CN106148490A - Soybean cyst nematode resistance is correlated with Map-5148SNP labelling and detection method and utilization - Google Patents
Soybean cyst nematode resistance is correlated with Map-5148SNP labelling and detection method and utilization Download PDFInfo
- Publication number
- CN106148490A CN106148490A CN201510152237.6A CN201510152237A CN106148490A CN 106148490 A CN106148490 A CN 106148490A CN 201510152237 A CN201510152237 A CN 201510152237A CN 106148490 A CN106148490 A CN 106148490A
- Authority
- CN
- China
- Prior art keywords
- soybean
- 5148snp
- map
- disease
- susceptible
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention discloses soybean cyst nematode resistance to be correlated with Map-5148SNP labelling and detection method and utilization.The invention provides the polymorphism in Map-5148SNP site or the material of genotype in detection soybean gene group identifying or assisting qualification Semen sojae atricolor to the application in No. 3 biological strain resistances of soybean cyst nematode Heterodera glycines.Additionally provide the polymorphism in Map-5148SNP site or the material of genotype in detection soybean gene group identify in preparation or assist qualification Semen sojae atricolor to the application in No. 3 biological strain resistance products of soybean cyst nematode Heterodera glycines.The experiment proves that, the present invention filters out Map-5148SNP site, in kind, in early days breeding material can be carried out No. 3 biological strain resistances of soybean cyst nematode Heterodera glycines by the genotype detecting it, greatly improving the efficiency of selection of disease-resistant variety in breeding process, shorten breeding time, the cultivation effect for anti-soybean cyst nematode Heterodera glycines kind is notable.
Description
Technical field
The present invention relates to biological technical field, particularly relate to soybean cyst nematode resistance and be correlated with Map-5148SNP labelling and detection method and utilization.
Background technology
Soybean cyst nematode Heterodera glycines (Soybean Cyst Nematode, SCN) there is distribution wide, harm weight, route of transmission is many, and host range is wide, time-to-live waits so long feature, being the soil-borne disease of a kind of extremely difficult preventing and treating, Soybean production can be caused crushing blow, at present by its generation, this disease has the trend spreading and increasingly increasing the weight of, and the most seriously constrains Soybean production.It was verified that cultivate and plant the most effective approach that disease-resistant variety is controlling disease.Due to SCN resistant gene complexity in heredity and the multiformity of Soybean Cyst Nematode, the kind utilizing traditional disease-resistant phenotypic evaluation and breeding method to cultivate anti-soybean cyst nematode not only needs to take a long time, and it is difficult to successfully, can not meet the development of current anti-line breeding.Exploitation and use along with molecular marker, molecular marker assisted selection (Molecular marker-assisted selection, MAS) becomes can save human and material resources and accelerate the effective ways (Cregan et al.1999) of breeding process.The great advantage of MAS is in the case of need not assess phenotypic characteristic, by being confirmed whether to identify resistant plant with target gene.
Classical genetic analysis shows, the resistance of soybean cyst nematode Heterodera glycines is the quantitative trait controlled by multiple sites, although two main disease-resistant sites (rhg1 and Rhg4) be cloned (Cook et al.Science, 2012；Liu et al.Nature, 2012), but whole resistant variant cannot be explained, it is impossible to meet breeding needs, it is necessary to continue to excavate new disease-resistant gene.Semen sojae atricolor originates from China, and the anti-source of China is the abundantest, wherein contains excellent disease-resistant gene.Association analysis, also known as association mapping (Association Mapping), it is a kind of based on LD (Linkage Disequlibrium) analyzes, directly genotypic variation and phenotypic variation are analyzed, thus those and the related gene identification of character out (Khush et al.2001), association analysis method becomes the powerful tool excavated with phenotypic correlation molecular marker.New molecular marker SNP because have quantity in genome many, widely distributed, can the advantage such as high throughput testing and be in recent years widely used in the complex character identifying controlled by multiple genes.Along with being on the increase of SNP marker quantity, high-throughout SNP typing platform is constantly released, including BeadArray (Illumina), GenomeLab SNP stream (Beckman) and MegAllele (Affymetrix) etc., wherein the BeadArray chip identification technology of Illumina company has efficiently, high flux, low cost, the advantages such as accuracy is good, it is suitable for number of sites from tens to thousand of moderate fluxes gene type research, experiment success rate > 99%, it it is the solution of preferable moderate fluxes gene type detection, have been widely used for the mankind at present, arabidopsis, the SNP typing of the species such as Oryza sativa L..
Summary of the invention
It is an object of the present invention to provide the polymorphism in Map-5148SNP site in detection soybean gene group or the purposes of the material of genotype.
In the detection soybean gene group that the present invention provides, the polymorphism in Map-5148SNP site or the material of genotype are being identified or are being assisted qualification Semen sojae atricolor to the application in No. 3 biological strain resistances of soybean cyst nematode Heterodera glycines.
The polymorphism (i.e. allele) in described detection Map-5148SNP site or genotype concretely detect the nucleotide kind in Map-5148SNP site.
Another object of the present invention is to provide the polymorphism in Map-5148SNP site in detection soybean gene group or another purposes of the material of genotype.
The invention provides the polymorphism in Map-5148SNP site or the material of genotype in detection soybean gene group identify in preparation or assist qualification Semen sojae atricolor to the application in No. 3 biological strain resistance products of soybean cyst nematode Heterodera glycines.
The 3rd purpose of the present invention is to provide the polymorphism in Map-5148SNP site in detection soybean gene group or the 3rd purposes of the material of genotype.
In the detection soybean gene group that the present invention provides, the polymorphism in Map-5148SNP site or the material of genotype are in the application identified or in the auxiliary disease-resistant Semen sojae atricolor of qualification；Described disease is the disease caused by No. 3 biological strains of soybean cyst nematode Heterodera glycines；
Or the polymorphism in Map-5148SNP site or the material of genotype are identified in preparation or assist the application identified in disease-resistant soybean prod in detection soybean gene group；Described disease is the disease caused by No. 3 biological strains of soybean cyst nematode Heterodera glycines.
The 4th purpose of the present invention is to provide the polymorphism in Map-5148SNP site in detection soybean gene group or the 4th purposes of the material of genotype.
The invention provides the polymorphism in Map-5148SNP site or the material of genotype in detection soybean gene group identifying or assisting the application identified in the single nucleotide polymorphism relevant to No. 3 biological strain resistances of soybean cyst nematode Heterodera glycines；
Or the polymorphism in Map-5148SNP site or the application in the single nucleotide polymorphism product that preparation is identified or auxiliary qualification is relevant to No. 3 biological strain resistances of soybean cyst nematode Heterodera glycines of the material of genotype in detection soybean gene group.
The 5th purpose of the present invention is to provide the polymorphism in Map-5148SNP site in detection soybean gene group or the 5th purposes of the material of genotype.
The invention provides the polymorphism in Map-5148SNP site or the application in screening or the disease-resistant Semen sojae atricolor of assisting sifting of the material of genotype in detection soybean gene group；Described disease is the disease caused by No. 3 biological strains of soybean cyst nematode Heterodera glycines；
Or the polymorphism in Map-5148SNP site or the application in preparation screening or the disease-resistant soybean prod of assisting sifting of the material of genotype in detection soybean gene group；Described disease is the disease caused by No. 3 biological strains of soybean cyst nematode Heterodera glycines.
In above-mentioned application, in described soybean gene group, Map-5148SNP loci gene type is TT, CT or CC；
Described Map-5148SNP site is positioned at the 886th of the Glyma.08g234400 gene of the 8th article of chromosome of soybean gene group；The nucleotides sequence of described Glyma.08g234400 gene is classified as sequence 1.
6th purpose of the present invention is to provide a kind of qualification or the auxiliary qualification Semen sojae atricolor method to No. 3 biological strain resistances of soybean cyst nematode Heterodera glycines.
The method that the present invention provides, comprises the steps: to detect soybean gene group Map-5148SNP loci gene type to be measured, if described soybean gene group Map-5148SNP loci gene type to be measured is TT or CT, the most described Semen sojae atricolor to be measured is or candidate is disease-resistant variety；If described soybean gene group Map-5148SNP loci gene type to be measured is CC, the most described Semen sojae atricolor to be measured is not or candidate is not for disease-resistant variety；Described disease is the disease caused by No. 3 biological strains of soybean cyst nematode Heterodera glycines；
Described detection soybean gene to be measured group Map-5148SNP loci gene type uses the following SNP genotype chip detection being fixed for detecting the probe groups in Map-5148SNP site.
The 6th purpose of the present invention is to provide polymorphism or the material of genotype in Map-5148SNP site in detection soybean gene group.
The polymorphism in Map-5148SNP site or the material of genotype in the detection soybean gene group that the present invention provides, for a)-d) in any one product:
A) identify or assist the qualification Semen sojae atricolor product to No. 3 biological strain resistances of soybean cyst nematode Heterodera glycines；
B) identify or assist the product identifying disease-resistant Semen sojae atricolor；Described disease is the disease caused by No. 3 biological strains of soybean cyst nematode Heterodera glycines；
C) identify or assist the single nucleotide polymorphism product that qualification is relevant to No. 3 biological strain resistances of soybean cyst nematode Heterodera glycines；
D) screening or the disease-resistant soybean prod of assisting sifting；Described disease is the disease caused by No. 3 biological strains of soybean cyst nematode Heterodera glycines；
The place gene in described Map-5148SNP site is the Glyma.08g234400 gene of the 8th article of chromosome of soybean gene group；The nucleotides sequence of described Glyma.08g234400 gene is classified as sequence 1；
Described Map-5148SNP site is sequence 1 the 886th in sequence table.
In the said goods, in described detection soybean gene group, the polymorphism in Map-5148SNP site or the material of genotype include that Map-5148SNP is fixed for detecting the SNP genotype chip of the probe groups in Map-5148SNP site；
Described probe groups is made up of the single strand dna shown in sequence 3 in the single strand dna shown in sequence 2 in the single strand dna shown in sequence in sequence table 1, sequence table and sequence table.
The experiment proves that, the present invention filters out Map-5148SNP site, in kind, in early days breeding material can be carried out No. 3 biological strain resistances of soybean cyst nematode Heterodera glycines by the genotype detecting it, greatly improving the efficiency of selection of disease-resistant variety in breeding process, shorten breeding time, the cultivation effect for anti-soybean cyst nematode Heterodera glycines kind is notable.
Detailed description of the invention
In example below the seed materials of table 3 be breed with Institute of Crop Science, Chinese Academy of Agricultural Science middle product 03-5373 (Zhang Shanshan etc., Acta Agronomica Sinica, 2013,39 (10): 1746-1753；Liu Zhangxiong etc., Soybean Science, 2008,27 (6): 911-914) be yellow 13 (ZDD23876) maternal, middle be that paternal hybrid builds F2Colony, plant mix receipts method breeding F2-4, single seed descent breeding F5～F10And derivative F5:10For seed materials.
Experimental technique used in following embodiment if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, the most commercially obtain.
Embodiment 1, Map-5148SNP site are and the soybean cyst nematode Heterodera glycines disease-resistant relevant single nucleotide polymorphism of No. 3 biological strains
Map-5148 mononucleotide polymorphism site is positioned at Glyma.08g234400 gene nucleotide series (sequence 1) the 886th, and its essential information is shown in Table 1.
Table 1, Map-5148SNP mononucleotide polymorphism site essential information
Two, the association analysis that No. 3 biological strains of Map-5148SNP genotype and soybean cyst nematode Heterodera glycines are disease-resistant
1, the soybean varieties disease-resistant detection to No. 3 biological strains of soybean cyst nematode Heterodera glycines
Soybean varieties in table 2 and table 3 is all inoculated under disease garden, field with two kinds of greenhouse environmental condition No. 3 biological strains of soybean cyst nematode Heterodera glycines.Completely random district group EXPERIMENTAL DESIGN scheme is used, in triplicate in field.Field planting line width 0.65 meter, long 1.5 meters of row, strain spacing 0.05 meter.Greenhouse uses potted plant qualification, and each kind plants 3 basins, and 5 strains planted by every basin.After emerging 30 days, field is all randomly choosed identical 10 strains of growing way with every part of material in greenhouse and identifies, the every strain cyst number of number, calculate the average cyst number of each identification of species.In order to detect cyst index (Female Index, FI) difference, every 40 row using middle product 03-5373 as disease-resistant comparison, middle yellow 13 as susceptible comparison.The resistance of each kind is assessed with the disease-resistant grade divided based on cyst index.The computing formula of cyst index is FI=(the average cyst number of the every strain of identification of species average cyst number/susceptible check variety) X 100%, and every part of material is with middle yellow the 13 of its nearest neighbours for susceptible check variety).Anti-sense grade scale is as follows, and FI=0-9 is disease-resistant (Resistant, R)；FI=10-29 resists (moderately resistant, MR) in being；FI=30-59 is middle sense (moderately susceptible, MS)；FI=60+ is susceptible (susceptible, S), and result is as shown in table 2 and table 3.
2, genotype chip detection SNP genotype
1), the preparation of Map-5148SNP locus gene cake core
Full-length genome SNP data set according to independent development, the Map-5148SNP site of screening Rhg4 interval (a length of 2.8Mb) is designed to Map-5148SNP loci gene type authentication chip, specific as follows:
According to SNP site analysis design and synthetic Map-5148SNP probe groups:
Probe A:ACTTCGTCAGTAACGGACGAGCTGCTCTTGCCCTTGAGAAGT (sequence 2)；
Probe B:GAGTCGAGGTCATATCGTGAGCTGCTCTTGCCCTTGAGAAGC (sequence 3)；
Probe C:GTAACTTGAACCTGTGCTTCTTATGTTTAGCCGAGTCCACACCTTCGTCTGCCT ATAGTGAGT C (sequence 4)
Map-5148SNP locus gene cake core is all to be fixed on chip (American I illumina company) by 3 probes of the Map-5148SNP probe groups of above-mentioned synthetic, obtains Map-5148SNP locus gene cake core.
2), genotype detection
The SNP detection platform utilizing Iillumina carries out SNP genotype identification to 133 soybean varieties shown in table 2 and 244 Semen sojae atricolor seed materials shown in table 3, specific as follows:
(1) the genomic DNA 250ng of each kind, is extracted.
(2), DNA sample to be detected is added the chip microballon containing probe groups OPA previously according to SNP site design.
(3), connect the complementary series having address sequence on the microballon of chip, complete hybridization by address sequence, and on chip, carry out mononucleotide base extension, obtain one section of segment comprising this SNP site.
(4), clean and scan chip.
(5), utilize BeadArray Reader software according to fluorescence color interpretation and to export genotyping result, determine the genotype of kind to be measured.Result is as shown in table 2.
Table 2 is soybean varieties SNP site genotype
The kind that above-mentioned table 2 relates to all is recorded in the following literature: kingdom's merit. Chinese soybean variety source catalogue. and Beijing: Chinese agriculture publishing house, 1982；Chang Ru town, Sun Jianying. Chinese soybean variety source catalogue: sequel. Beijing: agricultural publishing house, 1991；Chang Ru town, Sun Jianying, Qiu Lijuan, an old dance. Chinese soybean variety source catalogue: sequel two. Beijing: Chinese agriculture publishing house, 1996；Zhang Shanshan, Li Yinghui, Li Jinying, Qiu Lijuan. in excellent strain, the heredity of product 03-5373 pedigree resolves and anti-soybean cyst nematode mark of correlation is identified. Acta Agronomica Sinica, 2013,39 (10): 1746-1753.
Table 3 is 217 Semen sojae atricolor seed materials SNP site genotype that middle product 03-5373 and middle yellow 13 is derivative
| Family name | Cyst index (%) | Resistance | Map-5148 loci gene type |
| R3 | 166.06 | Susceptible | TT |
| R4 | 178.57 | Susceptible | CC |
| R5 | 83.11 | Susceptible | CC |
| R6 | 109.69 | Susceptible | CC |
| R7 | 106.35 | Susceptible | TT |
| R8 | 95.94 | Susceptible | CC |
| R9 | 114.92 | Susceptible | CC |
| R11 | 117.47 | Susceptible | CC |
| R12 | 80.89 | Susceptible | TT |
| R14 | 148.09 | Susceptible | CC |
| R15 | 122.51 | Susceptible | TT |
| R19 | 87.24 | Susceptible | TT |
| R21 | 98.42 | Susceptible | TT |
| R23 | 102.33 | Susceptible | CC |
[0065] [0065]
| R24 | 131.68 | Susceptible | TT |
| R25 | 122.47 | Susceptible | CC |
| R26 | 156.04 | Susceptible | CC |
| R27 | 6.45 | Disease-resistant | TT |
| R28 | 179.79 | Susceptible | TT |
| R29 | 107.79 | Susceptible | CC |
| R30 | 159.20 | Susceptible | CC |
| R31 | 88.56 | Susceptible | CC |
| R32 | 155.61 | Susceptible | CC |
| R33 | 170.74 | Susceptible | CC |
| R36 | 144.82 | Susceptible | TT |
| R37 | 0.77 | Disease-resistant | TT |
| R38 | 128.96 | Susceptible | CC |
| R42 | 73.78 | Susceptible | TT |
| R43 | 96.91 | Susceptible | CC |
| R46 | 83.75 | Susceptible | CC |
| R48 | 0.25 | Disease-resistant | TT |
| R49 | 112.95 | Susceptible | CC |
| R50 | 136.05 | Susceptible | CC |
| R51 | 113.41 | Susceptible | CC |
| R52 | 154.29 | Susceptible | CC |
| R53 | 147.36 | Susceptible | CC |
| R55 | 183.16 | Susceptible | CC |
| R56 | 100.49 | Susceptible | CC |
| R59 | 115.97 | Susceptible | CC |
| R60 | 115.16 | Susceptible | TT |
| R61 | 107.10 | Susceptible | CC |
| R62 | 0.26 | Disease-resistant | CT |
| R63 | 100.55 | Susceptible | CC |
| R64 | 101.05 | Susceptible | TT |
| R65 | 65.59 | Susceptible | CC |
| R67 | 128.11 | Susceptible | CC |
| R68 | 66.71 | Susceptible | TT |
| R69 | 117.17 | Susceptible | CC |
| R70 | 81.79 | Susceptible | CC |
| R73 | 177.91 | Susceptible | CC |
[0066] [0066]
| R74 | 78.46 | Susceptible | CT |
| R75 | 103.08 | Susceptible | CC |
| R76 | 114.22 | Susceptible | CC |
| R81 | 69.26 | Susceptible | TT |
| R82 | 0.18 | Disease-resistant | CT |
| R83 | 160.78 | Susceptible | TT |
| R84 | 135.00 | Susceptible | CC |
| R85 | 141.00 | Susceptible | CC |
| R86 | 71.30 | Susceptible | CC |
| R87 | 113.27 | Susceptible | TT |
| R88 | 104.40 | Susceptible | CC |
| R89 | 144.00 | Susceptible | TT |
| R90 | 0.14 | Disease-resistant | CT |
| R91 | 80.55 | Susceptible | CC |
| R92 | 121.23 | Susceptible | TT |
| R93 | 129.52 | Susceptible | TT |
| R94 | 97.44 | Susceptible | TT |
| R96 | 122.35 | Susceptible | TT |
| R97 | 1.68 | Disease-resistant | CT |
| R98 | 106.54 | Susceptible | TT |
| R99 | 2.67 | Disease-resistant | CC |
| R100 | 144.56 | Susceptible | CC |
| R102 | 124.39 | Susceptible | CC |
| R103 | 219.50 | Susceptible | CC |
| R104 | 100.34 | Susceptible | CC |
| R107 | 87.01 | Susceptible | CC |
| R108 | 96.74 | Susceptible | TT |
| R109 | 2.81 | Disease-resistant | CT |
| R110 | 122.73 | Susceptible | CT |
| R111 | 106.04 | Susceptible | CT |
| R112 | 123.24 | Susceptible | CC |
| R113 | 68.49 | Susceptible | TT |
| R114 | 145.84 | Susceptible | TT |
| R115 | 85.97 | Susceptible | CC |
| R116 | 105.56 | Susceptible | TT |
| R118 | 91.84 | Susceptible | TT |
[0067] [0067]
| R121 | 219.53 | Susceptible | CC |
| R122 | 212.09 | Susceptible | TT |
| R123 | 132.29 | Susceptible | CC |
| R125 | 197.85 | Susceptible | CC |
| R126 | 160.32 | Susceptible | TT |
| R128 | 98.93 | Susceptible | TT |
| R129 | 110.80 | Susceptible | TT |
| R130 | 95.43 | Susceptible | CC |
| R131 | 169.61 | Susceptible | TT |
| R132 | 0.57 | Disease-resistant | TT |
| R133 | 121.63 | Susceptible | TT |
| R134 | 100.31 | Susceptible | CC |
| R135 | 149.64 | Susceptible | TT |
| R136 | 0.61 | Disease-resistant | CT |
| R137 | 157.02 | Susceptible | CC |
| R139 | 128.23 | Susceptible | CC |
| R141 | 150.77 | Susceptible | CC |
| R142 | 101.42 | Susceptible | TT |
| R143 | 0.30 | Disease-resistant | TT |
| R144 | 153.95 | Susceptible | CC |
| R145 | 97.31 | Susceptible | CC |
| R146 | 157.03 | Susceptible | CC |
| R147 | 0.87 | Disease-resistant | TT |
| R148 | 140.44 | Susceptible | CC |
| R149 | 64.58 | Susceptible | CC |
| R150 | 64.62 | Susceptible | CC |
| R151 | 105.61 | Susceptible | CC |
| R152 | 195.49 | Susceptible | CC |
| R153 | 188.43 | Susceptible | CC |
| R154 | 84.10 | Susceptible | CC |
| R155 | 101.96 | Susceptible | TT |
| R156 | 159.30 | Susceptible | CC |
| R157 | 1.28 | Disease-resistant | CT |
| R158 | 65.77 | Susceptible | CT |
| R161 | 2.70 | Disease-resistant | TT |
| R162 | 76.22 | Susceptible | CC |
[0068] [0068]
| R163 | 120.41 | Susceptible | CC |
| R164 | 122.80 | Susceptible | TT |
| R165 | 151.45 | Susceptible | TT |
| R166 | 154.51 | Susceptible | TT |
| R167 | 87.90 | Susceptible | CC |
| R168 | 0.50 | Disease-resistant | CT |
| R170 | 148.23 | Susceptible | CC |
| R171 | 134.33 | Susceptible | CC |
| R172 | 0.44 | Disease-resistant | CT |
| R173 | 113.55 | Susceptible | CC |
| R174 | 102.14 | Susceptible | TT |
| R175 | 216.91 | Susceptible | TT |
| R176 | 212.57 | Susceptible | CC |
| R177 | 335.64 | Susceptible | CC |
| R178 | 171.45 | Susceptible | CC |
| R179 | 112.90 | Susceptible | TT |
| R180 | 62.46 | Susceptible | TT |
| R181 | 74.19 | Susceptible | CC |
| R182 | 2.77 | Disease-resistant | CT |
| R183 | 89.09 | Susceptible | CC |
| R184 | 99.15 | Susceptible | CC |
| R185 | 145.01 | Susceptible | TT |
| R186 | 60.37 | Susceptible | TT |
| R187 | 3.50 | Disease-resistant | CT |
| R189 | 98.98 | Susceptible | CC |
| R190 | 108.60 | Susceptible | CC |
| R191 | 108.43 | Susceptible | CC |
| R193 | 3.16 | Disease-resistant | CT |
| R195 | 65.03 | Susceptible | CC |
| R196 | 115.44 | Susceptible | TT |
| R197 | 5.26 | Disease-resistant | CT |
| R204 | 63.28 | Susceptible | CC |
| R205 | 3.24 | Disease-resistant | CC |
| R206 | 70.82 | Susceptible | CC |
| R207 | 82.88 | Susceptible | CT |
| R208 | 127.55 | Susceptible | CC |
[0069] [0069]
| R209 | 99.44 | Susceptible | CC |
| R211 | 118.35 | Susceptible | CC |
| R214 | 76.47 | Susceptible | CC |
| R216 | 93.24 | Susceptible | CC |
| R217 | 92.48 | Susceptible | CC |
| R218 | 141.64 | Susceptible | CC |
| R220 | 62.54 | Susceptible | CT |
| R221 | 127.59 | Susceptible | TT |
| R222 | 121.21 | Susceptible | CC |
| R224 | 195.22 | Susceptible | CC |
| R226 | 166.09 | Susceptible | TT |
| R228 | 122.40 | Susceptible | TT |
| R229 | 108.12 | Susceptible | CC |
| R232 | 122.99 | Susceptible | CC |
| R233 | 162.19 | Susceptible | TT |
| R234 | 3.26 | Disease-resistant | CT |
| R235 | 89.67 | Susceptible | CC |
| R236 | 70.02 | Susceptible | TT |
| R237 | 95.46 | Susceptible | CC |
| R238 | 110.48 | Susceptible | TT |
| R241 | 9.43 | Disease-resistant | CT |
| R242 | 131.68 | Susceptible | TT |
| R243 | 165.67 | Susceptible | CC |
| R244 | 0.84 | Disease-resistant | CT |
| R245 | 165.64 | Susceptible | CC |
| R246 | 103.17 | Susceptible | CC |
| R247 | 104.50 | Susceptible | TT |
| R248 | 109.63 | Susceptible | CC |
| R249 | 117.76 | Susceptible | TT |
| R250 | 70.86 | Susceptible | CC |
| R251 | 0.09 | Disease-resistant | CT |
| R253 | 65.76 | Susceptible | TT |
| R256 | 0.22 | Disease-resistant | CT |
| R257 | 119.26 | Susceptible | CC |
| R258 | 119.48 | Susceptible | CC |
| R259 | 151.47 | Susceptible | TT |
[0070] [0070]
| R261 | 174.83 | Susceptible | TT |
| R262 | 140.95 | Susceptible | TT |
| R263 | 79.02 | Susceptible | CC |
| R264 | 91.27 | Susceptible | TT |
| R265 | 85.34 | Susceptible | TT |
| R266 | 102.76 | Susceptible | CC |
| R267 | 98.26 | Susceptible | CC |
| R268 | 164.98 | Susceptible | CC |
| R269 | 0.65 | Disease-resistant | CT |
| R270 | 73.95 | Susceptible | TT |
| R271 | 64.35 | Susceptible | CC |
| R272 | 84.91 | Susceptible | CT |
| R274 | 86.66 | Susceptible | CC |
| R275 | 65.20 | Susceptible | CC |
| R280 | 105.12 | Susceptible | CC |
| R281 | 115.59 | Susceptible | TT |
| R282 | 182.45 | Susceptible | CC |
| R283 | 140.92 | Susceptible | CC |
| R284 | 131.92 | Susceptible | CC |
| R285 | 188.05 | Susceptible | TT |
| R287 | 137.53 | Susceptible | TT |
| R288 | 194.90 | Susceptible | CC |
| R289 | 206.12 | Susceptible | TT |
Table 2 result shows, in 34 Semen sojae atricolor disease-resistant varieties the allele genotype in the Map-5148SNP site of 27 kinds be TT, the allele genotype in the Map-5148SNP site of 5 kinds be CT；In the susceptible sick kinds of 17 Semen sojae atricolor the allele genotype in the Map-5148SNP site of 14 kinds be CC, the allele genotype in the Map-5148SNP site of a kind be CT.
Disease-resistant variety or ore grade indexes efficiency (carrying the allelic disease-resistant variety of TT or CT/all of disease-resistant variety) in computational chart 2, disease-resistant variety or ore grade indexes efficiency are 94.1%.
Susceptible variety or ore grade indexes efficiency (carrying the allelic susceptible variety of CC/all of susceptible variety) in computational chart 2；Susceptible variety determination rates is 82.3%.
Table 3 result shows, in 28 disease-resistant seed materials that middle product 03-5373 and middle yellow 13 hybridization derive, the allele genotype in the Map-5148SNP site of 7 seed materials is TT, the allele genotype in the Map-5148SNP site of 19 seed materials is CT；In 189 susceptible seed materials of Semen sojae atricolor the allele genotype in the Map-5148SNP site of 116 seed materials be CC, the allele genotype in the Map-5148SNP site of 7 seed materials be CT.
Disease-resistant seed materials determination rates (carrying the allelic disease-resistant seed materials of TT or CT/all disease-resistant seed materials) in computational chart 3, disease-resistant seed materials determination rates is 92.9%.
Susceptible seed materials determination rates (carrying the allelic susceptible seed materials of CC/all susceptible seed materials) in computational chart 3, susceptible seed materials determination rates is 61.4%.
Said method may be used for the resistance identifying Semen sojae atricolor to be measured to No. 3 biological strains of soybean cyst nematode Heterodera glycines.
Claims (10)
1. in detection soybean gene group, the polymorphism in Map-5148SNP site or the material of genotype are being identified or auxiliary mirror
Determine Semen sojae atricolor to the application in soybean cyst nematode resistance.
2. in detection soybean gene group, the polymorphism in Map-5148SNP site or the material of genotype are identified or auxiliary in preparation
Help qualification Semen sojae atricolor to the application in soybean cyst nematode resistance product.
3. in detection soybean gene group, the polymorphism in Map-5148SNP site or the material of genotype are being identified or auxiliary mirror
Application in fixed disease-resistant Semen sojae atricolor；Described disease is the disease caused by soybean cyst nematode Heterodera glycines；
Or the polymorphism in Map-5148SNP site or the material of genotype are identified or auxiliary in preparation in detection soybean gene group
Help the application identified in disease-resistant soybean prod；Described disease is the disease caused by soybean cyst nematode Heterodera glycines.
4. in detection soybean gene group, the polymorphism in Map-5148SNP site or the material of genotype are being identified or auxiliary mirror
Application in the fixed single nucleotide polymorphism relevant to soybean cyst nematode resistance.
5. in detection soybean gene group, the polymorphism in Map-5148SNP site or the material of genotype are identified or auxiliary in preparation
Help the application identified in the single nucleotide polymorphism product relevant to soybean cyst nematode resistance.
6. in detection soybean gene group, the polymorphism in Map-5148SNP site or the material of genotype sieve in screening or auxiliary
Select the application in disease-resistant Semen sojae atricolor；Described disease is the disease caused by soybean cyst nematode Heterodera glycines；
Or the polymorphism in Map-5148SNP site or the material of genotype screen or auxiliary in preparation in detection soybean gene group
Help the application screened in disease-resistant soybean prod；Described disease is the disease caused by soybean cyst nematode Heterodera glycines.
7. according to described application arbitrary in claim 1-6, it is characterised in that: in described soybean gene group
Map-5148SNP loci gene type is TT, CT or CC；
Described Map-5148SNP site is positioned at the Glyma.08g234400 gene of the 8th article of chromosome of soybean gene group
886th；The nucleotides sequence of described Glyma.08g234400 gene is classified as sequence 1；
Described soybean cyst nematode Heterodera glycines is No. 3 biological strains of soybean cyst nematode Heterodera glycines.
8. identify or auxiliary identifies a Semen sojae atricolor method to soybean cyst nematode resistance, comprise the steps: that detection is treated
Survey soybean gene group Map-5148SNP loci gene type, if described soybean gene group Map-5148SNP site to be measured base
Because type is TT or CT, the most described Semen sojae atricolor to be measured is or candidate is disease-resistant variety；If described soybean gene group to be measured
Map-5148SNP loci gene type is CC, and the most described Semen sojae atricolor to be measured is not or candidate is not for disease-resistant variety；Described disease is
The disease caused by soybean cyst nematode Heterodera glycines；
Described soybean cyst nematode Heterodera glycines is specially No. 3 biological strains of soybean cyst nematode Heterodera glycines.
9. detect polymorphism or the material of genotype in Map-5148SNP site in soybean gene group, for a)-d) in
Any one product:
A) identify or assist the qualification Semen sojae atricolor product to soybean cyst nematode resistance；
B) identify or assist the product identifying disease-resistant Semen sojae atricolor；Described disease is the disease caused by soybean cyst nematode Heterodera glycines；
C) identify or assist the single nucleotide polymorphism product that qualification is relevant to soybean cyst nematode resistance；
D) screening or the disease-resistant soybean prod of assisting sifting；Described disease is the disease caused by soybean cyst nematode Heterodera glycines；
The place gene in described Map-5148SNP site is the 8th article of chromosome of soybean gene group
Glyma.08g234400 gene；The nucleotides sequence of described Glyma.08g234400 gene is classified as sequence 1；
Described Map-5148SNP site is sequence 1 the 886th in sequence table.
Product the most according to claim 9, it is characterised in that: Map-5148SNP in described detection soybean gene group
The polymorphism in site or the material of genotype include the SNP base being fixed for detecting the probe groups in Map-5148SNP site
Because of cake core；
Described probe groups is by the list shown in sequence 2 in the single strand dna shown in sequence in sequence table 1, sequence table
Single strand dna composition shown in sequence 3 in ssdna molecule and sequence table；
Described soybean cyst nematode Heterodera glycines is No. 3 biological strains of soybean cyst nematode Heterodera glycines.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510152237.6A CN106148490B (en) | 2015-04-01 | 2015-04-01 | Soybean cyst nematode resistance correlation Map-5148SNP label and detection method and utilization |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510152237.6A CN106148490B (en) | 2015-04-01 | 2015-04-01 | Soybean cyst nematode resistance correlation Map-5148SNP label and detection method and utilization |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106148490A true CN106148490A (en) | 2016-11-23 |
| CN106148490B CN106148490B (en) | 2019-06-18 |
Family
ID=57337368
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510152237.6A Active CN106148490B (en) | 2015-04-01 | 2015-04-01 | Soybean cyst nematode resistance correlation Map-5148SNP label and detection method and utilization |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106148490B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107299146A (en) * | 2017-08-21 | 2017-10-27 | 中国农业科学院作物科学研究所 | Anti- soybean cyst nematode Heterodera glycines correlation CAPS mark detection methods and primer |
-
2015
- 2015-04-01 CN CN201510152237.6A patent/CN106148490B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| COOK DE等: "《NM_001353935.1》", 《GENEBANK》 * |
| DAVID E.COOK等: "《Copy number variation of multiple genes at Rhg1 mediates nematode resistance in soybean》", 《SCIENCE》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107299146A (en) * | 2017-08-21 | 2017-10-27 | 中国农业科学院作物科学研究所 | Anti- soybean cyst nematode Heterodera glycines correlation CAPS mark detection methods and primer |
| CN107299146B (en) * | 2017-08-21 | 2020-07-14 | 中国农业科学院作物科学研究所 | Soybean cyst nematode-resistant related CAPS (cleaved amplified polymorphic sequence) marker detection method and primers |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106148490B (en) | 2019-06-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hawkins et al. | Recent progress in alfalfa (Medicago sativa L.) genomics and genomic selection | |
| Hill et al. | Characterization of Capsicum annuum genetic diversity and population structure based on parallel polymorphism discovery with a 30K unigene Pepper GeneChip | |
| Innan et al. | Intragenic Recombination in the Adh Locws of the Wild Plant Arabidopsis thaliana | |
| Gupta et al. | Construction of a genetic linkage map of black gram, Vigna mungo (L.) Hepper, based on molecular markers and comparative studies | |
| Sukumaran et al. | Association mapping of genetic resources: achievements and future perspectives | |
| CN106148491B (en) | The chip detecting method of soybean cyst nematode resistance correlation Map-5147SNP label and application | |
| Ku et al. | QTL mapping and epistasis analysis of brace root traits in maize | |
| Ha et al. | A near‐complete genome sequence of mungbean (Vigna radiata L.) provides key insights into the modern breeding program | |
| Fujii et al. | High-throughput genotyping in citrus accessions using an SNP genotyping array | |
| Joukhadar et al. | Artificial selection causes significant linkage disequilibrium among multiple unlinked genes in Australian wheat | |
| Zhang et al. | Using nuclear loci and allelic variation to disentangle the phylogeny of Phyllostachys (Poaceae, Bambusoideae) | |
| Wangsomnuk et al. | Assessing genetic structure and relatedness of jerusalem artichoke (Helianthus tuberosus L.) germplasm with RAPD, ISSR and SRAP markers | |
| CN106148490B (en) | Soybean cyst nematode resistance correlation Map-5148SNP label and detection method and utilization | |
| CN104789661B (en) | The chip detecting method of soybean cyst nematode resistance correlation Map-5041SNP labels and application | |
| Abdel-Haleem et al. | Genetic diversity and population structure of the USDA collection of Brassica juncea L. | |
| Xu et al. | Hotspots of independent and multiple rounds of LTR-retrotransposon bursts in Brassica species | |
| Li et al. | Development of a core set of KASP markers for assaying genetic diversity in Brassica rapa subsp. chinensis Makino | |
| Torres et al. | Genomic selection for productive traits in biparental cassava breeding populations | |
| CN106148493B (en) | The detection method and utilization of soybean cyst nematode resistance correlation Map-5140SNP label | |
| CN106148492B (en) | The genotype detection method of soybean cyst nematode resistance correlation Map-5142SNP label and application | |
| Lu et al. | Genetic dissection of the general combining ability of yield-related traits in maize | |
| CN104789662A (en) | Gene type detection method of Map-5053SNP mark relevant to resistance of soybean cyst nematode and application of gene type detection method | |
| CN116287393B (en) | SNP (Single nucleotide polymorphism) marker related to peanut yield traits and application thereof | |
| Kumawat et al. | Opportunity and challenges for whole‐genome resequencing‐based genotyping in plants | |
| CN104789663B (en) | The detection method of soybean cyst nematode resistance correlation Map 5037SNP marks and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |