CN106148496A - A kind of test kit detecting Her2 gene and application thereof - Google Patents

Abstract

The invention discloses a kind of test kit detecting Her2 gene and application thereof.Specifically, the invention discloses a kind of Her2 gene detecting kit, described test kit contains container, and laying respectively in container: Her2 gene-specific primer pair, described specific primer is to as shown in SEQ ID NO.:1 (forward ACAACCAAGTGAGGCAGGTC) and SEQ ID NO.:2 (reverse GTATTGTTCAGCGGGTCTCC)；Probe is detected, shown in Her2 gene-specific probe sequence such as SEQ ID NO.:3 (CCCAGCTCTTTGAGGACAAC) with Her2 gene specific.The copy number of the Her2 gene in high specific of the present invention, high sensitivity, rapidly mensuration pathology sample, can be used for auxiliary or replaces the current diagnostic method to Her2.

Description

A kind of test kit detecting Her2 gene and application thereof

Technical field

The invention discloses a kind of test kit for detecting Her2 gene relative expression quantity.Specifically, institute The test kit stated contains specific primer and the detection probe of Her2 gene, can be used for quantitative fluorescent PCR Method and calculating detection Her2 gene expression amount change.

Background technology

Incidence gastric cancer rate and mortality rate all occupy malignant tumor prostatitis, the whole world, and within overall 5 years, survival rate is 10%-40%. Accept the patients with advanced gastric cancer of radical excision, middle position Overall survival about 24 months, and Palliative Hepatectomy The latter is only 8.1 months, for performing the operation or occur the patient of transfer, the middle position that combined chemotherapy is obtained Overall survival is only about 12 months.In recent years, the novel therapeutic means with molecular targeted therapy as representative by Gradually convert to clinical practice from laboratory.With regard to gastric cancer molecular targeted therapy target spot select and drug development and Speech, studies more person at present, in addition to anti-tumor angiogenesis drug, also includes Her/erbB receptor family, The existing medicine (Herceptin-Herceptin) for above-mentioned target spot is in I, II and the clinical research of III phase Stage shows good efficacy.Owing to the clinical patients with gastric cancer of major part is still difficult to early discovery, examining of gastric cancer Disconnected also it be dependent on gastroscopy and be diagnosed as master.

Her2 receptor (also referred to as c-erbB-2, HER2/neu) is that molecular weight is 185kD, has tyrosine kinase The transmembrane protein of activity, its encoding gene is positioned human chromosome 17q21, is EGF-R ELISA man The member of race.HER2 Overexpression may result in cell hyperproliferation and phenotype vicious transformation.Research shows Having patient with breast cancer's Her2 Overexpression of 30%, this kind of patient tumors grade malignancy is high, recur and turn Move occur early, poor prognosis, some chemotherapeutics is had opposing, and it was found that HER2 Overexpression with The disease free survival of patient is relevant with total life cycle.The biomarker of tumor is reacted as oncotherapy Important prediction index is one of main purpose of oncobiology research.

Determination for Her2 yin and yang attribute still relies primarily on SABC IHC method and fluorescence clinically Immuning hybridization FISH method determines.IHC method antagonist requires the highest, and for judging with the strongest subjectivity Judge the impact of the interference of consciousness and No. 17 many bodies of chromosome, often result in the difference of testing result；FISH Although method eliminates No. 17 chromosome Multi-body disturbance, but it is expensive, fluorescent quenching cause result without Method preserves term, and technology requires higher, and time-consumingly.The inspection policies of Her2 is to be carried out by IHC at present Primary dcreening operation, result is that the weak positive (++) person is FISH again and is confirmed, this inspection policies has obtained in Britain to be recommended .But still do not have a kind of method can be universally accepted as the standard method of assessment HER2 at present.

Therefore, this area in the urgent need to exploitation a kind of can accurate quantitative analysis or the side of qualitative detection Her2 gene Method.

Summary of the invention

The invention provides and a kind of be applicable to the high specific of Her2 gene by fluorescence quantitative PCR, high sensitivity Primer and probe combinations.

First aspect present invention, it is provided that a kind of Her2 gene detecting kit, described test kit contains appearance Device, and lay respectively in container:

Her2 gene-specific primer pair, described specific primer is to such as SEQ ID NO.:1 (forward ACAACCAAGTGAGGCAGGTC) and SEQ ID NO.:2 (reverse GTATTGTTCAGCGGGTCTCC) shown in； With

Her2 gene specific detection probe, Her2 gene-specific probe sequence such as SEQ ID NO.: Shown in 3 (CCCAGCTCTTTGAGGACAAC).

In another preference, described Her2 gene source in mammal, it is preferred that derive from mice, Rat, people.

In another preference, the Gene ID:2064 of described Her2 gene, (NCBI Reference Sequence:NM_001289936.1)

In another preference, described test kit possibly together with crt gene specific primer to and specificity inspection Probing pin.

In another preference, described test kit detects related reagent possibly together with optional PCR, as mastermix, Distilled water etc..

In another preference, described PCR detection related reagent is not particularly limited, and can be any PCR inspection Amplification required for survey, indicator, can obtain, such as Taqman GEMM mastermix from commercially available source.

In another preference, the reporter group of the specificity detection probe of described crt gene and Her2 gene Reporter group is different.

In another preference, the specific primer of described crt gene is to sequence such as SEQ ID NO.:4 (just To GCTGATGATCATAAAGCCACAGGTA) and SEQ ID NO.:5 (reverse TGGTGCTCAGGCAGTGC) institute Show；And/or shown in described specificity detection probe sequence such as SEQ ID NO.:6 (TGCTGCAATAGGCGG).

In another preference, described one end in specificity detection probe is marked with fluorescence generation group, separately One end is marked with fluorescent quenching group.

In another preference, 5 ' end flag F AM fluorophors of described detection probe, and the 3 ' of detection probe End labelling MGB fluorescent quenching group.

In another preference, described detection probe can be specific binding with the nucleotide sequence of Her2 gene.

In another preference, the concentration of described specific primer is 2.5-8uM/ul, is preferably 3-5uM/ul, such as 4.5uM/ul.

In another preference, the concentration of described specificity detection probe is 0.5-5uM/ul, is preferably 1-2uM/ul。

Second aspect present invention, it is provided that Her2 gene copy counting method in the detection sample of a kind of nondiagnostic, Including step:

Her2 gene Relative copy number method in the detection sample of a kind of nondiagnostic, it is characterised in that include step Rapid:

I () provides specific primer that a reaction system, described reaction system contain Her2 gene to special The specific primer of property probe and crt gene to and crt gene；

(ii) utilize the reaction system in (i) that Her2 gene and crt gene are carried out PCR amplification；

(iii) fluorescence signal that the specific probe of described Her2 gene and crt gene sends is measured respectively, Thus detect the Her2 gene Relative copy number relative to crt gene；

Wherein, described Her2 specific probe is as shown in SEQ ID NO.:3；Described Her2 gene Specific primer is to as shown in SEQ ID NO.:1 (Fw) and SEQ ID NO.:2 (Rv).

In another preference, described crt gene includes Cep17 gene.

In another preference, the specific primer of described crt gene (Cep17 gene) is to such as SEQ ID NO.: 4 (forward GCTGATGATCATAAAGCCACAGGTA) and SEQ ID NO.:5 are (reversely TGGTGCTCAGGCAGTGC) shown in；And/or described specific probe sequence such as SEQ ID NO.: Shown in 6 (TGCTGCAATAGGCGG).

In another preference, described is determined as quantitatively or qualitative determination.

In another preference, described pcr amplification reaction condition is as follows:

95 DEG C 10 minutes；92 DEG C 15 seconds, 60 DEG C 60 seconds, 40 circulations.

In another preference, described sample includes tissue samples or blood sample.

In another preference, described tissue samples includes tumor tissues or cancer beside organism.

In another preference, described tumor tissues includes stomach organization, breast cancer tissue, colorectal cancer Tissue.

Third aspect present invention, it is provided that the purposes of test kit described in first aspect present invention, for diagnosis or The expression of Her2 gene in nondiagnostic detection sample.

In another preference, described detection includes diagnostic assays and nondiagnostic detection.

Fourth aspect present invention, it is provided that Her2 gene Relative copy number and/or judgement in a kind of detection sample Whether individual internal Her2 gene is positive method, including step:

I () provides specific primer that a reaction system, described reaction system contain Her2 gene to special The specific primer of property probe and crt gene to and crt gene；

(ii) utilize the reaction system in (i) that Her2 gene and crt gene are carried out PCR amplification；

(iii) fluorescence signal that the specific probe of described Her2 gene and crt gene sends is measured respectively, Thus detect the Her2 gene Relative copy number relative to crt gene；

Wherein, described Her2 specific probe is as shown in SEQ ID NO.:3；Described Her2 gene Specific primer is to as shown in SEQ ID NO.:1 (Fw) and SEQ ID NO.:2 (Rv)；

In another preference, when Her2/Cep17 copy number ratio >=2, it is judged that Her2 gene is sun Property.

In should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the present invention and below (as implemented Example) in can be combined with each other between each technical characteristic of specifically describing, thus constitute new or preferred skill Art scheme.As space is limited, the most tired at this state.

Accompanying drawing explanation

Fig. 1 is the PCR amplification curve of test kit detection sample, abscissa PCR cycle number Cycles in figure, Vertical coordinate is the fluorescent value Fluorescence (dRn) of amplified reaction.1A is stomach normal structure matched group The Her2 (red or light grey (under gray scale)) of fluorescence quantitative PCR detection and CEP17 (blue or Dark grey (under gray scale)) gene amplification curve.1B is IHC and the fluorescence of the gastric cancer Her2 assaypositive tissue of FISH qualification The Her2 (red) of quantitative PCR detection and CEP17 (blue) gene amplification curve.1C is through IHC The Her2 (red) and CEP17 of fluorescence quantitative PCR detection with the gastric cancer Her2 negative tissue that FISH identifies (blue) gene amplification curve.

Fig. 2 is present invention value based on fluorescence quantitative PCR detection Her2 gene copy number quantitative Analysis Δ Δ Ct Method schematic diagram.

Fig. 3 is to design two the Her2 gene test probes filtered out in the present invention, based on quantitative fluorescent PCR Detection amplification curve diagram.Abscissa PCR cycle number Cycles in figure, vertical coordinate is the fluorescent value of amplified reaction Fluorescence(dRn).3A is middle probe SEQ ID NO.:3 of the present invention and positive control probe detection Gene gained amplification curve.3B is probe SEQ ID NO.:7 and positive control probe detection gene gained expands Increase curve.

Detailed description of the invention

The present inventor is through extensively in-depth study, by having screened the PCR primer of a large amount of Her2 gene, Filter out a pair can the primer pair of efficient amplification Her2 gene, this primer is clear to produced amplified band Clear without disperse, additionally, the present inventor is also by further Her2 gene probe being designed and screened, And obtain the fluorescent probe shown in SEQ ID NO.:3, its combination with primer pair of the present invention can effectively, The copy number of mensuration Her2 gene, and sensitivity exactly and specificity are high, combine with IHC or FISH The respective goodness of fit be above IHC and FISH combine the goodness of fit, it is possible to as FISH or IHC clinically examine That surveys Her2 gene effectively supplements even alternative method.On this basis, the present invention is completed.

Her2 gene

Her2 receptor (also referred to as c-erbB-2, HER2/neu) is that molecular weight is 185kD, has tyrosine kinase The transmembrane protein of activity, its encoding gene is positioned human chromosome 17q21, is EGF-R ELISA man The member of race.HER2 Overexpression may result in cell hyperproliferation and phenotype vicious transformation.Research shows Having patient with breast cancer's Her2 Overexpression of 30%, this kind of patient tumors grade malignancy is high, recur and turn Move occur early, poor prognosis, some chemotherapeutics is had opposing, and it was found that HER2 Overexpression with The disease free survival of patient is relevant with total life cycle.The biomarker of tumor is reacted as oncotherapy Important prediction index is one of main purpose of oncobiology research.

Monoclonal antibody regulates tumor growth, monoclonal antibody Herceptin by transferring under HER2 Trastuzumab (Herceptin) can the antagonism HER-2/neu albumen of directly selecting property, thus suppress tumor Growth, it has high affinity, highly targeting, only works cancerous cell, and to normal cell Killing less, be the present age breast carcinoma targeted therapy representative drugs.It is applicable to the breast of Her2 process LAN Adenocarcinoma and patients with gastric cancer.In a clinical I phase is studied, the metastatic breast cancer of 45 example HER2 process LAN Patient, is safe with Herceptin, have objective reaction for 11.6%, stable disease is 37%.From 2010, Europe and the U.S. successively approval chemotherapy combined used Herceptin treatment HER2 positive stomach and stomach Esophagogastric junction cancer patient.Gastric cancer Her2 is expressed and gene amplification testing result is advanced gastric carcinoma Her2 accurately Targeted therapy patient screening and the premise of outcome prediction.But, the sine qua non of Herceptin treatment It it is the process LAN (positive) of Her2.

Can be used for the Her2 gene source of the present invention in mammal, preferably derive from rat, mice, Or people.For example, it is preferable to the Genbank ID of Her2 gene be 2064.

Primer and probe

As used herein, term " primer of amplification Her2 gene ", " primer of the present invention " refer to so Primer (to), its amplified production amplified has the complementary strand sequence of Her2.

Through a large amount of primers (to) screening, the present inventor invent, such as SEQ ID NO.:1 and SEQ ID NO.: Primer shown in 2 is to amplifying Her2 gene order efficiently, and the product band amplified is clear Without disperse.

In order to effectively measure the product expanded further, the present inventor devises a series of Her2 gene Fluorescent detection probe, such as shown in SEQ ID NO.:7 (TATGCCCTGGCCGTGCTAGACAAT), and Eventually screening obtains the molecular probe of high specific, hypersensitivity, its sequence as shown in SEQ ID NO.:3, Probe of the present invention is made up of the single stranded nucleic acid molecule of fluorescent dye and quencher two ends covalent labeling respectively.Excellent Selection of land, 5 ' end flag F AM fluorophors of described detection probe, and 3 ' end labelling MGB of detection probe are glimmering Optical quenching group.

By the primer shown in SEQ ID NO.:1-2 and the probe application shown in SEQ ID NO.:3 in Her2 The copy number detection of gene, it is found that contrast primer+probe combinations cannot obtain result or result is special Property is poor, and primer of the present invention and probe combinations then can detect the knot of Her2 delicately, with high specificity Really.

Can be used for the specific primer of crt gene of the present invention to sequence such as SEQ ID NO.:4 (forward And SEQ ID NO.:5 (reverse TGGTGCTCAGGCAGTGC) institute GCTGATGATCATAAAGCCACAGGTA) Show；And/or shown in described specificity detection probe sequence such as SEQ ID NO.:6 (TGCTGCAATAGGCGG).

Analytical calculation

Adopt owing to needing to judge that the process LAN of Her2, those skilled in the art typically require in clinical diagnosis By the relative amount of Her2/CEP17, therefore, the present invention the most preferably uses CEP17 as comparison (internal reference) Gene, thus judge whether target gene produces amplification.

Such as Her2 gene copy number is labeled as Ct-1, CEP17 gene copy number and is labeled as Ct-2, this Bright judge Her2 gene copy number by calculating Δ Δ Ct value, thus judge Her2 positive sample in gastric cancer. Δ Δ Ct=Δ Ct (gastric cancer sample)-Δ Ct (check sample)；Δ Ct (gastric cancer sample)=Ct-2 (gastric cancer Sample)-Ct-1 (gastric cancer sample)；Δ Ct (check sample)=Ct-2 (check sample)-Ct-1 (comparison Sample) (as shown in Figure 2).Δ Δ Ct < 0 is judged as that Her2 is expressed as feminine gender；Δ Δ Ct > 0 then judges The positive is expressed for Her2.

Test kit

The invention provides a kind of Her2 gene detecting kit, described test kit contains container, and difference It is positioned at container:

Her2 gene-specific primer pair, described specific primer is to such as SEQ ID NO.:1 (forward ACAACCAAGTGAGGCAGGTC) and SEQ ID NO.:2 (reverse GTATTGTTCAGCGGGTCTCC) shown in； With

Her2 gene specific detection probe, Her2 gene-specific probe sequence such as SEQ ID NO.: Shown in 3 (CCCAGCTCTTTGAGGACAAC).

Preferably, the present invention possibly together with possibly together with crt gene specific primer to and specificity detection probe； The specific primer of a kind of preferred crt gene is to sequence such as SEQ ID NO.:4 (forward GCTGATGATCATAAAGCCACAGGTA) and SEQ ID NO.:5 (reverse TGGTGCTCAGGCAGTGC) shown in； And/or shown in described specificity detection probe sequence such as SEQ ID NO.:6 (TGCTGCAATAGGCGG).

The concentration of test kit middle probe of the present invention and primer is not particularly limited, can be by those skilled in the art's root Determine according to required amplification efficiency.Preferably, the concentration of Her2 gene-specific primer of the present invention is 2.5-8uM/ul, preferably 3-5uM/ul, such as 4.5uM/ul, Her2 gene-specific probe of the present invention Concentration be 0.5-5uM/ul, preferably 1-2uM/ul.

Detection method

The invention provides a kind of Her2 gene Relative copy number method in nondiagnostic/diagnostic detection sample, Including step:

I () provides specific primer that a reaction system, described reaction system contain Her2 gene to special The specific primer of property probe and crt gene to and crt gene；

(ii) utilize the reaction system in (i) that Her2 gene and crt gene are carried out PCR amplification；

(iii) fluorescence signal that the specific probe of described Her2 gene and crt gene sends is measured respectively, Thus detect the Her2 gene Relative copy number relative to crt gene；

Wherein, described Her2 specific probe is as shown in SEQ ID NO.:1；Described Her2 gene Specific primer is to as shown in SEQ ID NO.:2 (Fw) and SEQ ID NO.:3 (Rv).

The crt gene that can be used for the present invention is not particularly limited, and is preferably the Cep17 (No. 17 that routine uses Chromosome centromere sequence) as crt gene.Certainly, those skilled in the art can also select other relatively Produce the gene order of many bodies less, if other gene orders of Her2 gene phase homologous chromosomes are as reference. Preferably measure the specific primer of crt gene (Cep17) to as shown in SEQ ID NO.:4-5, special Property probe is as shown in SEQ ID NO.:6.

The detection method of the present invention is applicable to quantitative fluorescent PCR, certainly may be used without step (i) and step , and use the verification method of standard PCR amplification product to carry out qualitative detection (ii).

The pcr amplification reaction condition that can be used for the present invention is not particularly limited, and can be the PCR of this area routine Reaction condition, it is preferable that described pcr amplification reaction condition is as follows:

95 DEG C 10 minutes；92 DEG C 15 seconds, 60 DEG C 60 seconds, 40 circulations.

The sample that can be used for the present invention includes tissue samples or blood sample.

In another preference, described tissue samples includes tumor tissues or cancer beside organism.

In another preference, described tumor tissues includes stomach organization, breast cancer tissue, colorectal cancer Tissue.

Beneficial effects of the present invention

The present invention, with regard to the feature of quantitative real time PCR Instrument detection Her2 acceptor gene copy number, designs and has screened big Find after the combination of amount primer and probe, when using primer of the present invention and the probe can efficiently, expand with high specificity Going out Her2 gene, amplified production is clear, and the fluorescence signal that its detection obtains is the most noiseless, is applied to After clinical diagnosis, height higher and cheap, repeatable, makes pathology detection with the goodness of fit of prior art Accuracy strengthened, and medical treatment cost and expense can be substantially reduced, reduce the waste of medical resource.

Below in conjunction with specific embodiment, the present invention is expanded on further.Should be understood that these embodiments are only used for The bright present invention rather than restriction the scope of the present invention.The experiment side of unreceipted actual conditions in the following example Method, generally according to normal condition, such as Sambrook et al., molecular cloning: laboratory manual (New York: Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to maker Condition proposed by business.Unless otherwise indicated, otherwise percentage ratio and number are percentage by weight and parts by weight.

The collection of embodiment 1 sample and information analysis

During this study sample is 2011 to 2013, the paraffin sample that gained achieves is collected by Long March hospital, Room temperature preserves.All samples is collected through individual consent, and according to Ethics Committee's approval protocol of hospital, Pathological diagnosis result confirms through more than two Pathology Doctors 's.All cases are adenocarcinoma, tumor tissues or mucosa Tissue accounts for more than the 85% of sample, and pathological diagnosis result confirms through more than two Pathology Doctors 's.Patient clinical Data includes age of onset, sex, tumor locus, lymphatic metastasis, intramural invasion, histo-differentiation and swells Tumor TNM (AJCC the 7th edition) by stages etc..

121 example sample altogether, including 120 example gastric cancer samples, 1 example normal control gastric tissue.Operation sample Put into liquid nitrogen for tumor tissues is removed from patient body and be stored in-80 DEG C, by Long March hospital tumor Section is prepared as the paraffin sample (FFPE sample) achieved.

Embodiment 2 DNA extracts

Sample is respectively by waiting test kit to carry out DNA extracting (Qiagen company), and in the present invention, sample uses The fresh paraffin-embedded tissue cut, takes 10um thickness, square (the area about 250mm of 16mm²) section 5-8 sheet, removes tissue unnecessary paraffin around.Remaining tissue room temperature preserves.

The fragment cut, with reference to Deparaffinization solution (Qiagen, 19093) explanation Paraffin sample is first dewaxed by book；Refer again to subsequently QIAamp DNA FFPE Tissue kit (Qiagen, 56404) extracting DNA.With determined by ultraviolet spectrophotometry OD260nm and OD280nm, calculate DNA concentration. -20 DEG C of preservations.

The screening of embodiment 3 primer

Screening obtains multipair alternative primer, (Fw:5 '-CCC AAC CAG GCG as shown in SEQ ID NO.:8-9 CAG AT-3′；Re:5 '-AGG GAT CCA GAT GCC CTT GTA-3 '), but with SEQ ID NO.: The product band that primer shown in 1 and SEQ ID NO.:2 is expanded is the most clear without disperse.

Embodiment 4 fluorescence quantitative PCR detection

4.1 experimental example

Configuration 4.5uM/ul Her2 gene PCR reaction stock solution (each 4.5uM forward primer SEQ ID NO.: 1 and downstream primer SEQ ID NO.:2,1uM probe SEQ ID NO.:3) and the CEP17 of 4.5uM/ul Reaction stock solution (each 4.5uM forward primer and downstream primer, 1uM probe) each 100ul is standby for gene PCR.

Draw the Her2 gene PCR reactant liquor of respective amount, CEP17 gene PCR reactant liquor, Taq in proportion (Her2 gene PCR reactant liquor and CEP17 gene PCR reactant liquor respectively take 2ul/ person-portion to enzyme, and Taqman is anti- Answer 2x MasterMix premixed liquid 5ul/ person-portion), the mixed liquor that abovementioned steps is obtained fully mix after by 9ul/ person-portion uses 12 road continuous liquid-moving machines mixed liquor to be separately added into 384 hole PCR reaction tubes line by line, often Hole 9ul, standby.

Respectively to adding Her2 gene PCR reactant liquor, CEP17 gene PCR reactant liquor and Taq enzyme mixing The reacting hole sample-adding of liquid, adds the gastric cancer FFPE tissue DNA that 1ul extracts, is separately added into 1ul normal simultaneously Gastric tissue sample, and add 1ul distilled water as NTC, after check that each hole amount of liquid is the most equal One.

Reverse mixing after using quantitative shrouding film (ABI, 4711971) shrouding, room temperature 1000g is centrifuged 1 minute. Put into (ABI, 7900Ht Fast) in quantitative PCR apparatus and do quantitative PCR.Program is: 95 DEG C 10 minutes； Rear operation 92 DEG C 15 seconds, 60 DEG C 60 seconds, 40 circulations.Her gene selects the Taqman of FAM labelling Probe detects, select Reporter be FAM and Quencher be MGB, use CEP17 gene simultaneously As reference, probe selects the probe of VIC labelling to detect, reselection Reporter be VIC and Quencher is the fluorescence signal of MGB.Collect data, carry out bioinformatic analysis.

4.2 reference examples

4.1 same procedure, difference are used to be to use other to design probe, the sequence of one of them such as SEQ ID Shown in NO.:7.

Embodiment 5 testing result computational analysis

5.1 Her2 gene copy number detections

Detection sample analyzes software by ABI, uses Automatic baseline, and arranges Manual ct Threshold be 0.2.Then the method for 4.1 and 4.2 is analyzed result.Each sample all has Two multiple holes, therefore calculate Average Ct values.Her2 gene copy number is labeled as Ct-1, CEP17 gene and copies Shellfish number is labeled as Ct-2, and the present invention judges Her2 gene copy number by calculating Δ Δ Ct value, thus judges stomach Her2 positive sample in cancer.Δ Δ Ct=Δ Ct (gastric cancer sample)-Δ Ct (check sample)；Δ Ct (stomach Cancer sample)=Ct-2 (gastric cancer sample)-Ct-1 (gastric cancer sample)；Δ Ct (check sample)=Ct-2 is (right In the same old way originally-Ct-1 (check sample) (as shown in Figure 2)).Δ Δ Ct < 0 is judged as that Her2 is expressed as the moon Property；Δ Δ Ct > 0 is then judged as that Her2 expresses the positive.

Result is visible, uses the method for 4.1 that the detection of Her2 gene copy number is calculated gained, and Her2 is positive Expressing sample is 51 examples.4.2 the most as shown in Figure 3 B, based on fluorescence quantitative PCR detection Her2 gene Amplification efficiency is low.

5.2 FISH with Her2 gene copy numbers compare

The Her2 of 120 example stomach organization samples expresses by fluorescence in situ hybridization (FISH) method and fluorescent quantitation PCR detection Her2 gene copy number method comparative result finds, the detection of FISH method finds that wherein 59 examples are Her2 Positive expression sample, 61 examples are that Her2 feminine gender expresses sample.

The Her2 positive sample meeting the detection of FISH method in the result of 5.1 is 46 examples, and goodness of fit is 77.97%, And Her2 feminine gender expression sample is 69 examples, the specimen meeting the detection of FISH method is 56 examples, and goodness of fit reaches 91.8%.Meeting total number of samples position 102 example of FISH method detection, goodness of fit is 85% (being shown in Table 1).

Table 1:FISH method and fluorescence quantitative PCR detection Her2 gene copy number comparative result.

5.3 IHC with Her2 gene copy numbers compare

120 example stomach organization samples by IHC method analyze time eliminate in the present invention 5 example gastroscopys with Post operation inspection does not meets sample, altogether 115 example.Wherein, Her2 expresses by immunohistochemistry (IHC) Method detection finds, wherein negative sample amounts to 63 examples (including that IHC=0 has 50 examples, IHC=1 has 13 examples)； It is 26 examples that IHC method detects uncertain sample (IHC=2)；Determine that positive sample (IHC=3) is 26 examples.

And found by the method for fluorescence quantitative PCR detection Her2 gene copy number, negative sample amounts to 53 (IHC=0 has 45 examples to example, and goodness of fit reaches 90%；IHC=1 has 8 examples, and goodness of fit is 61.5%)；And Positive sample testing result and IHC method and FISH method all as be 26 examples, goodness of fit is 100%.Such as table 2 Shown in, the sample meeting the detection of IHC method amounts to 78 examples, and goodness of fit is 89.7%, higher than IHC method and FISH The 78% of method.

Table 2:IHC method and FISH method and fluorescence quantitative PCR detection Her2 gene copy number comparative result.

The breast carcinoma of the screening Her2 gene amplification of FDA accreditation at present or the method for patients with gastric cancer are mainly also It is IHC method and FISH method, general employing immunohistochemical method detection Her2 protein overexpression, should Her2 gene amplification level is detected with fluorescence in situ hybridization.Therefore the result of the present invention is by contrast two kinds Method, the present invention effectively can supplement as that whether Her2 gene copy number in detection gastric cancer expands.

The all documents mentioned in the present invention are incorporated as reference the most in this application, just as each document It is individually recited as with reference to like that.In addition, it is to be understood that after the above-mentioned teachings having read the present invention, The present invention can be made various changes or modifications by those skilled in the art, and these equivalent form of values fall within this Shen equally Please appended claims limited range.

Claims (10)

1. a Her2 gene detecting kit, it is characterised in that described test kit contains container, and Lay respectively in container:

Her2 gene-specific primer pair, described specific primer is to such as SEQ ID NO.:1 (forward ACAACCAAGTGAGGCAGGTC) and SEQ ID NO.:2 (reverse GTATTGTTCAGCGGGTCTCC) shown in； With

Her2 gene specific detection probe, Her2 gene-specific probe sequence such as SEQ ID NO.: Shown in 3 (CCCAGCTCTTTGAGGACAAC).

2. test kit as claimed in claim 1, it is characterised in that described test kit is possibly together with crt gene Specific primer to and specificity detection probe；And/or

Described test kit detects related reagent possibly together with optional PCR, if mastermix is (such as Taqman GEMM Mastermix etc.) and/or distilled water (such as distilled water etc.).

3. test kit as claimed in claim 2, it is characterised in that the specific primer of described crt gene (anti-to sequence such as SEQ ID NO.:4 (forward GCTGATGATCATAAAGCCACAGGTA) and SEQ ID NO.:5 To TGGTGCTCAGGCAGTGC) shown in；And/or described specificity detection probe sequence such as SEQ ID NO.: Shown in 6 (TGCTGCAATAGGCGG).

4. test kit as claimed in claim 1, it is characterised in that described in specificity detection probe one End is marked with fluorescence generation group, and the other end is marked with fluorescent quenching group.

5. test kit as claimed in claim 1, it is characterised in that the concentration of described specific primer is 2.5-8uM/ul, preferably 3-5uM/ul, such as 4.5uM/ul and/or

The concentration of described specificity detection probe is 0.5-5uM/ul, preferably 1-2uM/ul.

6. Her2 gene Relative copy number method in the detection sample of a nondiagnostic, it is characterised in that bag Include step:

I () provides specific primer that a reaction system, described reaction system contain Her2 gene to special The specific primer of property probe and crt gene to and crt gene；

(i i) utilizes the reaction system in (i) that Her2 gene and crt gene are carried out PCR amplification；

(i i i) measures the fluorescence signal that the specific probe of described Her2 gene and crt gene sends respectively, Thus detect the Her2 gene Relative copy number relative to crt gene；

Wherein, described Her2 specific probe is as shown in SEQ ID NO.:3；Described Her2 gene Specific primer is to as shown in SEQ ID NO.:1 (Fw) and SEQ ID NO.:2 (Rv).

7. method as claimed in claim 6, it is characterised in that described crt gene includes Cep17 base Cause.

8. method as claimed in claim 7, it is characterised in that described pcr amplification reaction condition is such as Under:

95 DEG C 10 minutes；92 DEG C 15 seconds, 60 DEG C 60 seconds, 40 circulations.

9. method as claimed in claim 6, it is characterised in that described sample include tissue samples, Or blood sample.

10. the purposes of test kit described in claim 1, it is characterised in that detect sample for nondiagnostic The expression of middle Her2 gene.