CN106148535A - The miRNA 4512 application in osteosarcoma diagnoses - Google Patents

The miRNA 4512 application in osteosarcoma diagnoses Download PDF

Info

Publication number
CN106148535A
CN106148535A CN201610616388.7A CN201610616388A CN106148535A CN 106148535 A CN106148535 A CN 106148535A CN 201610616388 A CN201610616388 A CN 201610616388A CN 106148535 A CN106148535 A CN 106148535A
Authority
CN
China
Prior art keywords
mirna
osteosarcoma
product
application
osteosarcomatous
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610616388.7A
Other languages
Chinese (zh)
Inventor
石小峰
孙锦云
杨承刚
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Medintell Bioinformatic Technology Co Ltd
Original Assignee
Beijing Medintell Bioinformatic Technology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Medintell Bioinformatic Technology Co Ltd filed Critical Beijing Medintell Bioinformatic Technology Co Ltd
Priority to CN201610616388.7A priority Critical patent/CN106148535A/en
Publication of CN106148535A publication Critical patent/CN106148535A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Abstract

The invention discloses the miRNA 4512 application in osteosarcoma diagnoses, described osteosarcoma is chondroblastic osteosarcoma.By second filial generation high-flux sequence, the present invention finds that miRNA 4512 significantly reduces in Patients with Osteosarcoma blood, further study show that, miRNA 4512 occurs development relevant to osteosarcomatous.By detecting the content of miRNA 4512, can be that patient provides early warning, instruct doctor's interventional therapy, improve the survival rate of patient.

Description

MiRNA-4512 application in osteosarcoma diagnoses
Technical field
The invention belongs to biomedicine field, relate to miRNA-4512 application in osteosarcoma diagnoses.
Background technology
Osteosarcoma is modal Primary Malignant Bone Tumor, the sarcoma cell of malignant proliferation directly produce tumprigenicity bone Sample tissue or immature bone, also referred to as osteogenic sarcoma, its histological characteristic is that the fusiformis tumor cell of hypertrophy directly produces bone sample base Matter or immature bone, visible many tumor cells under microscope, cell and nucleus size, shape differ, and have small-sized multinuclear huge Cell, spindle cell, jejune chondrocyte and pernicious osteoblast, nucleus is big, dyes the deepest.Nearly all osteosarcoma Transfer is all transferred to lung through blood, and minority is transferred to the internal organs such as brain, kidney and through lymphatic metastasis.
Osteosarcoma can be divided into different hypotypes, chondroblastic osteosarcoma as conventional osteosarcoma a hypotype and The clinical treatment of other conventional osteosarcomas and prognosis there is no big difference, but because of in Radiologic imaging and histopathology with soft Osteosarcoma has overlapped part, easy mistaken diagnosis to be chondrosarcoma, therefore mainly should differentiate with chondrosarcoma.Chondroblast Type osteosarcoma, to produce cartilage matrix, is mostly high-level hyaline cartilage, except jawbone and the chondroblastic of basin bone Beyond osteosarcoma, the cartilage matrix of intra-tumor seldom has obvious mucinous degeneration or the chondrosarcoma composition of other forms occurs.Soft In the osteosarcomatous tumor tissue of osteoblastic, more than 1/2 in chondrosarcoma spline structure, metaplasia can form tumor on this basis Bone.
Osteosarcoma total incidence accounts for the 0.2% of human malignant's entity tumor, age of onset many 15-25 year between, man Property more than women, predilection site is the dry marrow end of long bone, and distal femur and proximal tibia are the most common, next to that humerus and calf Proximal bone, other positions such as osseous tissue such as near end of thighbone, vertebra, ilium all can occur.The grade malignancy of this tumor is the highest, prognosis Extreme difference, feature is that local occurs early with metastasis, and when clinic makes osteosarcoma diagnosis, lung has occurred in wherein most patient Micro metastasis, within 5 years, survival rate is low.In recent years due to new adjuvant chemotherapy and the progress of chemotherapy regimen and surgical technic not Disconnected raising, hence it is evident that improve the survival rate of Patients with Osteosarcoma.Use the comprehensive therapeutic plan of operation combined chemotherapy, osteosarcoma at present 5 years survival rates of patient are 55-68%, the most unsatisfactory, and the main cause of its prognosis mala shifts in early days, current The not already available promising result of anti-metastatic therapy.Osteosarcomatous invasion and attack and transfer drastically influence the quality of life of patient with pre- After, the treatment of gene level becomes the focus of vast scholar's research, but its concrete mechanism and therapeutic scheme still need further Research, and gene therapy is sought effective therapy target and becomes one of key issue needing solution.
Recent studies have shown that microRNA (miRNA) plays an important role in tumor develops.miRNAs A kind of endogenous noncoding strand microRNA, if it is sour to there are about 18-26 core, main mechanism be by with target The 3' end non-coding region specific bond of the mRNA molecule of target gene suppress the mRNA of target gene to transcribe after translation, thus join With physiology multiple in human body and pathological process.Find and occur the miRNA that development is relevant that osteosarcomatous science is ground to osteosarcoma Study carefully and just have important meaning with application clinically.
Summary of the invention
An object of the present invention is to provide a kind of miRNA diagnosis marker, and this diagnosis and treatment mark is miRNA-4512.
The two of the purpose of the present invention, it is provided that a kind of product, it is possible to realize osteosarcomatous early diagnosis, improve Patients with Osteosarcoma Survival rate and quality of life.
To achieve these goals, present invention employs following technical scheme:
The invention provides the application in preparation diagnoses osteosarcomatous product of miRNA-4512 or its congener.
Further, described osteosarcoma is chondroblastic osteosarcoma.
Further, described product is by measuring in sample the expression of miRNA-4512 or its congener to diagnose kindred Tumor.
Further, described product includes by using qRT-PCR, marking hybridization, in situ hybridization, hybridization array, gene core Sheet or new-generation sequencing detect the level of miRNA-4512 or its congener to diagnose osteosarcomatous product.
Wherein, miRNA-4512 or its congener down-regulated expression in osteosarcoma tissue, compared with the control, work as blood samples of patients In miRNA-4512 when significantly reducing, it can be determined that patient suffers from osteosarcoma or has the osteosarcomatous risk of trouble.
Further, described product includes chip and/or test kit.Wherein, described chip includes solid phase carrier and fixes Oligonucleotide probe on described solid phase carrier, described oligonucleotide probe includes specifically corresponding to recited above The part or all of sequence of miRNA-4512.Described test kit includes the expression water for detecting miRNA-4512 recited above Flat reagent.
Further, described test kit includes the primer pair expanding miRNA-4512, sequence such as SEQ ID NO.2 and SEQ ID Shown in NO.3.
The invention provides the osteosarcomatous product of a kind of diagnosis, described product can be by miRNA-4512 in detection sample Or the level of its congener diagnoses osteosarcoma.
Further, described sample includes blood, urine, cerebrospinal fluid, tissue fluid, perspiration, saliva, tear.The present invention's In detailed description of the invention, described sample is blood.
Further, described product includes chip and/or test kit.Wherein, described chip includes solid phase carrier；And it is fixing Oligonucleotide probe on described solid phase carrier, described oligonucleotide probe includes specifically corresponding to recited above The part or all of sequence of miRNA-4512.Described test kit includes the expression water for detecting miRNA-4512 recited above Flat reagent.
Further, described test kit includes primer and/or the probe of miRNA-4512.Described test kit also includes for existing Have in technology it has been reported that the primer of diagnosis osteosarcoma miRNA and/or probe.By detection primer and/or the spy of multiple miRNA Pin is placed in same reagent box and is also contained in the present invention's by the multiple miRNA osteosarcomatous situation of index Combining diagnosis of detection Within protection domain.
Described chip (i.e. microarray) comprises for the specific one group of oligonucleotide of miRNA-4512 (such as few deoxynucleoside Acid) probe.By using this microarray, can then make it with micro-by reverse transcription RNA to produce one group of target oligodeoxynucleotide Probe oligodeoxynucleotide hybridization on array, thus produce hybridization or express spectra, measure multiple Microrna in biological sample Expression.The specific probe oligonucleotides of miRNA or probe oligonucleotides specific to miRNA refer to have through choosing Select the probe widow of the sequence that the reverse transcription thing with specific miR-96 gene products thereof or with this specific miR-96 gene product hybridizes Nucleotide.
In the detailed description of the invention of the present invention, described miRNA-4512 is ripe miRNA-4512, and nucleotide sequence is such as Shown in SEQ ID NO.1 in sequence table.
It should be known that the miRNA-4512 of the present invention includes the function equivalent of composing type nucleic acid molecules, i.e. variant, " become Body " refer to corresponding wild type miR-96 gene product, there is the homogeneity less than 100% and there is corresponding wild type miRNA The one or more bioactive miRNA of gene outcome.This type of bioactive example includes but not limited to, sends out with osteosarcoma The suppression of the cell processes (such as, cell differentiation, cell growth, cell death) of hair growth promoting exhibition.These variants include specie variants With the variant produced due to one or more sudden changes (such as, replace, lack, insert) of miR-96 gene.Some embodiment party In case, variant has at least about 70% with corresponding wild type miR-96 gene product, 75%, 80%, 85%, 90%, 95%, The homogeneity of 98% or 99%.It shows the function that complete miRNA-4512 nucleic acid molecules is identical, and they may pass through nucleotide The disappearance of residue, replace or insert and suddenly change.
Those skilled in the art know, and in order to ensure the stability of miRNA, can increase in one end of miRNA or two ends and protect Protecting property base, such as TT, it is possible to modify miRNA base, but does not affect the function of miRNA.Therefore, people in the art Member knows, and under conditions of not affecting miRNA-4512 function, miRNA-4512 carries out base modification or increases at two ends Within the sequence that base obtains is also contained in protection scope of the present invention.
The miRNA-4512 nucleic acid molecules of the present invention can be presented in strand or double-strand.Ripe miRNA-4512 Main in single stranded form, and miRNA-4512 precursor is part complementation certainly, to form duplex structure.The nucleic acid molecules of the present invention Can be with the form being RNA, DNA, PNA, LNA.
According to the nucleotide sequence shown in SEQ ID NO.1, the RNA marking for giving miR-96 gene product can be generated The proper probes of hybridization, includes but not limited to, have at least about 70% with target miR-96 gene product, 75%, 80%, 85%, 90%, 95%, 98%, 99% or the probe of complete complementary.DNA and RNA of labelling uses conventional method to prepare, and such as nucleic acid is visited Pin following substances labelling, such as radionuclide 3H, 32P, 33P, 14C or 35S, heavy metal, can play the special of tagged ligand Property combine part such as biotin, avidin or antibody etc. to member's function, fluorescence molecule, chemiluminescent molecule, enzyme Deng.
By nick-translation method or random priming, probe can be marked as high specific activity, the latter is from single stranded DNA Or the system of selection of the probe from the 32P-labelling of RNA templated synthesis high specific activity.Such as, by using according to nick-translation method Efficient radioactive nucleotide replaces existing nucleotide, can prepare specific activity and substantially exceed the 32P-of 108cpm/ microgram The nucleic probe of labelling.Then by making the filter membrane of hybridization be exposed to photographic film, the autoradiography inspection hybridized can be carried out Survey.Densitometric scan to the photographic film that the filter membrane of hybridization exposes, can provide the accurate survey of miR-96 gene transcript levels Amount.
Oligonucleotide probe of the present invention may also include in prior art it has been reported that can be used for diagnose bone The oligonucleotide probe of the miRNA of sarcoma.The detection probe of multiple miRNA is placed multiple by detection on the same chip Within the osteosarcomatous situation of miRNA index Combining diagnosis is also contained in protection scope of the present invention.Reagent described above also includes For in prior art it has been reported that the primer of diagnosis osteosarcoma miRNA and/or probe.Detection primer by multiple miRNA And/or probe is placed in same reagent box and is also contained in by the multiple miRNA osteosarcomatous situation of index Combining diagnosis of detection Within protection scope of the present invention.
The preparation of described miRNA chip can use the common manufacturing method of biochip known in the art, such as, as Really solid phase carrier uses modification slide or silicon chip, and 5 ' ends of probe, can be by oligonucleotide containing amido modified poly-dT string Probe is configured to solution, then uses point sample instrument being modified on slide or silicon chip by its point, is arranged in predetermined sequence or array, Then pass through to stand overnight to fix, so that it may obtain the miRNA chip of the present invention.If nucleic acid is without amido modified, then its system Preparation Method can also refer to: " the gene diagnosis technology-on-radiation workbook " of Wang Shenwu chief editor；J.L.erisi, V.R.Iyer, P.O.BROWN.Exploring the metabolic and genetic control of gene Expression on a genomic scale.Science, 1997；278:680 and Ma Li people, Jiang Zhonghua edits. biological core Sheet. Beijing: Chemical Industry Press, 2000,1-130.
The miRNA-4512 of the present invention can be natural or synthetic, or use can express miRNA- The vector-transfected cell of the DNA fragmentation of 4512 obtains.
Carrier for expression of eukaryon can be any suitable expression vector, include but not limited to pCMV-Myc expression vector, PcDNA3.0 expression vector, pcDNA3.1 expression vector, pEGFP expression vector, pEF Bos expression vector, pTet expression vector, PTRE expression vector or carrier engineered on the basis of known expression vector, such as pBin438, pCAMBIA1301 Deng.
The DNA fragmentation that can express miRNA-4512 can obtain in the following way: from miRNA data base (http://microrna.sanger.ac.uk/sequences/) finds miRNA-4512 position on genome and concrete Sequence information, determines the position of the initial miRNA of miRNA-4512 according to genome sequence, in miRNA-4512 initial miRNA position Design the sequence in the middle of specific primer, amplimer in the upstream and downstream 500-800bp interval put and can obtain expression miRNA- The DNA fragmentation of 4512.
In the present invention, " array " or " microarray " is that hybridised arrays original paper is ordered in substrate, described hybridization battle array Row original paper such as polynucleotide probe (such as oligonucleotide) or bonding agent (such as antibody).Described substrate can be solid-based Matter, such as, glass or silicon dioxide slide, pearl, fibre optics binding agent or semi-solid matrix, such as nitrocellulose filter.Core Nucleotide sequence can be any arrangement of DNA, RNA or therein.Microarray can be from the gene-spy being produced from known miRNA sequence Prepared by different oligonucleotide probe.Array can be a kind of containing living containing 2 kinds of different oligonucleotide probes of each miRNA The mature sequence of property, and another kind is specific to the precursor of miRNA.Array also can be containing comparison, such as with human ortholog One or more mouse sequence that the most several bases are different, it can be as the comparison of hybridization stringent condition.From two species TRNA also can be imprinted on microchip, it is provided that the inside of specific hybridization, metastable positive control.One of Non-specific hybridization Or multiple suitable comparison may also comprise on microchip.
" bioactive fragment " of miR-96 gene product refers to, have one of corresponding wild type miR-96 gene product or The RNA fragment of multiple bioactive miR-96 gene products.As mentioned above it is possible, this type of bioactive example include but not It is limited to, the suppression of osteosarcomatous proliferation process.In certain embodiments, bioactive fragment is at least about in length 5,7,10,12,15 or 17 nucleotide.In particular embodiments, can be by the miR-96 gene product separated and one or many Plant other anticancer therapy combination to use to experimenter.Suitable anticancer therapy includes but not limited to, chemotherapy, radiation are treated Method and combination (such as, chemicotherapy).
Term " miR-96 gene product " or " congener " they can be any products transcribed from miR-96 gene and obtain, including Primary transcript, primary miRNA, pre-miRNA, miRNA*, ripe miRNA or its variant.
Advantages of the present invention and beneficial effect:
Present invention firstly discovers that the expression of miRNA-4512 occurs development relevant, by detection to osteosarcomatous The level of miRNA-4512, it can be determined that whether patient suffers from osteosarcoma or suffer from osteosarcomatous risk.
The invention provides the osteosarcomatous product of a kind of diagnosis, this product can diagnose in early days in osteosarcoma morbidity, Instruct doctor to carry out early intervention, improve survival rate and the quality of life of patient.
Accompanying drawing explanation
Fig. 1 show utilize high-flux sequence detect miRNA-4512 expression in Patients with Osteosarcoma blood；
Fig. 2 show utilize qPCR detect miRNA-4512 expression in Patients with Osteosarcoma blood.
Detailed description of the invention
Further illustrating the present invention below in conjunction with specific embodiment, embodiments of the invention are only used for explaining the present invention, It is not intended to limit protection scope of the present invention.
Experimental technique used in following embodiment if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, the most commercially obtain.
The screening of the miRNA that embodiment 1 is relevant to osteosarcoma
1, sample acquisition: collect 10 example chondroblastic Patients with Osteosarcomas and 10 normal persons.Experimenter requires on an empty stomach At least 12h, under m seq 7:00～8:00 room temperature, extraction 10ml venous blood in ethylenediaminetetraacetic acid (EDTA) anticoagulant tube, Extract PERIPHERAL BLOOD MONONUCLEAR CELL PBMCs, add 1ml Trizol reagent (Invitrogen company), fully mix ,-80 DEG C of guarantors Deposit specimen, extract for RNA.All of blood sample and pathological examination should be true and reliable, study and ratify through Ethics Committee, patient Informed consent.
2, the extraction of blood mononuclear cell RNA
The RNA using Invitrogen company extracts test kit and extracts total serum IgE.Step is as follows:
(1) 1ml Trizol is first added in 1 × 107In cell, if freeze-stored cell is directly added into Trizol, it is not required to thaw, blows Breaking solution, rear chamber is gentle and quiet puts 5-10min.
(2) adding 0.2ml chloroform (three chloromethane gastral cavitys), acutely shake 15s, room temperature stands 2-3min.
(3) at 4 DEG C, 12000g is centrifuged 15min.
(4) the careful sucking-off supernatant water 500 μ l that make an appointment move into another centrifuge tube (being careful not to be extracted into albumin layer), add 500 μ L isopropanol (special), reverse mixing, room temperature stands 10min.
(5) 4 DEG C of 12000g are centrifuged 10min, remove supernatant, needle point size whiteness seen from bottom.
(6) add 1ml 70% ethanol and rotate washing, clean isopropanol.
(7) 4 DEG C of 7500g are centrifuged 5min, and dry in the air after removing ethanol (as far as possible blotting only) with rifle head 5-10min, the most dry, no Then it is difficult to dissolve, is positioned over-70 DEG C of preservations.
3, the quality analysis (NanoDrop1000 spectrophotometer) of RNA sample
NanoDrop2000 spectrophotometer detection RNA sample, the sample requirement of RNA-seq order-checking: OD260/OD280 1.8。
The RNA of said extracted carries out agarose gel electrophoresis, and Agilent 2100 (RNA 6000 Nano kit) detects RNA sample quality, observes on gel imaging instrument, takes pictures, and preserves image, it is desirable to 28S:18S >=1；RIN value 7.0.
4, SRNA library construction
Experiment uses Illumina TruSeq Small RNA test kit to build library, reclaims length 18-in total serum IgE 30nt RNA, after becoming singly-bound cDNA, cDNA to expand by RT-PCR reverse transcription, reclaims cDNA product, builds up tiny RNA s library.
5, order-checking
Use llumina Hiseq2500/Miseq second filial generation high throughput sequencing technologies that mRNA and miRNA is checked order, By removing joint, going low quality, the process such as depollute to complete the process of data, obtain final data.
6, result:
Carry out t-test after miRNA initial data being carried out background correction by transcript profile data analysis software and obtain P value, Then Fisher inspection is utilized to merge P value, the miRNA of screening differential expression.Set p value ＜ 0.01 and log2(Fold_ Change) absolute value >=3 of normalized are as significance threshold value.As it is shown in figure 1, miRNA-4512 is at normal person and kindred Differential expression in tumor patient, significantly lowers (P < 0.05) in chondroblastic Patients with Osteosarcoma blood.
The miRNA-4512 of embodiment 2 QPCR checking differential expression
1, miRNA-4512 is selected to carry out large sample QPCR checking according to the testing result of miRNA chip.According to embodiment 1 In sample collection mode select normal person and each 60 examples of chondroblastic osteosarcoma sample.
2, RNA extracts process with embodiment 1.
3, reverse transcription:
1) by many to the total serum IgE template of 10pg-1 μ g and 2 μ l 10 × buffer, 2 μ l dATP (10mM), 0.5 μ l polyA Poly-enzyme, 0.5 μ l ribonuclease (RNase) inhibitor and deoxyribonuclease water (RNase free water) mixing, volume It is finally 20 μ l, hatches 1h for 37 DEG C.
2) reaction tube adds 1 μ l 0.5 μ g/ μ l Oligo (dT) specific RT primer, hatches 5min for 70 DEG C.
3) hatch at least 2min the most on ice, interrupt the secondary structure of RNA and primer.
4) by above-mentioned 20 μ l reactant mixtures and 4 μ l 5 × buffer, 1 μ l dNTP (10mM), 0.5 μ l M-MLV reverses Record enzyme, 0.5 μ l ribonuclease (RNase) inhibitor, 10 μ l polyA reaction mixtures and 4 μ l deoxyribonuclease water (RNase free water) mixes, and hatches 1h for 42 DEG C.
4, QPCR reaction:
1) design of primers
The primer of amplification miRNA-4512
Forward primer: CAGGGCCTCACTGTATCGCCCA (SEQ ID NO.2)
Reverse primer: GTGCAGGGTCCGAGGT (SEQ ID NO.3)
The primer of amplification U6snRNA
Forward primer: CTCGCTTCGGCAGCACA (SEQ ID NO.4)
Reverse primer: AACGCTTCACGAATTTGCGT (SEQ ID NO.5)
2) PCR reaction system is prepared according to table 1:
Wherein, SYBR Green polymerase chain reaction system is purchased from Invitrogen company.
Table 1PCR reaction system
Volume
SYBR Green polymerase chain reaction system 12.5μl
Forward primer 1μl
Reverse primer 1μl
CDNA template 2μl
ddH2O 8.5μl
Cumulative volume 25μl
3) PCR reaction condition: 95 DEG C of 10min, (95 DEG C of 15s, 60 DEG C of 60s) × 45 circulations.Using SYBR Green as Fluorescent marker, reacts at the Light enterprising performing PCR of Cycler quantitative real time PCR Instrument, using U6snRNA as reference gene, logical Cross melt curve analysis analysis and electrophoresis determines that purpose band, Δ Δ CT method carry out relative quantification.
5, result
As in figure 2 it is shown, compared with normal human blood, the expression of the miRNA-4512 in Patients with Osteosarcoma blood is notable Reduce, consistent with high-flux sequence result (P < 0.05).
The explanation of above-described embodiment is only intended to understand the method for the present invention and core concept thereof.It should be pointed out that, for this For the those of ordinary skill in field, under the premise without departing from the principles of the invention, it is also possible to the present invention is carried out some improvement And modification, these improve and modify also by the protection domain falling into the claims in the present invention.

Claims (10)

1.miRNA-4512 or the application in preparation diagnoses osteosarcomatous product of its congener.
Application the most according to claim 1, it is characterised in that described osteosarcoma is chondroblastic osteosarcoma.
Application the most according to claim 1 and 2, it is characterised in that described product is by measuring miRNA-4512 in sample Or the expression of its congener is to diagnose osteosarcoma.
Application the most according to claim 3, it is characterised in that described product includes by using qRT-PCR, the marking miscellaneous Friendship, in situ hybridization, hybridization array, gene chip or new-generation sequencing detect the level of miRNA-4512 or its congener to examine Disconnected osteosarcomatous product.
Application the most according to claim 3, it is characterised in that described product includes chip and/or test kit.
Application the most according to claim 5, it is characterised in that described test kit includes the primer expanding miRNA-4512 Right, sequence is as shown in SEQ ID NO.2 and SEQ ID NO.3.
7. one kind diagnose osteosarcomatous product, it is characterised in that described product can by detection sample in miRNA-4512 or The level of its congener diagnoses osteosarcoma.
Product the most according to claim 7, it is characterised in that described sample include blood, urine, cerebrospinal fluid, tissue fluid, Perspiration, saliva, tear.
Product the most according to claim 7, it is characterised in that described product includes chip and/or test kit.
Product the most according to claim 9, it is characterised in that described test kit includes the primer for miRNA-4512 And/or probe.
CN201610616388.7A 2016-07-29 2016-07-29 The miRNA 4512 application in osteosarcoma diagnoses Pending CN106148535A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610616388.7A CN106148535A (en) 2016-07-29 2016-07-29 The miRNA 4512 application in osteosarcoma diagnoses

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610616388.7A CN106148535A (en) 2016-07-29 2016-07-29 The miRNA 4512 application in osteosarcoma diagnoses

Publications (1)

Publication Number Publication Date
CN106148535A true CN106148535A (en) 2016-11-23

Family

ID=57328075

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610616388.7A Pending CN106148535A (en) 2016-07-29 2016-07-29 The miRNA 4512 application in osteosarcoma diagnoses

Country Status (1)

Country Link
CN (1) CN106148535A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105441565A (en) * 2016-01-04 2016-03-30 杨祚璋 miRNA regarding as osteosarcoma treatment target
CN105506156A (en) * 2016-01-29 2016-04-20 北京泱深生物信息技术有限公司 Molecular marker for diagnosing osteosarcoma
CN106191264A (en) * 2016-07-21 2016-12-07 杨祚璋 Osteosarcomatous miRNA diagnosis marker

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105441565A (en) * 2016-01-04 2016-03-30 杨祚璋 miRNA regarding as osteosarcoma treatment target
CN105506156A (en) * 2016-01-29 2016-04-20 北京泱深生物信息技术有限公司 Molecular marker for diagnosing osteosarcoma
CN106191264A (en) * 2016-07-21 2016-12-07 杨祚璋 Osteosarcomatous miRNA diagnosis marker

Similar Documents

Publication Publication Date Title
JP5755569B2 (en) How to detect lung cancer
US20090239815A1 (en) Novel human microRNAs associated with cancer
CN107312852A (en) Myocardial infarction diagnosis mark compositions
CN107475440A (en) A kind of application of blood plasma excretion body biomarker in breast cancer diagnosis
CN107586842A (en) A kind of biomarker for clear cell carcinoma of kidney diagnosis and treatment
CN106191264B (en) The miRNA diagnosis marker of osteosarcoma
CN108624693B (en) MiR-577 is preparing the application in diagnosis of nephropathy marker
CN105506156A (en) Molecular marker for diagnosing osteosarcoma
CN105154541A (en) Application of miRNA to diagnosis and treatment of acute myelogenous leukemia
CN107475441A (en) It is a kind of to predict reactive biomarker of the patient with breast cancer to AT scheme new adjuvant chemotherapies
CN107312851A (en) Myocardial infarction biomarker miR 1283
CN105063052B (en) Acute myeloid leukemia miRNA markers
CN107058579A (en) Adenocarcinoma of lung related miRNA, composition and its application
CN104774966A (en) Lung adenocarcinoma miRNA marker
CN112430663B (en) Biomarker for diagnosis and treatment of bladder cancer and application thereof
CN111073981B (en) Application of circular RNA circEMB-003 as colorectal cancer marker
CN106148535A (en) The miRNA 4512 application in osteosarcoma diagnoses
CN101365800B (en) Composition and method for determination of CK19 expression
US11021756B2 (en) MiRNA markers for the diagnosis of osteosarcoma
CN110205385A (en) Molecular marker and its application for adenocarcinoma of lung diagnosis
CN111424096A (en) Biomarker related to occurrence and development of gastric adenocarcinoma
CN105821131B (en) Osteosarcoma miRNA marker
CN109371136A (en) One kind lncRNA relevant to adenocarcinoma of lung and its application
CN106011294A (en) Use of miRNA in diagnosis on chondroblast type osteosarcoma
CN111808952B (en) Tumor lncRNA marker and application thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
CB02 Change of applicant information
CB02 Change of applicant information

Address after: Room 1210, Building 3, Ronghua Xintai Building, 10 Ronghua South Road, Yizhuang Economic and Technological Development Zone, Daxing District, Beijing

Applicant after: Beijing Yang Shen biology information technology company limited

Address before: 100080 Beijing city Haidian District Shanyuan Street No. 1 cubic court building room 3103

Applicant before: Beijing Yang Shen biology information technology company limited

RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20161123