)
MuRF-1reverse:cttcgtgttccttgcacatc (SEQID NO.6)
The MuLv reverse transcription reverse transcription using NEB is cDNA, detects amyotrophy labelling by real-time fluorescence quantitative PCR
The mrna expression level of thing Atroign1 and MuRF1.Result is as in figure 2 it is shown, process LAN Dkk-3 can raise Atrogin1 (left)
With the expression of MuRF1 (right), cause amyotrophy.
Additionally, also carried out following optimization to investigate experiment:
A the natural law of () fixing induction is 3 days, 72 hours action time, enter the effective dose of Dkk-3 adenovirus
Row is investigated, that is, in above-mentioned steps (5), add the Dkk-3 adenovirus of different titers so that it is in division culture medium
Final concentration is respectively 0,6,13,26,60,130x106Tu, observes the situation of change of terminal differentiation muscle cell diameter,
Result is as shown in table 1:
Table 1. different amounts of Dkk-3 virus infects the effect after myotubes
| Virus quantity (x106Tu) | Myotube diameter (μm) | Mortality rate (%) |
| 0 | 15.7±1.73 | 0 |
| 6 | 14.4±1.59 | 3 |
| 13 | 7.5±0.65 | 7 |
| 26 | 3.81±0.42 | 9 |
| 60 | 3.7±0.48 | 85 |
| 130 | 4.1±0.47 | 95 |
From the above results, if the amount of virus is too small, efficiency of infection is relatively low, and process LAN degree is low, induced muscle atrophy
DeGrain；The amount of virus is excessive, and cell is caused serious cell death by superinfection.
Concrete, as Dkk-3 adenovirus final concentration of (6～26) x10 in division culture medium6During Tu, all can make end point eventually
Change muscle cell diameter to be obviously reduced.But, when Dkk-3 adenovirus final concentration in division culture medium is higher than 60x106During Tu,
Most cell death can be caused.Following experiment preferably employs Dkk-3 adenovirus final concentration of 26x10 in division culture medium6Tu。
The final concentration of 26x10 of Dkk-3 adenovirus in (b) fixing division culture medium6Tu, induction divergaence time 3 days, to effect
Time is investigated, that is, in above-mentioned steps (5), cultivate 12～96 hours, observe terminal differentiation muscle cell diameter
Situation of change, result as shown in Table 2 and Figure 3:
Table 2. diameter of different time myotubes after process LAN Dkk-3 in muscle cell
| Effect (cultivation) time (hour) | Average myotubes diameter (μm) |
| 0 | 14.7±1.51 |
| 12 | 15.3±1.62 |
| 24 | 14.64±1.55 |
| 36 | 14.82±1.38 |
| 48 | 11.57±1.06 |
| 60 | 5.38±0.61 |
| 72 | 3.81±0.42 |
| 96 | 4.05±0.48 |
From table 2 and Fig. 3 result, after process LAN 2 days, experimental group myotube started to attenuate, process LAN 3 days
After, compared with matched group, myotube diameter substantially attenuates.It is therefore preferable that action time is 72h.
The foundation of the amyotrophy animal model of embodiment 2 process LAN Dkk-3 induction
Expressing the Dkk-3 adenovirus with GFP label, titre is 1.3x1010TU/ml.
The concrete grammar of the adenovirus (titre: 1.3x1010TU/ml) that packaging can express Dkk-3 is as follows:
First from NCBI, Dkk-3CDS sequence (NM_015814) is obtained, design PCR primer:
Primer-F:GGGGTACCATGGACTACAAAGACCATGAC (SEQID NO.7)；
primer-R:GCTCTAGACTAAATCTCCTCCTCTCCGCC(SEQID NO.7)。
Take the C2C12 cell of a 10cm culture dish, inhale and abandon culture fluid, add 1mlTrizol cell lysis；Add 200 μ l
Chloroform, fully shakes mixing, and 12000 revs/min 4 degree are centrifuged 15 minutes, take upper strata clear liquid, be transferred to new EP
Guan Zhong；Adding 500 μ l isopropanols, fully mix, 12000 revs/min 4 degree are centrifuged 15 minutes, abandon supernatant, in precipitation
Adding 1ml75% ethanol and wash once, after abandoning supernatant, room temperature is dried in the air 10 minutes；Add the 40 μ l water dissolution without RNase, it is thus achieved that
Total mRNA.Survey after concentration, take 1ug total serum IgE, add 1 μ l (200units) NEB company's MuLV reverse transcription and
Its 1x reaction buffer, 0.5mM dNTP mixture, 4 μMs of Oligo dT, it is little that 1 μ l RNase inhibitor 42 DEG C hatches 1
Time, reverse transcription is cDNA.CDNA is inactivated 10 minutes at 75 DEG C, as pcr template.PCR primer with design
PCR obtains the gene expressing Dkk-3,37 DEG C of enzyme action of Kpn1 and Xbal1 restricted enzyme 2 hours, carrier
PadTrack-GFP also uses 37 DEG C of enzyme action of Kpn1 and Xbal1 restricted enzyme 2 hours, after agarose gel electrophoresis reclaims,
After connecting 5 hours by T4DNA ligase room temperature, transformed competence colibacillus cell BJ5183, restricted interior with Kpn1 and Xbal1
After cutting the qualification of enzyme enzyme action, transfection DH5 α competent cell amplification plasmid, after extracting plasmid, with Pac1 restricted enzyme line
Property, glue i.e. can be used for transfecting the cell 293A of packaging virus after reclaiming.Take the expression plasmid that 10ug linearisation is good, phosphoric acid
(10ug plasmid joins in 250 μ l water calcium precipitation method transfection 293A cell, adds 250 μ l calcium chloride solutions, fully mixes
Standby；Take a 50ml centrifuge tube, add the 2xHBS solution of 500 μ l, the plasmid-calcium solution got ready is added dropwise to
In HBS solution, limit edged fully shakes；Add rear room temperature place 20 minutes standby；Grow to the 293A of about 60% floor space
Cell takes out, and inhales and abandons old culture fluid, adds 10ml grown cultures (DMEM+10%FBS), the plasmid calcium that will above get ready
Precipitation suspension is slowly added in culture medium, shakes up gently and is placed on 37 degree, cultivates in 5% CO2 gas incubator；After transfection
16 hours, the growth medium more renewed, continues to cultivate.After 48 hours, every day at fluorescence microscopy Microscopic observation, until
Under mirror, all of cell all expresses green fluorescence (it is generally required to 7-10 days).Collect all of cell and cell culture fluid, 1500
Rev/min centrifugal room temperature is centrifuged 5 minutes, abandons supernatant, stays cell to precipitate.After washing twice with PBS, add 500 μ lPBS weights
Outstanding, with liquid nitrogen-37 degree multigelation method cell lysis (freeze thawing 3 times), 2000 revs/min of room temperatures are centrifuged 5 minutes, supernatant
Forward new pipe standby (i.e. P1 generation virus) to.Cultivate 40 dishes (10cm culture dish) 293A cell to growing to for 60% end
Area, often dish adds 10 μ l P1 generation virus infection, and Microscopic observation every day after 24 hours, until all cells expresses green fluorescence
After (it is generally required to 2-3 days), collect and crack releasing virus according to the receipts P1 same method of generation virus and (typically add 2mlPBS
Cell lysis obtains virus), the most i.e. obtain P2 generation virus.Can use (follow-up more sick if necessary after surveying titre
Poison, i.e. expands according to the method obtaining P2 generation virus).
Method: take adult mice (6-8 week), first do preliminary experiment with the empty carrier adenovirus only expressing GFP, screen
Feeding time after good injection time and injection.After the different number of times of injection continuously, after putting to death mice after raising different number of days
Take tibialis anterior, be embedded in embedding medium OCT, make frozen section.Take pictures at Zeiss fluorescence microscopy Microscopic observation, sieve
Select the experimental group expressing green fluorescence most and carry out follow-up test.As shown in Figure 4, after we filter out and inject 7 times continuously
Raise 7 days is optimum condition.
It is 1.3x10 by 50 μ l titres10The adenovirus of the expression Dkk-3 of TU/ml passes through intramuscular injection, is injected into mice left
In lower limb tibialis anterior, it is 1.3x10 that right lower limb tibialis anterior injects 50 μ l titres10The empty carrier adenovirus of TU/ml as comparison,
Every day injects once, after injecting 7 days continuously, waits 10 days.Then take flesh before mouse tibia, be embedded in embedding medium OCT
In, make frozen section.Show muscle fiber profile by hematoxylin-eosin staining (HE dyeing), compare diameter of muscle fiber big
Little.Colouring method is as follows: washed by frozen section PBS twice, 5 minutes/time；Brazilwood extract dyeing 1 minute, tap water rushes
Wash 20 minutes；30% ethanol is hatched 5 minutes；50% ethanol is hatched 5 minutes；70% ethanol hatches 5min；
95% ethanol hatches 5min；Yihong dyestuff dyes 10 seconds；95% ethanol is hatched 5 minutes；100% ethanol
In hatch 5 minutes；100% ethanol is hatched 5 minutes；Dimethylbenzene: hatch 10 minutes in EtOH=1:1 solution；Diformazan
Benzene is hatched 10 minutes；Resin glue mounting is used after drying.Take pictures under microscope, add up myofibrillar diameter (Fig. 4).Tool
Body, as shown in Figure 4 A, in mouse muscle, process LAN is with the Dkk-3 induced muscle atrophy of GFP label；Such as Fig. 4 B
Shown in, statistical analysis shows, process LAN is substantially wanted than the diameter of the only muscle of expression GFP with the Dkk-3 of GFP label
Little.
Additionally, also carried out following optimization to investigate experiment:
A () has investigated the injection Dkk-3 virus different number of days impact on mouse muscle fiber area, result such as table the most continuously
Shown in 3:
The area of muscle fiber of Dkk-3 virus different number of days injected the most continuously by table 3.
| Injection natural law (my god) | Average area of muscle fiber (μm2) |
| 0 | 9461±764 |
| 1 | 9245±547 |
| 2 | 9852±845 |
| 3 | 9425±815 |
| 4 | 9210±683 |
| 5 | 8788±652 |
| 6 | 7254±684 |
| 7 | 6435±554 |
| 8 | 6341±617 |
| 9 | 6784±648 |
| 10 | 6421±663 |
From the above results, when Dkk-3 adenoviral injection is 3～10 days, mouse muscle cell dia is all enabled to
It is obviously reduced.But, when injecting natural law and being 7 days, have been achieved with good effect.
B () has investigated the impact on mouse muscle fiber area of the different Dkk-3 virus injection concentration, result is as shown in table 4:
The area of muscle fiber of varying number virus injected in vivo by table 4.
| Virus titer (x109Tu/kg body weight) | Area of muscle fiber (μm2) |
| 1.3 | 9251±905 |
| 6.5 | 8735±817 |
| 13 | 6145±487 |
| 65 | 5942±678 |
| 130 | 6082±647 |
| 650 | 6175±724 |
| 1300 | 6253±637 |
| 6500 | 6217±715 |
From the above results, it is (1.3～6500) x10 when Dkk-3 adenoviral injection concentration9During Tu/kg body weight, equal energy
Mouse muscle cell dia is enough made to be obviously reduced.
C () has investigated the impact on mouse muscle diameter of the different feeding time, result is as shown in table 5:
Table 5. waits the area of muscle fiber of different number of days in vivo after injection Dkk-3 virus
| Wait natural law (my god) | Area of muscle fiber (μm2) |
| 0 | 9264±614 |
| 1 | 9317±742 |
| 2 | 9230±845 |
| 3 | 9325±675 |
| 4 | 9283±734 |
| 5 | 9246±842 |
| 6 | 9295±914 |
| 7 | 8343±761 |
| 8 | 8651±815 |
| 9 | 7624±572 |
| 10 | 6245±437 |
| 11 | 6387±523 |
| 12 | 6145±487 |
| 13 | 6284±518 |
| 14 | 6495±495 |
| 15 | 6642±467 |
From the above results, when Dkk-3 adenovirus action time is 5～15 days, mouse muscle cell is all enabled to
Diameter is obviously reduced.But, when acting on natural law and being 7 days, have been achieved with good effect.
Embodiment 3 drug screening
With embodiment 1 preparation amyotrophy cell model or embodiment 2 preparation amyotrophy animal model as study subject,
Detection is before and after drug candidate uses, and Myotube diameter changes, thus judges that whether drug candidate is to have for treatment amyotrophy
Effect.
Test group: give the model of drug candidate；
Matched group: do not give drug candidate or give the model of placebo.
If compared with matched group, the Myotube diameter in test group becomes big, the mrna expression of Atroign1 and Murf1
Level declines, then illustrate that this drug candidate can treat amyotrophy.
May utilize and suffer from amyotrophy animal, amyotrophic drug candidate can be treated to above-mentioned through screening, carry out further
Animal experiment, verifies therapeutic effect further.
Above embodiment illustrates that embodiment disclosed by the invention, can not be interpreted as limitation of the present invention.This
Outward, method, the change of compositions in various amendments listed herein and invention, without departing from the scope of the present invention and essence
It is apparent from for those skilled in the art on the premise of god.Although having combined the multiple concrete preferred of the present invention
Embodiment has carried out concrete description to the present invention, it is to be understood that, the present invention should not be limited only to these specific embodiments.Thing
In reality, various as above for those skilled in the art obvious amendment obtain invention and be intended to be included in
In the scope of the present invention.
Claims (13)
1.Dkk-3 purposes in the medicine preparing induced muscle cell generation atrophy or preparation.
Purposes the most according to claim 1, it is characterised in that described medicine or preparation are for reducing the diameter of myotube in muscle
Or cross-sectional area.
Purposes the most according to claim 1, it is characterised in that described medicine or preparation are used for raising muscular atrophy in muscle cell
The expression of condensed phase correlation gene Atroign1 and Murf1.
4.Dkk-3 purposes in building amyotrophy cell model or amyotrophy animal model.
5. the method building amyotrophy cell model, said method comprising the steps of: in muscle cell, process LAN is effective
The Dkk-3 of dosage；Obtain amyotrophy cell model.
Method the most according to claim 5, it is characterised in that described muscle cell is the muscle cell of terminal differentiation.
Method the most according to claim 5, it is characterised in that the method for the Dkk-3 of described process LAN effective dose is: adopt
With the fresh division culture medium containing Dkk-3 adenovirus, cultivate the muscle cell of terminal differentiation；Described Dkk-3 adenovirus
Can the Dkk-3 of process LAN effective dose.
Method the most according to claim 7, it is characterised in that the Dkk-3 adenovirus final titre in division culture medium is
6x106～26x106TU；Incubation time is 24～96 hours.
9. the method building amyotrophy animal model, said method comprising the steps of: to the effective agent of mammal process LAN
The Dkk-3 of amount；Obtain amyotrophy animal model.
Method the most according to claim 9, it is characterised in that described mammal is Mus.
11. methods according to claim 9, it is characterised in that method particularly includes: a couple of days continuously, lead to mammal
Cross the mode of tibialis anterior local injection, after using the Dkk-3 adenovirus of effective dose, raise a couple of days.
12. by the amyotrophy cell models of method structure described in claim 5～8 any claim or by claim 9～11
The amyotrophy animal model that method described in any claim builds purposes in screening of medicaments.
13. 1 kinds are screened the method treating amyotrophic drug candidate, said method comprising the steps of: will test candidate's medicine
Thing is applied to the amyotrophy cell model by method structure described in claim 5～8 any claim or is wanted by by right
Seek the amyotrophy animal model that method described in 9～11 any claim builds, and test drug candidate with not using
Amyotrophy cell model or amyotrophy animal model compare, cause after wherein using muscle wasting symptoms improve or
The test compound cured treats amyotrophic drug candidate exactly.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510215820.7A CN106190958B (en) | 2015-04-29 | 2015-04-29 | It is overexpressed the amyotrophy model and its application of Dkk-3 induction |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510215820.7A CN106190958B (en) | 2015-04-29 | 2015-04-29 | It is overexpressed the amyotrophy model and its application of Dkk-3 induction |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106190958A true CN106190958A (en) | 2016-12-07 |
| CN106190958B CN106190958B (en) | 2019-11-15 |
Family
ID=57458178
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510215820.7A Active CN106190958B (en) | 2015-04-29 | 2015-04-29 | It is overexpressed the amyotrophy model and its application of Dkk-3 induction |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106190958B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111484550A (en) * | 2020-04-24 | 2020-08-04 | 苏州神肌赢生物医药科技有限公司 | Dkk-3 protein functional fragment and application thereof |
-
2015
- 2015-04-29 CN CN201510215820.7A patent/CN106190958B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| DUSTIN D. ARMSTRONG等: "Wnt/β-catenin signaling activates growth-control genes during overload-induced skeletal muscle hypertrophy", 《AM J PHYSIOL CELL PHYSIOL》 * |
| 陈小琼等: "糖皮质激素引起肌肉萎缩细胞模型的建立", 《军事体育进修学院学报》 * |
| 魏秋实等: "从Wnt /β-catenin 和OPG/RANKL /RANK 信号通路探讨糖皮质激素诱发骨质疏松症的可能途径", 《中国骨质疏松杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111484550A (en) * | 2020-04-24 | 2020-08-04 | 苏州神肌赢生物医药科技有限公司 | Dkk-3 protein functional fragment and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106190958B (en) | 2019-11-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104814984B (en) | Application of the Alphavirus in terms of antineoplastic is prepared | |
| CN107028980A (en) | Pharmaceutical composition for treating heart disease | |
| CN102864172B (en) | Leukemia mouse model based on gene co-transfection technology and preparation method thereof | |
| CN106191067A (en) | Circular rna circ NFATC3 and application thereof | |
| CN114794018A (en) | Mumps virus counteracting animal model and establishment method thereof | |
| CN107988141A (en) | liver fibrosis model and its construction method and application | |
| CN104164410B (en) | A kind of Newcastle disease poison strain and the application in preparing Newcastle disease vaccine thereof | |
| CN109908369A (en) | A kind of application of new circular rna circCRKL in prostate cancer therapy | |
| CN102618500A (en) | Method for inducing human mesenchymal stem cells to differentiate into insulin-secreting cells in vitro | |
| CN106190958A (en) | The amyotrophy model of process LAN Dkk-3 induction and application thereof | |
| CN110218726A (en) | It is a kind of for inhibiting the shRNA and application thereof of rat Cacna1c gene expression | |
| CN109234381A (en) | Application of the miR-2682-5p as kidney fibrosis marker | |
| CN106065401B (en) | Treatment use of the lentivirus mediated CXCR7 high expression engineering endothelial progenitor cells in ischemic disease | |
| CN106191215A (en) | The screening of the protein molecular marker Dkk-3 that amyotrophy is relevant and application thereof | |
| CN114042064A (en) | Application of nitazoxanide in pharmacy | |
| CN105457028A (en) | Stress sensitivity microRNA exerting regulating effect in bone formation | |
| CN106282240A (en) | Build the method that stability and high efficiency expresses the rat bone marrow mesenchymal stem cells cell strain of c met albumen | |
| CN114134195A (en) | Screening method of medicament for preventing prostate cancer and application of nitazoxanide in pharmacy | |
| CN107345221A (en) | A kind of TGF β 1 modify the preparation method of umbilical cord mesenchymal stem cells and the application in rheumatism | |
| CN110564700B (en) | Oncolytic vaccinia virus carrying limulus lectin gene, construction method and application | |
| CN109939222A (en) | CREG albumen is used to promote the medical usage of skeletal muscle regeneration | |
| CN109136263A (en) | A kind of screening promotees method, recombinant vector and the cell strain of stem cell homing drug | |
| CN105567737A (en) | Construction and application of miRNA-34a overexpression recombinant vector | |
| CN107970435A (en) | The method and application that the endogenous Lgr5+ liver stem cells of combined induction increase | |
| CN107982518A (en) | A kind of Lgr5 positive liver stem cells abductive approach and its detection application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200423 Address after: 200031 building 35, No. 320, Yueyang Road, Xuhui District, Shanghai Patentee after: Center for excellence and innovation of molecular cell science, Chinese Academy of Sciences Address before: 200031 No. 320, Yueyang Road, Shanghai, Xuhui District Patentee before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |