CN106148324B - RNA-RNA interaction analyzes and identifies method and its application - Google Patents

Abstract

Method and its application are analyzed and identified the present invention relates to RNA-RNA interaction.In the present invention, reverse transcription reaction based on the starting of endogenous RNA primer, and combine high throughput sequencing technologies, establish it is a kind of efficiently, it is accurate, directly and systematically study the new method of intramolecular and intermolecular RNA-RNA interaction, and identify and illustrate in a series of RNA molecule and intermolecular interaction.The present invention provides new approach for subsequent RNA-RNA repercussion study and relevant biological function.

Description

RNA-RNA interaction analyzes and identifies method and its application

Technical field

The invention belongs to molecular biology field, more particularly it relates in gene molecule and intermolecular chimaeric sequence What column and corresponding RNA-RNA interacted analyzes and identifies method and its application.

Background technique

RNA realizes its various biological function by interacting with protein, DNA and RNA.It is ground past In studying carefully, protein-protein, the interaction between protein and nucleic acid is by extensive experimental verification.Intramolecular and point Although the RNA-RNA interaction between son has had predictive calculation method and some experimental methods to carry out preliminary grind Study carefully, but the form and mechanism of its interaction are still very unclear, it is also necessary to more subsequent experimental researchs.

Different from the duplex structure of DNA molecular, RNA molecule is existed in single-stranded form.In vivo due to AU, GC and GU Pairing and the effect of some rna binding proteins, the interior interaction of RNA molecule form complicated secondary structure even three-level Structure.In terms of RNA interacts the secondary structure to be formed in the molecule, most commonly seen is the base pairing shape by nucleotide At loop-stem structure, also referred to as hairpin structure.These structures of RNA can influence the transcription of RNA, montage, cellular localization, translation and Conversion.Therefore the research for RNA structure, or perhaps for the research of intramolecular RNA interaction, just have extremely important Biological significance.In early stage research, the structure of RNA is mainly predicted by calculation method, and is broadly divided into non-method of comparison And method of comparison.It is most mainly relevant by minimizing free energy (minimum-free energy, MFE) in non-method of comparison Some calculation methods find secondary structure existing for the most stable most probable of RNA, are minimizing free energy base in addition there are some The free energy analysis of the method but all too busy to get away base pairing that develop on plinth.Contrastive principle mainly pass through RNA secondary structure into Conservative in change is calculated and is predicted.However the accuracy due to calculating prediction technique and unsatisfactory, Yi Xieji It is established and used for the secondary structure of research RNA in the method that chemical modification and enzyme spcificity are cut, principle is the base of RNA Unpaired part can by compound specificity modify or digestion, so as to anti-in modification or the record of restriction enzyme site blockade reversal The extension answered passes through the information of reverse transcription reaction termination site base, so that it may obtain the unpaired portion of base in RNA secondary structure The information divided, and further deduce the secondary structure information of RNA.

In early days, compound dimethyl suflfate (dimethyl sulfate, DMS) and coke diethyl phthalate (diethylpyrocarbonate, DEPC) be used to study the structure of RNA.After high throughput sequencing technologies generation, due to The advantages that its high accuracy, high throughput, high sensitivity and low cost, is also applied to the research of RNA secondary structure.In view of DMS It can penetrate into living cells, the A and C of base pairing not occur in specifically methylation modification RNA molecule, and then can prevent The extension of reverse transcriptase, for this characteristic in conjunction with high throughput sequencing technologies, providing a kind of can analyze intracellular full genome The method of group RNA secondary structure.But DMS is only capable of A and C in modification RNA, this will lead to the second level to G, U rich region of RNA There is very big difficulty in structural analysis.

Also research selectively carries out acylation modification to 2 ' hydroxyls on RNA ribose with chemical reagent in cell, from And it terminate RNA can in the decorating site when reverse transcription and react.The cDNA that reverse transcription is obtained is sequenced and is analyzed, It can be obtained by the secondary structure of RNA, this method is referred to as SHAPE method, and uses compound N-first in early stage research Base isatoic anhydride (N-methylisatoic anhydride, NMIA) analyzes tRNA^ASPStructure.With the hair of investigative technique Exhibition, a kind of more effective chemical reagent 1M7 (1-methyl-7-nitroisatoicanhydride) is instead of N-methyl-isatin Acid anhydrides simultaneously achieves better effect.

There are many methods at present studies RNA structure by enzymatic cleavage methods.There are two types of can cut the non-base-paired regions RNA Enzyme RNase I and RNase J1 be used to study the secondary structure of RNA.In the recent period, research establishes a kind of new collimation Analyze the method PARS (Parallel analysis of RNA structure) of RNA secondary structure.

These chemical modification methods and enzymatic cleavage methods are the RNA second level knot for the full-length genome range for understanding multiple species in depth Structure provides method and has laid important foundation.However complexity and dynamic and these methods due to RNA secondary structure Some shortcomings are still remained, explore new method further to obtain more comprehensively more direct RNA secondary structure Information Atlas also urgently Wait carry out.

The intermolecular interaction of RNA and RNA be most commonly that non-coding RNA (ncRNA) can by base pairing and Its target RNA interaction, thus many biological functions such as regulatory protein translation, rna stability.Non-coding RNA mainly includes MicroRNA, piRNA (Piwi-interacting RNA), siRNA (siRNA), small nuclear rna (snRNA) and long-chain are non- Coding RNA (lncRNA) etc..In the target gene of early stage research microRNA effect, calculating analysis pair is usually first passed through The base pairing of microRNA and target gene freely can be carried out prediction, and common software has a miRanda, TargetScan and Pictar etc..According to the target gene of prediction, the reporter gene progress that a series of experiments such as contains prediction bond area is redesigned Verifying.But microRNA at least only needs seed region only 6 base pairings when playing a role, so that The microRNA target prediction result of microRNA has very big uncertainty, and prediction result has hundreds of possibility sometimes.In order to logical It crosses experimental method and studies interaction between microRNA and mRNA with high throughput, HITS-CLIP method can be tied in Ago albumen On the basis of closing microRNA and target gene, the protein bound microRNA and mRNA of Ago is extracted by immuno-precipitation and is gone forward side by side Row high-flux sequence is analyzed in conjunction with bioinformatic analysis method, to obtain most probable microRNA and mRNA is mutual Interactively.

Interact information between the more direct RNA molecule of acquisition, has researcher to establish CLASH method, by egg The RNA combined in white compound is crosslinked with RNA, connect and etc. processing, available chimeric RNA sequence, and passing through The chimeric sequences information of its formation of library sequencing analysis is built, to obtain the information of RNA and RNA molecule interaction.However it uses The chimeric sequences ratio that CLASH method obtains is lower, and when studying yeast rna and RNA molecule interacts, chimeric sequences occupy height The 0.46% of total amount of data is sequenced in flux, in the analysis for people microRNA and target gene interaction, chimeric sequences ratio Example is about 2%.

But it is direct that either HITS-CLIP method or CLASH method, which cannot distinguish between the RNA-RNA interaction detected, Or it is indirect, and cannot pointedly study a certain RNA.Stop at RNA and RNA crosslinking by reverse transcription reaction, With the purifying based on antisense probe to specific RNA, there is researcher to establish and systematically study specific RNA and other RNA phases The method RAP-RNA of interaction.However RAP-RNA method cannot be used for interacting between research full-length genome RNA molecule, HITS- CLIP method and CLASH method are only used for the RNA interaction in research albumen composition.

To sum up, there is an urgent need in the art to establish comprehensively study the method to interact between RNA molecule.

Summary of the invention

Method and its application are analyzed and identified the purpose of the present invention is to provide a kind of novel RNA-RNA interaction, together When provide in a series of corresponding gene molecules and intermolecular chimeric sequences, these chimeric sequences can be used for medical diagnosis on disease With the detection of disease susceptibility.

In the first aspect of the present invention, a kind of similar RNA reverse transcription method is provided, comprising: unmatched using 3 ' ends RNA carries out the reaction of similar reverse transcription using reverse transcription system as primer.

In another aspect of this invention, a kind of method for connecting RNA when RNA reverse transcription or similar reverse transcription is provided, comprising: Use RNA as primer, reverse transcription product or similar reverse transcription product, it can and pairing complementary completely or partially with template strand RNA connection, and no matter should with template strand completely or partially it is complementary and match RNA 5 ' ends whether with template strand Match.

In a preferred embodiment, the starting base of similar reverse transcription reaction be with matched in RNA primer with template strand one A base.

In another preferred example, this principle can be used for judging RNA-RNA phase to the starting base with the pairing of template strand Interaction.

In another preferred example, judge that the further method of RNA-RNA interaction is using similar reverse transcription React the chimeric sequences obtained.

In another preferred example, one matches with template strand with complete or partial complementary and pairing the RNA of template strand Particular bases connect with reverse transcription product.

In another preferred example, the pairing of the particular bases and template strand can be used for judging that RNA-RNA interacts.

In another preferred example, judge that the further method of RNA-RNA interaction is using reverse transcription or class The chimeric sequences obtained like reverse transcription reaction.

In another preferred example, RNA primer can be external source addition, and it is endogenous to be also possible to sample.

In another preferred example, the unmatched RNA in 3 ' ends is used as primer or uses RNA as both sides of primer Method is to carry out simultaneously.

In another preferred example, comprising: can also mutually be connected with subsequent second chain cDNA synthesis step.

In another preferred example, it after being mutually connected with subsequent second chain cDNA synthesis step, can further be produced with cDNA It repairs step or is directly mutually connected with PCR reaction in the end of object.

In another preferred example, after being mutually connected with subsequent second chain cDNA synthesis step, can further and The end of cDNA product is repaired step and is mutually connected, and can further connect with connector, PCR amplification, DNA base Sequence Detection Equal conventional molecular biologicals operation is mutually connected.

In another preferred example, the template of reverse transcription or similar reverse transcription includes: artificial synthesized RNA sample, extraction The RNA of tissue or cell sample, including but not limited to total serum IgE, mRNA, non-coding RNA.

In another aspect of this invention, a kind of similar RNA reverse transcription method is provided, comprising: extract tissue or cell sample MRNA or total serum IgE, using reverse transcriptase obtain the first chain cDNA, utilize archaeal dna polymerase synthesize the second chain cDNA；Also, it should Method does not add external source reverse transcription primer.

In a preferred embodiment, it after synthesizing the second chain cDNA, further comprises the steps of: and end reparation is carried out to cDNA product.

In another aspect of this invention, a kind of method of identification RNA-RNA interaction is provided, which comprises

(1) cDNA product is obtained in the method；

(2) Sequence Detection, including but not limited to DNA sequencing are carried out to the cDNA product that step (1) obtains；

(3) analytical sequence testing result determines that RNA-RNA interacts according to the chimeric sequences of acquisition.

In a preferred embodiment, in (3), the determination RNA-RNA interaction includes: intramolecular RNA-RNA mutual Effect and intermolecular RNA-RNA interaction.

In another preferred example, the intramolecular RNA-RNA interacts according to detected corresponding chimaeric sequence Column are judged that the mode of these chimeric sequences includes but is not limited to: justice-antisense is fitting to connection mode, antisense-sense chimeric Connection mode, antisense-justice-antisense are fitting to connection mode.

In another preferred example, justice-antisense prna chimera connection mode is initially to be obtained by the method in claim 1 , antisense-justice prna chimera connection mode is initially to be obtained by the method in claim 2, antisense-justice-antisense Prna chimera connection mode be initially by the method in claim 1 and 2 while to be obtained.

In another preferred example, the described intermolecular RNA-RNA interaction is between identical gene molecule, or different Between gene molecule.

In another preferred example, intermolecular RNA-RNA interaction is according to detected corresponding chimeric What sequence was judged, the mode of these chimeric sequences includes but is not limited to: justice-antisense fitting connection mode, antisense-is just The fitting connection mode of justice, antisense-justice-antisense fitting connection mode.

In another preferred example, justice-antisense fitting connection mode is initially to be obtained by the method in claim 1 , antisense-justice fitting connection mode is initially to be obtained by the method in claim 2, and antisense-justice-antisense is embedding Closing connection mode is initially by the method in claim 1 and 2 while to be obtained.

In another preferred example, in (2), Sequence Detection is carried out to cDNA product, including but not limited to conventional sequencing, high pass Sequence is measured, high-flux sequence, including but not limited to both-end or single-ended high-flux sequence are preferably used；Preferably, the sequencing It is both-end high-flux sequence, sequence measuring joints is added at the both ends of cDNA double-strand, to carry out high-flux sequence.

In another preferred example, the method is non-disease diagnostic method.

It is described with intermolecular chimeric sequences in the natural not existing gene molecule that method described in front is any obtains The modes of chimeric sequences include but is not limited to: justice-antisense fitting connection mode, antisense-justice fitting connection mode, Antisense-justice-antisense fitting connection mode.

In a preferred embodiment, using the method obtain include or part comprising cited by table 1- table 4 with specific Gene is exemplary natural not existing chimeric sequences.

In another preferred example, the chimeric sequences include or part includes the original survey using the method acquisition Ordinal number according to SRX973697 (NCBI Sequence Read Archive accession number, http: // Www.ncbi.nlm.nih.gov/sra the natural not existing gene obtained after low quality sequence and joint sequence is rejected in) Intramolecular or intermolecular chimeric sequences.

In another preferred example, the chimeric sequences include or part includes the method using claim 1,2 and 17 The height of acquisition is similar to raw sequencing data SRX973697 (NCBI Sequence Read Archive accession Number, http://www.ncbi.nlm.nih.gov/sra) in reject after low quality sequence and joint sequence it is natural not In existing gene molecule or intermolecular chimeric sequences.

In another aspect of this invention, a kind of reagent detected according to the sequence is provided.

In a preferred embodiment, the reagent includes but is not limited to be reacted according to the sequence design or the PCR of development Reagent, sequencing reagent, high-flux sequence reagent, hybridization probe reagent.

In another aspect of this invention, a kind of method of medical diagnosis on disease or susceptibility analysis is provided, comprising: obtain subject Sample to be tested, using the reagent diagnosis disease or detection disease susceptibility.

In another aspect of this invention, a kind of method of medical diagnosis on disease or susceptibility analysis is provided, which comprises obtain The test serum or cell sample for obtaining subject, using the method identification RNA-RNA interaction situation, according to RNA- RNA interaction situation analysis disease susceptibility.

In a preferred embodiment, RNA-RNA interaction includes: intramolecular RNA-RNA interaction and molecule Between RNA-RNA interact；Preferably, the intramolecular RNA-RNA interaction is to occur to be fitted into gene, comprising: just The connection of justice-antisense prna chimera, the connection of antisense-justice prna chimera, antisense-justice-antisense prna chimera connection；Preferably Ground, the described intermolecular RNA-RNA interaction be occur between gene it is chimeric, comprising: the connection of justice-antisense prna chimera, instead The prna chimera connection of justice-justice, antisense-justice-antisense prna chimera connection.

In another aspect of this invention, it provides a kind of for detecting the metabolic diseases such as hyperglycemia, hyperlipidemia or related wind The reagent or kit of dangerous factor, it includes the primers of the specific Apoa2 chimeric sequences of specific amplification；The specific Apoa2 Chimeric sequences are Apoa2 justice cDNA the 508th and are connected to antisense sequences the 474th and are constituted (in terms of the number of sites of Sense sequences) Chimeric sequences.

In a preferred embodiment, the nucleotide sequence of the primer is as shown in SEQ ID NO:1 and SEQ ID NO:2.

In another aspect of this invention, it provides a kind of for detecting the metabolic diseases such as hyperglycemia, hyperlipidemia or related wind The reagent or kit of dangerous factor, it includes the primer of the specific Fabp1 chimeric sequences of specific amplification, the specific Fabp1 Chimeric sequences are Fabp1 Antisense cDNA the 46th and are connected to Sense sequences the 8th (in terms of the number of sites of Sense sequences) and are constituted Chimeric sequences.In a preferred embodiment, the nucleotide sequence of the primer is as shown in SEQ ID NO:3 and SEQ ID NO:4.

In another aspect of this invention, provide it is a kind of for detecting the reagent or kit of tumour or associated risk factors, It includes the primer of the specific catalase Catalase chimeric sequences of specific amplification, the specific catalase Catalase chimeric sequences are that the enzyme Catalase justice cDNA the 2054th of hydrogen peroxide is connected to the 2037th (with just sequence The number of sites meter of column) chimeric sequences that constitute of corresponding antisense sequences.In a preferred embodiment, the nucleotide sequence of the primer As shown in SEQ ID NO:5 and SEQ ID NO:6.

In another aspect of this invention, the purposes of the reagent is provided, the generations such as diagnosis hyperglycemia, hyperlipidemia are used to prepare The kit of thanking property disease or test for metabolic disorders neurological susceptibility；Or it is used to prepare diagnosing tumour or detects the examination of tumor susceptibility Agent box.

Other aspects of the invention are apparent to those skilled in the art due to this disclosure 's.

Detailed description of the invention

Fig. 1, the unmatched RNA in end can be used as the primer of reverse transcription reaction.

(A) experimental design schematic diagram.The Pax6RNA segment of in-vitro transcription matches RNA primer with end shown in figure The non-matching RNA primer (5m1mR, 5m2mR, 5m4mR, 5m8mR) in (5mR) and end carries out reverse transcription.It is synthesized in the second chain cDNA Later, PCR amplification is carried out with the primer of diagram (5D and 5mD), later the building and sequencing or electrophoresis detection for T/A clone. The base of red mark indicates and the unmatched sequence of Pax6RNA segment.

(B) pass through the PCR of 2 circulations and construct T/A clone and be sequenced and find that end matching and unmatched RNA are ok Primer as reverse transcription reaction.Upper section is representative sequencing result, underscore indicate to detect in RNA primer 5 The consistent sequence of a non-matching base.Lower section table indicates to contain lower stroke in the clone constructed after with RNA primed reverse transcription Ratio shared by the positive colony of line sequence column.

(C) further confirm that end matching and unmatched RNA all can serve as reverse transcription reaction by PCR and electrophoresis Primer.

(D) the new method schematic diagram of RNA-RNA interaction is studied by RNA primed reverse transcription.It is non-containing RNA primer The pcr amplification product for matching sequence can be detected by sequencing, so as to for studying RNA-RNA interaction.

Fig. 2, endogenous RNA primed reverse transcription method Library development flow and high-flux sequence aggregate analysis result.

(A) library construction strategy and high-flux sequence schematic diagram.

(B) pie chart indicate matching sequence, chimeric sequences between chimeric sequences (intra-cm-Seq) and gene in gene (inter-cm-Seq) the respective percentage of three parts.

(C) pie chart indicates that justice-antisense connection, antisense-justice connection and antisense-justice-are anti-in chimeric sequences in gene Justice three kinds of respective percentages of Main Patterns of connection.

(D) justice-antisense, antisense-justice and antisense-three kinds of justice-antisense Main Patterns in chimeric sequences in gene Connection schematic diagram.

Justice-antisense connection mode cDNA chimeric sequences analysis and verifying in Fig. 3, gene.

(A) the highest preceding 20 kinds of genes of justice-antisense connection mode chimeric sequences abundance in gene.

Justice-antisense connection mode chimeric sequences connection site is in gene C at (B) and Apoa2 (C) in (B and C) gene Distribution.

(D) the Cat chimeric sequences obtained in the high-flux sequence are connected to the G of antisense by the C2054 for being matched to positive-sense strand (i.e. the C2037 of positive-sense strand) forms (intra-Cat cm-Seq (S-2054, As- (S-2037))).

(E) the corresponding original mRNA segment of Cat chimeric sequences (D).

(F) the formation model of chimeric sequences intra-Cat cm-Seq (S-2054, As- (S-2037)).Left part is The secondary structure of prediction, right part indicate finally to generate chimeric sequences intra-Catcm- by endogenous RNA primed reverse transcription Seq(S-2054,As-(S-2037))。

(G) synthesized by endogenous RNA primed reverse transcription as shown in Figure 2 A and the second chain and etc., chimeric sequences intra- Cat cm-Seq (S-2054, As- (S-2037)) can pass through PCR electrophoresis and sequence verification.Herein in figure and other figures, arrow Indicate the purpose band of specificity, asterisk indicates nonspecific band.

(H) the Apoa2 chimeric sequences obtained in the high-flux sequence are connected to the T of antisense by the G508 of matching positive-sense strand (i.e. the A474 of positive-sense strand) forms (intra-Apoa2cm-Seq (S-508, As- (S-474))).

(I) the corresponding original mRNA segment of Apoa2 chimeric sequences (H).

(J) the formation model of chimeric sequences intra-Apoa2cm-Seq (S-508, As- (S-474)).Left part is pre- The secondary structure of survey, right part indicate finally to generate chimeric sequences intra-Apoa2cm- by endogenous RNA primed reverse transcription Seq(S-508,As-(S-474))。

(K) synthesized by endogenous RNA primed reverse transcription and the second chain and etc., chimeric sequences intra-Apoa2cm-Seq (S-508, As- (S-474)) can pass through PCR electrophoresis and sequence verification.

(L) justice-antisense connection mode chimeric sequences formation model in gene.A and b indicates nucleotide in positive-sense strand Position.

The chimeric sequences comparison and enrichment analysis of Fig. 4, Intra-Cat cm-Seq (S-2054, As- (S-2037)).

Fig. 5, chimeric sequences in the gene of Cat and Apoa2 are verified by mutation and bridge-type primer.

(A) pass through the schematic diagram of bridge-type primed reverse transcription and PCR amplification wild type and saltant type Cat.Left part indicates Reverse transcription and PCR reaction are carried out with bridge-type primer.Right side shows wild type and saltant type Cat, bridge-type primer and expected PCR product Base sequence.The base sequence of red dash area indicates that the stem sequence in the loop-stem structure of prediction, green base indicate prominent The base sequence of change.

(B) pass through the reverse transcription of bridge-type primer and PCR reaction and sequence verification chimeric sequences intra-Catcm-Seq Intramolecular interaction representated by (S-2054, As- (S-2037)) is implicitly present in.The transfection expression wild type and prominent in cell It after the plasmid of modification Cat, collects cell extraction total serum IgE and carries out reverse transcription with bridge-type primer, then use bridge-type primer and position PCR amplification is carried out in the primer combination of carrier.Purpose band size and sequencing result are all consistent with expection.Underlined sequences table Show the sequence consistent with bridge-type primer sequence, shade sequence expression saltant type Cat intramolecular secondary structure detects after opening.

(C) pass through the schematic diagram of bridge-type primed reverse transcription and PCR amplification saltant type Cat.Left part expression is drawn with bridge-type Object carries out reverse transcription and PCR reaction detection saltant type Apoa2.Right side shows wild type and saltant type Apoa2, bridge-type primer and pre- The base sequence of phase PCR product.The base sequence of red dash area indicates the stem sequence in the loop-stem structure of prediction, green alkali The base sequence of basis representation mutation.

(D) pass through bridge-type primed reverse transcription and PCR reaction and sequence verification chimeric sequences intra-Apoa2cm-Seq Intramolecular interaction representated by (S-508, As- (S-474)) is implicitly present in.Transfection expression wild type and mutation in cell After the plasmid of type Apoa2, is collected cell extraction total serum IgE as shown in figure (B) and carried out the reactions such as reverse transcription simultaneously with bridge-type primer Sequencing.Purpose band size and sequencing result are all consistent with expection.Underlined sequences indicate consistent with bridge-type primer sequence, Shade sequence indicates the sequence detected after saltant type Apoa2 intramolecular secondary structure opening.

Antisense-justice connection mode cDNA chimeric sequences analysis and verifying in Fig. 6, gene.

(A) the highest preceding 20 kinds of genes of antisense-justice connection mode chimeric sequences abundance in gene.

Antisense-justice connection mode chimeric sequences connection site is in gene C at (B) and Apoa2 (C) in (B and C) gene Distribution.

(D) the Cat chimeric sequences obtained in the high-flux sequence are by being matched to the A (i.e. the T1951 of positive-sense strand) of antisense strand The T1978 for being connected to matching positive-sense strand forms (intra-Cat cm-Seq (As- (S-1951), (S-1978))).

(E) the corresponding original mRNA segment of Cat chimeric sequences (D).

(F) the formation model of chimeric sequences intra-Cat cm-Seq (As- (S-1951), (S-1978)).Left part It is the secondary structure of prediction, right part indicates finally to generate chimeric sequences intra- by endogenous RNA primed reverse transcription Catcm-Seq(As-(S-1951),(S-1978))。

(G) synthesized by endogenous RNA primed reverse transcription as shown in Figure 2 A and the second chain and etc., chimeric sequences intra- Cat cm-Seq (As- (S-1951), (S-1978)) can pass through PCR electrophoresis and sequence verification.

(H) the Apoa2 chimeric sequences obtained in the high-flux sequence by matching antisense strand C (i.e. positive-sense strand G55) connection The T110 of matching justice forms (intra-Apoa2cm-Seq (As- (S-55), S-110))).

(I) the corresponding original mRNA segment of Apoa2 chimeric sequences (H).

(J) chimeric sequences intra-Apoa2cm-Seq (As- (S-55), S-110)) formation model.Left part is pre- The secondary structure of survey, right part indicate finally to generate chimeric sequences intra-Apoa2cm- by endogenous RNA primed reverse transcription Seq(As-(S-55),S-110))。

(K) synthesized by endogenous RNA primed reverse transcription and the second chain and etc., chimeric sequences intra-Apoa2cm-Seq (As- (S-55), S-110)) PCR electrophoresis and sequence verification can be passed through.

(L) antisense-justice connection mode chimeric sequences formation model in gene.C and d indicates nucleotide in positive-sense strand Position.

Antisense-justice-antisense connection mode cDNA chimeric sequences analysis and verifying in Fig. 7, gene.

(A) the highest preceding 20 kinds of genes of antisense-justice-antisense connection mode chimeric sequences abundance in gene.

Antisense-justice-antisense connection mode chimeric sequences connection site is in Gene A lb (B) and Fabp1 in (B and C) gene (C) distribution in.

(D) the Alb chimeric sequences obtained in the high-flux sequence are by being matched to the G (i.e. the C28 of positive-sense strand) of antisense strand even The T57 of matching positive-sense strand is connected to again by being matched to the C381 matching connection of positive-sense strand to the T (i.e. the A602 of positive-sense strand) of antisense strand Form (intra-Alb cm-Seq (As- (S-28), S-57；S-381, As- (S-602))).

(E) the corresponding original mRNA segment of Alb chimeric sequences (D).

(F) chimeric sequences intra-Alb cm-Seq (As- (S-28), S-57；S-381, As- (S-602)) formation mould Type.Left part is the secondary structure of prediction, and right part indicates finally to generate chimeric sequences by endogenous RNA primed reverse transcription Intra-Alb cm-Seq (As- (S-28), S-57；S-381, As- (S-602)).

(G) synthesized by endogenous RNA primed reverse transcription and the second chain and etc., chimeric sequences intra-Albcm-Seq (As- (S-28), S-57；S-381, As- (S-602)) PCR electrophoresis and sequence verification can be passed through.

(H) chimeric sequences intra-Alb cm-Seq (As- (S-28), S-57；S-381, As- (S-602)) formation it is logical The Alb RNA segment being transcribed in vitro is crossed further to verify.Experimental strategy schematic diagram and sequencing positive colony ratio are as shown in the figure.By It is lower in antisense-justice-antisense connection mode chimeric sequences abundance in gene, 25 have been carried out before building T/A clone The PCR of circulation.

(I) the Fabp1 chimeric sequences obtained in the high-flux sequence by matching antisense strand A (i.e. positive-sense strand T46) connection To matching positive-sense strand C86 again by being matched to the G336 matching connection of positive-sense strand to T (i.e. the A417 of positive-sense strand) shape of antisense strand At (intra-Fabp1cm-Seq (As- (S-46), S-86；S-336,As-(S-417))).

(J) the corresponding original mRNA segment of Fabp1 chimeric sequences (I).

(K) chimeric sequences intra-Fabp1cm-Seq (As- (S-46), S-86；S-336, As- (S-417)) formation mould Type.

(L) synthesized by endogenous RNA primed reverse transcription and the second chain and etc., chimeric sequences intra-Fabp1cm-Seq (As-(S-46),S-86；S-336, As- (S-417)) PCR electrophoresis and sequence verification can be passed through.

(M) antisense-justice-antisense connection mode chimeric sequences formation model in gene.

The analysis and verifying of chimeric sequences (inter-cm-Seq) between Fig. 8, gene.

(A) containing the highest preceding 20 kinds of genes of chimeric sequences abundance between gene.

(B) the Rn28s1-Sepp1 chimeric sequences obtained in the high-flux sequence are by being matched to the T4716 connection of Rn28s1 G (i.e. positive-sense strand C617) to matching Sepp1 antisense strand forms (Rn28s1-Sepp1cm-Seq (S-4716, As- (S- 617)))。

(C) between gene chimeric sequences Rn28s1-Sepp1cm-Seq (S-4716, As- (S-617)) formation model.Upper figure Indicate that the RNA-RNA intermolecular interaction model of prediction, the following figure indicate to ultimately generate molecule by endogenous RNA primed reverse transcription Between Rn28s1-Sepp1 chimeric sequences model.

(D) synthesized by endogenous RNA primed reverse transcription and the second chain and etc., chimeric sequences Rn28s1- between gene Sepp1cm-Seq (S-4716, As- (S-617)) can pass through PCR electrophoresis and sequence verification.

(E) the Rn28s1-Alb chimeric sequences obtained in the high-flux sequence are connected to by the T4716 for being matched to Rn28s1 The G (i.e. positive-sense strand C1722) for matching Alb antisense strand forms (Rn28s1-Alb cm-Seq (S-4716, As- (S-1722))).

(F) between gene chimeric sequences Rn28s1-Alb cm-Seq (S-4716, As- (S-1722)) formation model.

(G) synthesized by endogenous RNA primed reverse transcription and the second chain and etc., chimeric sequences Rn28s1-Alb between gene Cm-Seq (S-4716, As- (S-1722)) can pass through PCR electrophoresis and sequence verification.

(H) the Rn28s1-Plg chimeric sequences obtained in the high-flux sequence are connected to by the T4716 for being matched to Rn28s1 The G (i.e. positive-sense strand C481) for matching Plg antisense strand forms (Rn28s1-Plg cm-Seq (S-4716, As- (S-481))).

(I) between gene chimeric sequences Rn28s1-Plg cm-Seq (S-4716, As- (S-481)) formation model.

(J) synthesized by endogenous RNA primed reverse transcription and the second chain and etc., chimeric sequences Rn28s1- between gene Plgcm-Seq (S-4716, As- (S-481)) can pass through PCR electrophoresis and sequence verification.

Fig. 9, (A) high fat diet (high-fat diet, HFD) mouse fasting blood-glucose and normal diet (Chow) mouse phase Than significantly increasing.

(B) the horizontal significant raising of high fat diet mouse blood triglycerides (triglyceride).

(C) (abundance of S-508, As- (S-474) significantly rise intra-Apoa2cm-Seq in high fat diet mouse blood Height prompts corresponding secondary structure to dramatically increase.

(D) abundance of intra-Fabp1cm-Seq (As- (S-46), S-8) is remarkably decreased in high fat diet mouse blood, Corresponding secondary structure is prompted to substantially reduce.Every group of 3 mouse.*, P < 0.05.

The abundance ratio LO2 of intra-Cat cm-Seq (S-2054, As- (S-2037)) in Figure 10, HepG2 human liver cancer cell The significant raising of normal liver cell, prompts corresponding secondary structure to dramatically increase.*, P < 0.05.

Specific embodiment

The present inventor fortunately has found that end mismatches the RNA of (the end mismatch with target RNA section) under study for action It can be used as the primer of similar reverse transcription reaction, and it was found that reverse transcription product or similar reverse transcription product, it can be with template The complementary RNA with pairing is connected chain completely or partially, and no matter should be with complete or partial complementary and pairing the RNA's of template strand Whether 5 ' ends match with template strand.Reverse transcription or similar reverse transcription reaction based on the starting of endogenous RNA primer, and combine high pass Amount sequencing technologies establish a kind of efficient, accurate, direct and systematically research intramolecular and intermolecular RNA-RNA interaction New method, and identify and illustrate series of genes intramolecular and intermolecular chimeric sequences, and in corresponding RNA molecule With intermolecular interaction.It is very important in clinical diagnosis and disease susceptibility detection to find that these chimaeric sequences are shown simultaneously The application of aspect.

It is important to note that carrying out similar reverse transcription reaction when 3 ' ends of RNA primer and template strand mismatch When, it is to be different from existing reverse transcription principle.According to existing reverse transcription principle, 3 ' ends can not be inverted when mismatching Record.It fortunately, can be with a kind of unknown specific the inventors discovered that when 3 ' ends of RNA primer and template strand mismatch The mode of principle carries out the reaction of similar reverse transcription.Because the primer that the reaction system and reverse transcription reaction system are used only is not Together, because of referred to herein as similar reverse transcription reaction, referred to as similar to reverse transcription or class reverse transcription.The subsequent endogenous RNA primer mentioned is anti- The similar reverse transcription reaction that endogenous RNA is primer is refered in particular in transcription.

Intramolecular and intermolecular RNA-RNA interaction have the biological function that RNA brings into normal play very heavy The effect wanted has been set up a variety of methods at present to study RNA-RNA interaction.Most methods by chemical modification, The means such as digestion or crosslinking form the reverse transcription termination site that can be detected, then by calculate and analysis removal with The reverse transcription termination site of machine finally determines possible RNA-RNA interaction.In our current research, the present inventor establishes One kind being based on endogenous RNA primed reverse transcription (Endogenous RNA-primed Reverse Transcription, ERP-RT) It interacts with the new method of high-flux sequence to directly research and analyze RNA-RNA.In research RNA-RNA interaction, Inventors have surprisingly discovered that the unmatched RNA in end can be used as similar reverse transcription reaction in the case of not adding exogeneous primer Primer.Based on the similar reverse transcription reaction of this endogenous RNA, i.e. nearly 3 ' end one using wherein RNA and mould Initiation site of the matched base of plate chain as similar reverse transcription, and form cDNA in similar reverse transcription reaction and be connected with RNA The embedded structure connect can obtain the library of this embedded structure and carry out high-flux sequence, and can obtain full-length genome molecule The information of interior and intermolecular RNA interaction.

New discovery based on the present inventor provides the method for a kind of RNA reverse transcription and similar RNA reverse transcription, comprising: mention The mRNA or total serum IgE for taking tissue or cell sample obtain the first chain cDNA using reverse transcriptase, utilize archaeal dna polymerase synthesis the Two chain cDNA；Also, this method does not add external source reverse transcription primer.Preferably, further including step after synthesizing the second chain cDNA It is rapid: end reparation is carried out to cDNA product.

The characteristics of RNA reverse transcription of the invention and similar reverse transcription method method different from the past, is without addition external source Reverse transcription primer, but apply endogenous RNA as primer.Other than not applying exogeneous primer, carry out reverse transcription needed for its Its reagent and method condition can using reagent and method condition known to the present invention, such as using common reverse transcriptase, often The archaeal dna polymerase of rule is reacted.It can also be using commercialized kit is reacted in this field.

In turn, the present invention also provides a kind of methods of identification RNA-RNA interaction, which comprises (1) with aforementioned RNA reverse transcription method obtains cDNA product；The cDNA product obtained to step (1) is sequenced；Sequencing result is analyzed, is determined RNA-RNA interaction.The RNA-RNA interaction includes but is not limited to: intramolecular (in gene) RNA-RNA phase interaction With and intermolecular (between gene) RNA-RNA interaction.The intramolecular RNA-RNA interaction is that generation is embedding in gene It closes, including but not limited to: the fitting connection of justice-antisense, the fitting connection of antisense-justice, antisense-justice-antisense are chimeric Connection.The described intermolecular RNA-RNA interaction is to occur between gene chimeric, and including but not limited to: justice-antisense is chimeric Connection, the fitting connection of antisense-justice, antisense-justice-antisense fitting connection.It should be understood that applying method of the invention, also It can get the sequence of other connection types.

It needs further it is emphasized that the antisense-sense chimeric sequence obtained, is anti-in reverse transcription or class reverse transcription It is generated in a manner of a kind of unknown principle during answering.Analyzed from the chimeric sequences obtained, it should be reverse transcription product or Similar reverse transcription product, and template strand is complementary completely or partially and the RNA connection of pairing, and no matter be somebody's turn to do with template strand it is complete or Whether 5 ' the ends of partial complementarity and the RNA of pairing match with template strand, and the base connected must be and template strand phase It mutually matches, and this pairing can be used for judging the interaction of RNA-RNA.

The library cDNA can establish to the cDNA product of acquisition, so that further progress is routinely sequenced or high-flux sequence.It is high Throughput sequencing methodology can be it is known in the art after commercialized various methods, can be both-end sequencing or single-ended sequencing side Method.For example, it may be the various high-flux sequence methods of Illumina company exploitation, Illumina company provide the survey of commercialization Sequence connector docks in order to which instrument realization is sequenced with it in sequence to be measured.More specifically, for example can be using based on Illumina The sequencing approach of high seq2000, Illumina high seq2500, ABI solid, Roche 454.Illumina sequencing Other sequencing technologies and its sequence measuring joints other than technology be also commercialization or those skilled in the art understood.

The present inventor utilizes the above method, is reacted with endogenous RNA primed reverse transcription method mouse liver mRNA, structure It has built corresponding cDNA library and has carried out high-flux sequence.Data analysis shows that, obtain chimaeric sequence in about 10% gene Arrange the chimeric sequences between about 0.4% gene.Wherein chimeric sequences mainly include justice-antisense in gene, antisense-justice, instead Justice-three kinds of justice-antisense form, and these three forms can be by PCR and sequence verification.Also, chimeric sequences in gene Interaction can be mutated by critical sites in representative RNA molecule and bridge-type primed reverse transcription is verified.Further The study found that the RNA being transcribed in vitro can obtain the chimeric sequences of this complexity of antisense-justice-antisense by ERP-RT method.Separately Outside, the present inventor confirmed the presence of the chimeric sequences formed between gene also by PCR and sequencing.People speculates according to the present invention The action model of ERP-RT method, each chimeric sequences all represent a kind of unique intramolecular or intermolecular RNA-RNA is mutual Effect.

Answer the method, the present inventor obtains in a large amount of gene molecule and intermolecular chimeric sequences and corresponding RNA-RNA interaction, according to documents and materials almost all there is correlation with all diseases in these genes.Further have found Many disease correlation chimeric sequences, these chimeric sequences interact corresponding to specific RNA-RNA, including betide Apoa2 RNA-RNA interaction in gene betides the RNA-RNA interaction in Fabp1 gene, betides in Cat gene RNA-RNA interaction, etc..Based on the corresponding chimeric sequences of these RNA-RNA interaction, the present inventor carries out disease Correlation analysis, and some chimeric sequences have been determined there are correlations with specified disease.

The inventors discovered that Apoa2 chimeric sequences, such as Apoa2 justice cDNA the 508th is connected to antisense sequences The chimeric sequences of 474 compositions, it is closely related with hyperglycemia or hyperlipidemia.This chimaeric sequence in hyperglycemia or hyperlipidemia animal The horizontal conspicuousness of column is higher than intact animal.Therefore, it as preferred embodiment of the invention, provides described for identifying The primer of Apoa2 chimeric sequences, which can be applied to the hyperglycemia of diagnosis animal or whether hyperlipidemia occurs.Using described Primer carries out PCR amplification, determines that the Apoa2 chimeric sequences are improved with the presence or absence of conspicuousness according to the amount of pcr amplification product, into And judge hyperglycemia or hyperlipidemia whether occurs or hyperglycemia, the neurological susceptibility of hyperlipidemia.

The present inventors have additionally discovered that Fabp1 chimeric sequences, such as Fabp1 Antisense cDNA the 46th is connected to Sense sequences the 8th The chimeric sequences that position is constituted, it is closely related with hyperglycemia or hyperlipidemia.This chimeric sequences in hyperglycemia or hyperlipidemia animal Horizontal conspicuousness be lower than intact animal.Therefore, it as preferred embodiment of the invention, provides for identifying the Fabp1 The primer of chimeric sequences, which can be applied to the hyperglycemia of diagnosis animal or whether hyperlipidemia occurs.Utilize the primer PCR amplification is carried out, determines that the Fabp1 chimeric sequences are reduced with the presence or absence of conspicuousness according to the amount of pcr amplification product, and then sentence Broken height blood glucose or whether hyperlipidemia occurs or hyperglycemia, the neurological susceptibility of hyperlipidemia.

The present inventors have additionally discovered that Catalase chimeric sequences, such as Catalase justice cDNA the 2054th is connected to The chimeric sequences that 2037 corresponding antisense sequences are constituted, it is closely related with liver cancer.This chimeric sequences in liver cancer cells Horizontal conspicuousness is higher than normal liver cell.Therefore, it as preferred embodiment of the invention, provides described for identifying Whether the primer of Catalase chimeric sequences, the liver cancer which can be applied to diagnosis animal occur.Using the primer into Row PCR amplification determines that the Catalase chimeric sequences are improved with the presence or absence of conspicuousness according to the amount of pcr amplification product, in turn Judge whether liver cancer occurs or the neurological susceptibility of liver cancer.

The reagent of measurement chimeric sequences presence or absence of the present invention, can be comprised in kit, consequently facilitating this Field technical staff application.In the kit, it may also include other application in the reagent for carrying out PCR amplification.In addition, described Kit in may also include operation instructions, there is illustrated measuring method of the invention and interpretation of result methods.

In short, the present invention establishes a kind of completely new method based on endogenous RNA primed reverse transcription and high-flux sequence, from And RNA-RNA interaction efficiently can be identified and analyzed by chimeric sequences, it is that subsequent further research RNA-RNA is mutual Effect and relevant biological function provide important channel.

In non-disease diagnostic field, method of the invention can be applied to the fitting connection sequence to note abnormalities, carry out nucleic acid Sequence analysis；In medical diagnosis on disease field, the sequence that method of the invention can be applied to find RNA-RNA abnormal interaction is gone forward side by side The analysis of row disease susceptibility.

Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip Part such as J. Pehanorm Brooker etc. is write, Molecular Cloning:A Laboratory guide, the third edition, Science Press, condition described in 2002, or According to the normal condition proposed by manufacturer.

Materials and methods

Mouse

C57BL/6 mouse is purchased from this Leco Corp. of Shanghai and model animal research institute, Nanjing University.Experiment mice can be certainly By acquisition food and drinking-water, raising is in SPF grades of animal houses, and 22 ± 3 DEG C of environment temperature, 35 ± 5%, 12 hour daily cycle of humidity (6:30 bright light every morning).

Mammalian cell strain

HEK 293: human embryonic kidney epithelial cells.

Main agents, kit

Trizol:Invitrogen company；PolyATtract mRNA Isolation System:Promega company； MRNA-Seq sample Prep Kit:Illumina company；QIAquick PCR Purification Kit:Qiagen is public Department；PGEM-T Easy vector:Promega company；Site-directed mutagenesis kit: Agilent company；DMEM culture medium and tire ox Serum: GIBCO company；RNA Oligo: Shanghai JiMa pharmacy Technology Co., Ltd；DNA primer: Shanghai JaRa bioengineering has Limit company.Other reagents unless otherwise specified, are purchased from China producer.

The collection of mouse liver sample, carries out similar reverse transcription reaction and the synthesis of the second chain at liver organization mRNA extracting

Mouse first uses 1% yellow Jackets to anaesthetize (final concentration of 90mg/kg weight), then uses nuclease free deionized water The PBS perfusion of preparation removes blood, rapidly collect liver be placed in it is quick-frozen in liquid nitrogen after be stored in -80 DEG C of refrigerators, for extracting RNA.

Liver specimens are ground to powdered in liquid nitrogen.1ml Trizol is added in about 100mg liver organization powder, sufficiently mixed It is even.5 minutes are placed at room temperature for, the chloroform of 0.2ml is then added, acutely after concussion 15 seconds, is stored at room temperature 2-3 minutes, 12,000g, 4 DEG C centrifugation 15 minutes after, take supernatant (about 0.5ml) into new centrifuge tube, add 0.5ml isopropanol mix, be placed at room temperature for After ten minutes, 12,000g, 4 DEG C be centrifuged 10 minutes, after the precipitating ethanol washing of 1ml 75%, remove supernatant and dry residual second Alcohol.Precipitating is dissolved in appropriate nuclease free deionized water, purity and concentration are detected.

Then with Promega companyMRNA Isolation System II kit is from total serum IgE Middle extraction mRNA.For the secondary structure for keeping RNA, the total serum IgE of the nearly 5mg of 2.43ml volume total amount is incubated for 10 minutes at 37 DEG C, so Oligo (dT) probe of biotin labeling and the SSC of 20X are added afterwards and is extracted at room temperature by kit operating instruction mRNA.MRNA obtained uses the RNase-free DNase I kit of Takara company to handle to remove DNA pollution, so again Afterwards to specifications with phenol chloroform and with being dissolved in nuclease free deionized water after ethanol precipitation.

Reverse transcription or similar reverse transcription reaction carry out in M-MLV reverse transcriptase (Promega) reaction system of 20 μ l, most Making reaction buffer eventually is 1X, and reverse transcriptase is 10U/ μ l, dNTP 0.5mM, and recombinant RNA enzyme inhibitor (Takara) is 1U/ μ l, template be 10ng/ μ l RNA segment or 50-100ng/ μ l mRNA (exogeneous primer is not added in the system, this is because It is unmatched there are 3 ' endogenous ends or the matched nucleic acid in 3 ' ends is as primer).For initial sample be RNA segment or The case where mRNA, obtains the first chain cDNA in 37 DEG C of reaction 9min；It the case where being total serum IgE for initial sample, is reacted at 37 DEG C 60 minutes the first chain cDNA of acquisition.Then 10 minutes are incubated for inactivate the termination reaction of M-MLV reverse transcriptase for 70 DEG C.On ice bath to It has synthesized in the 20 μ l reaction systems of the first chain cDNA and has sequentially added following reagent: DNA polymerase i reaction buffer (10X) 8 1 μ l of μ l, RNase H (NEB) (1U/ μ l), 3 μ l of DNA polymerase i (10U/ μ l) (Fermentas), nuclease free deionized water 68 μl.Rear centrifugation liquid is mixed gently, and is incubated for 2 hours at 15 DEG C.The T4DNA Polymerase of 2.5 μ l is then added (Fermentas) and at 15 DEG C it is incubated for 15 minutes.Finally recycled with the PCR QIAquick Gel Extraction Kit of Qiagen.After recovery product Continue for building library or pcr amplification reaction.

Build library and high-flux sequence

The second chain cDNA synthetic product is carried out with the mRNA-seq sample prep kit of Illumina company subsequent Build library processing.Key step includes: after the second chain cDNA synthetic product end is repaired, to add A in 3 ' ends of double-strand, is connected The both-end sequence measuring joints of Illumina company then purify the segment between 100-500bp range, are purified by PCR amplification CDNA segment.Sample carries out both-end sequencing with Illumina HiSeq 2000 after purified PCR amplification.

Bioinformatic analysis

Using the High Performance Computing Cluster of Shanghai nutrition science research institute, life science institute to high-flux sequence result It is analyzed.The low-quality sequence of removal is first filtered for the high-throughput both-end sequencing result of HiSeq2000, including there is N in centre Sequence or be full A or T sequence and residual joint sequence.Using Bowtie (http://bowtie- Bio.sourceforge.net/index.shtml) and in Blast analytic process, when screening exactly matches sequence, at most allow One base mispairing, does not allow centre to have insertion or missing.The high quality sequence of acquisition first passes through Bowtie and is downloaded from NCBI under The library mouse RNA (ftp: //ftp.ncbi.nlm.nih.gov/genomes/M_musculus/RNA/) matched.Then Fail exact matching sequence pass through again Blast respectively with mouse rDNA repetitive unit (GenBank:BK000964) and mitochondria DNA is matched.For the sequence that high-flux sequence obtains, only both-end sequence is all exactly matched to the library mouse RNA, rDNA weight Being named as of multiple unit or mitochondrial DNA, matches sequence (Matched reads).Sequence is being mismatched using Blast analysis When, a base mispairing does not allow to exist.Fail exact matching sequence again by Blast respectively with the library mouse RNA, When rDNA repetitive unit or mitochondrial DNA match, rules of order are as follows: when there is the exact matching of the segment greater than 50nt in one end, remain Remaining fragment sequence preferentially attempt compare has matched gene, if cannot match again with the library mouse RNA, rDNA repetitive unit or mitochondria Other sequences are compared in DNA.Obtained not match in sequence, both-end sequence, which is matched to, mutually isogenic is named as base Because of interior chimeric sequences (intragene chimericsequence), and a terminal sequence is exactly matched to a certain gene, the other end When being matched to the sequence of different genes comprising two sections, it is named as chimeric sequences (intergene chimeric between gene sequence)。

The forecast analysis of RNA interaction

Vienna RNAfold webserver(http://rna.tbi.univie.ac.at/cgi-bin/ RNAfold.cgi) for carrying out sunykatuib analysis (Gruber AR etc., The Vienna RNA to RNA secondary structure Websuite.Nucleic Acids Res 2008,36:W70-74).The program is mainly counted by RNA basepairing rule The best free energy that RNA is folded is calculated, to predict the secondary structure of RNA.RNAhybrid(http:// Bibiserv.techfak.uni-bielefeld.de/rnahybrid) it is used for the prediction of RNA-RNA intermolecular interaction Analyze (RehmsmeierM etc., Fast and effective prediction of microRNA/target Duplexes.RNA 2004,10:1507-1517).

Plasmid construction

PCMV-Pax6 building: the Pax6 gene order of mouse is expanded from mouse cDNA using primer and is obtained, through BamH I PCMV-Pax6 is built into Xho I site insertion pCMV-Tag 3B (Stratagene).Primer sequence is as follows:

5 '-ATGGATCCATGCAGAACAGTCACAGCG-3 ' (SEQ ID NO:7),

5’-GGCTCGAGTCTCTTTACTGTAATCGAG-3’(SEQ ID NO:8)。

PRL-Cat-WT building: the catalase gene fragment order of mouse is expanded from mouse liver cDNA using primer It obtains, is built into pRL-Cat-WT through Sal I and Kpn I site insertion pRL-TK (Promega).Primer sequence is as follows:

5 '-ACTCGTCGACTGAGGAGACCTCTCGTGAAG-3 ' (SEQ ID NO:9),

5’-GGGGTACCTCTGGCCGCTGGCGCTT-3’(SEQ ID NO:10)。

PRL-Cat-Mut building: Quikchange Site-Directed Mutagenesis Kit is used, is made referring to it PRL-Cat-WT be mutated with explanation, it is as follows to be mutated used primer sequence:

5'-AGATAAAAATCTTGGCGTCTCTAGTGTATTCTCCTATTA-3'(SEQ ID NO:11)；

5’-TAATAGGAGAATACACTAGAGACGCCAAGATTTTTATCT-3’(SEQ ID NO:12)。

PRL-Apoa2-WT building: the Apoa2 sequence of mouse synthesizes following four single stranded DNAs by Shanghai JaRa company, warp Annealing is crossed to obtain.

5’-CTAGAGATGTGCCAGGCCCAGTCTTCCCACCCCAGCTGCTCCACTGGCCACCGCTAGAGCCCCTC TCCCTACCTTCTGCC-3 ' (SEQ ID NO:13),

5 '-TGTTTTCTCCAATAAATGCGGAAGGAGTTAAACTTCATGC-3 ' (SEQ ID NO:14),

5’-GGCCGCATGAAGTTTAACTCCTTCCGCATTTATTGGAGAAAACAGGCAGAAGGTAGGGAGAGGGG CTCTAGCGGT-3 ' (SEQ ID NO:15),

5’-GGCCAGTGGAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCT-3’(SEQ ID NO:16)。

PRL-Apoa2-WT is built into through Xba I and Not I site insertion pRL-TK.

PRL-Apoa2-Mut: the Apoa2 mutant nucleotide sequence of mouse synthesizes following four single stranded DNAs by Shanghai JaRa company, warp Annealing is crossed to obtain.

5’-CTAGAGATGTGCCAGGCCCAGTCTTCCCACCCCAGCTGCTCCACTGGCCACCGCTAGAGCCCCTC TCCCTACCTTCTGCC-3 ' (SEQ ID NO:17),

5 '-TGTTTTCTCCAATAAATGATTCTTTAGTTAAACTTCATGC-3 ' (SEQ ID NO:18),

5’-GGCCGCATGAAGTTTAACTAAAGAATCATTTATTGGAGAAAACAGGCAGAAGGTAGGGAGAGGGG CTCTAGCGGT-3 ' (SEQ ID NO:19),

5’-GGCCAGTGGAGCAGCTGGGGTGGGAAGACTGGGCCTGGCACATCT-3’(SEQ ID NO:20)。

PRL-Apoa2-Mut is built into through Xba I and Not I site insertion pRL-TK vector.

External rna transcription

DNA profiling for transcribing mouse Pax6RNA sequence is obtained using primer Pax6F and Pax6R from pCMV-Pax6 amplification ?.DNA profiling for transcribing mouse Alb RNA sequence is expanded from mouse liver cDNA using primer Alb F and Alb R to be obtained ?.Specific primer sequence is as follows:

Pax6F:5 '-CGTGGATAGCGGTTTGACTCACGG-3 ' (SEQ ID NO:21),

Pax6R:5 '-GCGTGTGCCCCAGCTTC-3 ' (SEQ ID NO:22)；

Alb F:5 '-TAATACGACTCACTATAGGGAGACCCACTAGCCTC-3 ' (SEQ ID NO:23), contains T7promoter sequence is in order to being subsequently used for the in-vitro transcription of RNA),

Alb R:5 '-AATTAACCCTCACTAAAGCCCACTAGCCTC-3 ' (SEQ ID NO:24)；

The advanced row agarose gel electrophoresis of the pcr amplification product of acquisition then uses Ago-Gel DNA QIAquick Gel Extraction Kit (JaRa company) carries out gel extraction to purpose band, and recovery product is diluted to 500 μ l of final volume, then with isometric phenol/chloroform (1:1) is stripped, and 12,000g, 4 DEG C of centrifugations after ten minutes, supernatant are transferred in new centrifuge tube, is then added isometric Chloroform be stored at room temperature 2-3 minute after mixing 15 seconds, after 12,000g, 4 DEG C are centrifuged 15 minutes, take supernatant to new centrifuge tube In, the 3M sodium acetate (pH 5.2) of 1/10 volume is added, the ethyl alcohol of 2.5 times of volumes mixes, after -80 DEG C are placed 30 minutes, 12, 000g, 4 DEG C be centrifuged 10 minutes, precipitating with 1ml nuclease free deionized water prepare 75% ethanol washing after, remove supernatant and dry Residual ethanol.Precipitating is dissolved in appropriate nuclease free deionized water, purity and concentration are detected.

The linear DNA fragments of purifying are for establishing following reaction system: 10 10 μ of μ l, dNTP10mM of 5X transcription buffer L, the 1 μ g of DNA profiling of linearisation, RNase inhibitor 50U, T3 or T7RNA Polymerase30U, supplement nuclease free go from Sub- water is to 50 μ l.After 37 DEG C of 2 hours of reaction, the RNase-freeDNase I that 2U is added is mixed to react 15 minutes in 37 DEG C To remove DNA profiling.It is taken out by the RNA product dilution final volume of transcription to 500 μ l, then with isometric phenol/chloroform (1:1) It mentions, 12,000g, 4 DEG C of centrifugations after ten minutes, supernatant are transferred in new centrifuge tube, isometric chloroform is then added, and are mixed After 15 seconds, it is stored at room temperature 2-3 minutes, after 12,000g, 4 DEG C are centrifuged 15 minutes, take supernatant into new centrifuge tube, add 1/ The ethyl alcohol of 3M sodium acetate (pH 5.2) and 2.5 times of volumes of 10 volumes are placed 30 minutes, 12,000g, 4 DEG C after mixing at -80 DEG C Centrifugation 10 minutes removes supernatant and dries residual second after precipitating uses 75% ethanol washing of 1ml nuclease free deionized water preparation Alcohol.Precipitating is dissolved in appropriate nuclease free deionized water, purity and concentration are detected.

Cell culture and plasmid transfection

Cell incubator is kept for 37 DEG C, and contains 5% carbon dioxide.Passage in cell generally every 2-3 days is primary, before keeping passage Density be more than 80% but less than 100%.Cell is inoculated into 6 orifice plates using first 16-24 hours.HEK293 cell strain culture In the DMEM culture solution containing 10%FBS, 100U/ml penicillin, 100 μ g/ml streptomysins and 25mM glucose.

Cell is advisable between 60-80% in density before transfection, is transfected using Lipofectamine 2000.Plasmid transfection Amount is 2 holes μ g/, and transfection collected cell after 24 hours.

Cell total rna extracting

The every hole cell of 6 orifice plates is cracked with 1ml Trizol, is transferred in 1.5ml EP and is placed at room temperature for after five minutes, is added The chloroform of 0.2ml after acutely rocking 15 seconds, is stored at room temperature 2-3 minutes, 12,000g, 4 DEG C after centrifugation 15 minutes, takes supernatant to new Centrifuge tube in (about 0.5ml), add 0.5ml isopropanol mix, be placed at room temperature for after ten minutes, 12,000g, 4 DEG C centrifugation 10 minutes, after precipitating uses the ethanol washing of 1ml 75%, supernatant is removed, residual ethanol is dried, precipitating is dissolved in appropriate nuclease free In deionized water, purity and concentration are detected.It is obtained with the RNase-free DNase I processing extracting of Takara company total RNA, to remove possible DNA pollution, then according to the specification phenol chloroform of DNase I and with being dissolved in after ethanol precipitation Nuclease free deionized water, then detect its purity and concentration.OD260/280 > 1.9 meet using standard.Purified total serum IgE It can be used for reverse transcription reaction.

PCR and sequencing

Expanded according to after the different PCR reaction condition of different primer combination confirmations using rTaq enzyme or Ex-Taq enzyme Increase.Description for specific chimeric sequences, wherein " Intra " indicates intramolecular, " cm " indicates chimeric, and " S " indicates justice, " AS " Indicate antisense, As- (S- number of sites) indicates antisense sequences but number of sites is in terms of justice.The primer that PCR is used are as follows:

Intra-Cat cm-Seq (S-2054, As- (S-2037)):

5 '-GAGAATAGTGTATTCTCGCC-3 ' (SEQ ID NO:25), and

5'-TGACTACATTTAAAATGATTACAAG-3'(SEQ ID NO:26)；

Intra-Apoa2cm-Seq (S-508, As- (S-474)):

5 '-CTTCTGCCTGTTTTCTCCAATAAATGCG-3 ' (SEQ ID NO:27), and

5'-GAGATGTGCCAGGCCCAGTCTTCCC-3'(SEQ ID NO:28)；

Intra-Cat cm-Seq (As- (S-1951), S-1978):

5 '-ATGTAGTCATTTAAATGATTACAAG-3 ' (SEQ ID NO:29), and

5'-GGAGAATACACTATTCTCGCC-3'(SEQ ID NO:30)；

Intra-Apoa2cm-Seq (As- (S-55), S-110):

5 '-GCTTCATGATGGCAGACTATG-3 ' (SEQ ID NO:31), and

5'-AAAGCTCCTTCCAGGCTACAG-3'(SEQ ID NO:32)；

Intra-Alb cm-Seq (As- (S-28), S-57；S-381, As- (S-602)):

5 '-CCCACTTCATTTTGCCAGA-3 ' (SEQ ID NO:33), and

5'-AGAACTTCTTTACTATGCTGAGC-3'(SEQ ID NO:34)；

Intra-Fabp1cm-Seq (As- (S-46), S-86；S-336, As- (S-417)):

5 '-CCTGGCTCTGCAATTGGTAC-3 ' (SEQ ID NO:35), and

5'-CATTGGGCGACATTGTCTACA-3'(SEQ ID NO:36)；

Rn28s1-Sepp1cm-Seq (S-4716, As- (S-617)):

5 '-CAGCCCTCGACACAAGGGT-3 ' (SEQ ID NO:37), and

5'-GATGACTTCCTCATCTATGACAG-3'(SEQ ID NO:38)；

Rn28s1-Alb cm-Seq (S-4716, As- (S-1722)):

5 '-TGAAAGTCAGCCCTCGACA-3 ' (SEQ ID NO:39), and

5'-GATATCTGCACACTTCCAGAGA-3'(SEQ ID NO:40)；

Rn28s1-Plg cm-Seq (S-4716, As- (S-481)):

5 '-AGCCCTCGACACAAGGGTT-3 ' (SEQ ID NO:41), and

5’-TCCAGGACAAAGAGTGGTGTT-3’(SEQ ID NO:42)。

Design and synthesize the 5 '-GACCATGAGGTAATAGGCCAA-3 ' of bridge-type primer for murine genes catalase (SEQ ID NO:43) and 5 '-ATGAAGTTTAACTTAGGG-3 ' of Apoa2 bridge-type primer (SEQ ID NO:44) are for examining It is no that there are corresponding secondary structure (Kedde M etc., Nat Cell Biol 2010,12:1014-1020).From HEK293 cell The total serum IgE of middle extraction purification M-MLV reverse transcriptase and bridge-type primer carry out reverse transcription reaction, obtain cDNA as template, divide The primer 5 '-CGTTCGTTGAGCGAGTTC-3 ' (SEQ ID NO:45) and 5 '-of pRL-TK carrier Yong be located at AAGTTCGTCGTCCAACATTA-3 ' (SEQ ID NO:46) is combined with corresponding bridge-type primer carries out PCR amplification.

Pcr amplification product connects in pGEM-T Easy carrier, and is transformed into bacillus coli DH 5 alpha.Pass through blue hickie Screening and with positioned at carrier primer sequence 5 '-CAAGGCGATTAAGTTGGGTAA-3 ' (SEQ IDNO:47) and 5 '- It agarose gel electrophoresis screening positive clone and is surveyed after CTATGACCATGATTACGCCAAG-3 ' (SEQ ID NO:48) amplification Sequence.

Embodiment 1, the unmatched RNA in end can be used as the primer of similar reverse transcription reaction

In the prior art, whether end and the unmatched RNA of template can be as the primers of similar reverse transcription reaction and unclear Chu, present inventor has performed verifyings.

According to the RNA segment (template) of Pax6, designs an end matching but centre there are 5 unmatched RNA of base to draw Object, and devise 4 ends based on this primer and mismatch the different RNA primer of base number, then pass through in-vitro transcription The RNA segment of Pax6 studies end as template and mismatches effect (Figure 1A) of the RNA in similar reverse transcription reaction.Use M- MLV reverse transcriptase is in 37 DEG C of one hours of reaction, and after completing the second chain cDNA synthesis, using for intermediate 5 not Corresponding primer is synthesized with base design and the recurring number different by PCR amplification, obtained product is respectively used to connection carrier and surveys Sequence and agarose gel electrophoresis detection (Figure 1A).It is to obtain double-stranded DNA effectively to connect that wherein PCR-, which expands 2 circulations, It is connected in carrier T and is sequenced.When occurring the complementary series TGATC of 5 mismatch base ACUAG in sequencing result, and end When end mismatches sequence disappearance, illustrate that the end of design mismatches RNA and can also exercise function (Figure 1A of primer in reverse transcription And 1B).In PCR amplification, only can just be amplified with the 5D primer consistent with base sequence red among reverse transcription primer Product, and the primer 5mD after being mutated cannot then make template amplification of reverse transcription product and go out corresponding band (Figure 1A and 1C), into one Step prompt end, which mismatches RNA, can be used as primer progress reverse transcription.

The experimental results showed that the unmatched RNA in end and the matched RNA in end equally all can serve as reverse transcription or similar The primer of reverse transcription reaction, and the chimeric sequences of cDNA the first chain and RNA primer can be obtained.It is matched and is mismatched based on end RNA primer carry out reverse transcription and similar reverse transcription to obtain chimeric sequences, thus to study the working principle of RNA interaction Figure, referring to Fig. 1 D.

The experiment flow and high-flux sequence that embodiment 2, endogenous RNA primed reverse transcription method research RNA-RNA interact Aggregate analysis result

In order to study the RNA-RNA interaction of full-length genome range, extracts mouse liver mRNA and be not added with The similar reverse transcription reaction of any exogeneous primer is (subsequent to be known as endogenous RNA primed reverse transcription or endogenous RNA primed reverse transcription Method), and the second chain cDNA is synthesized, and builds library and high-flux sequence (Fig. 2A).Raw sequencing data is stored in the SRA of NCBI, number According to number be SRX973697 (NCBI Sequence Read Archive accession number, http: // www.ncbi.nlm.nih.gov/sra)。

For the chimeric sequences for finding needs, bioinformatic analysis is carried out to high-flux sequence data.Analysis is as the result is shown 51.3% sequence is exact matching sequence, and about 9.97% is (the intragene chimeric of chimeric sequences in gene Sequence, intra-cm-Seq), i.e. the segment of composition chimeric sequences all matches same gene, and about 0.43% sequence is base The chimeric sequences (intergene chimeric sequence, inter-cm-Seq) because between form two pieces of chimeric sequences Section is matched to two different genes (Fig. 2 B).It has furthermore been found that chimeric sequences are mainly by three kinds of different connection types in gene It constitutes, wherein justice-antisense connection mode chimeric sequences (intra-cm-Seq linked from sense to Antisense cDNA fragment, intra-cm-Seq (S-As)) 61.8% is accounted for, antisense-justice connection mode (intra- Cm-Seq linked from antisense tosense cDNA fragment, intra-cm-Seq (As-S)) it is chimeric Sequence accounts for 15.0%, and more peculiar from antisense-justice-antisense connection mode chimeric sequences (intra-cm-Seq linked from linked from antisense to sense and then to antisense cDNA Fragment, intra-cm-Seq (As-S-As)) account for 8.8% (Fig. 2 C and Fig. 2 D).

These results indicate that establishing a kind of new method by endogenous RNA primed reverse transcription and high-flux sequence, and obtain It obtained in a large amount of expected gene molecules and intermolecular chimeric sequences.

Justice-antisense connection mode cDNA chimeric sequences analysis and verifying in embodiment 3, gene

In order to further study justice in gene-antisense connection mode chimeric sequences (intra-cm-Seq (S-As)), Include the highest preceding 20 kinds of genes such as Fig. 3 A of justice-antisense connection mode abundance.It is arranged comprising justice-antisense connection mode gene Table is referring to table 5.2 kinds of relatively common genes are had chosen from the highest preceding 20 kinds of genes of abundance as sample carries out subsequent depth Enter research, enzyme Catalase (Cat) (NM_009804.2, Mus musculus including coding catalytic decomposition hydrogen peroxide Catalase the second high albumin A poa2 (NM_013474.2, Mus musculus abundant) and in encoding high density lipoprotein apolipoprotein A-II).The chimeric sequences of Cat and Apoa2 are mainly distributed on 3 ' UTR regions, are partially distributed in the area CDS, In the 5 ' areas UTR almost without distribution (Fig. 3 B and 3C).The corresponding particular sequence of the chimeric sequences of Apoa2 is referring to table 1.

It being found when analyzing Cat chimeric sequences, the C in 2054 site Cat justice cDNA is connected to the G of Antisense cDNA, that is, The C in the just site cDNA2037 forms Cat chimeric sequences intra-Cat cm-Seq (S-2054, As- (S-2037)).Choosing It takes one of chimeric sequences to carry out detailed analysis (Fig. 3 D), and has listed file names with Cat corresponding to this chimeric sequences MRNA sequence (Fig. 3 E).It is embedding to this in order to explain the reason of intra-Cat cm-Seq (S-2054, As- (S-2037)) is formed It closes the corresponding original RNA sequence of sequence and has carried out secondary structure prediction, and it was found that the sequence between C2037 and C2054 Loop-stem structure (Fig. 3 F) can be formed.The structure of reference prediction and the chimeric sequences of acquisition are found in endogenous RNA primed reverse transcription When generation, if carrying out reverse transcription by prime end of C2054, and using C2037 as first nucleotide of template strand, in this way The formation mechenism (Fig. 3 F) of intra-Cat cm-Seq (S-2054, As- (S-2037)) can be just explained almost ideally.

Meanwhile it being carried out with products as templates of the mouse liver mRNA after endogenous RNA primed reverse transcription and the synthesis of the second chain PCR is simultaneously sequenced, and further demonstrates the presence (Fig. 3 G) of intra-Cat cm-Seq (S-2054, As- (S-2037)).In addition it sends out Existing, intra-Cat cm-Seq (S-2054, As- (S-2037)) can exist in a variety of forms, the sequence specifically detected and The abundance of various sequences is shown in Fig. 4.

Similarly, the chimeric sequences intra-Apoa2cm-Seq (S-508, As- (S-474)) of Apoa2 is analyzed, and List the corresponding Apoa2mRNA sequence of the chimeric sequences (Fig. 3 H and 3I).In the secondary structure prediction to Apoa2mRNA sequence In, it is found that the sequence between A474 and G508 can form loop-stem structure (Fig. 3 J).The structure of reference prediction and the present inventor obtain The chimeric sequences obtained have been found that using G508 as prime end progress endogenous RNA primed reverse transcription, and using A2037 as template First nucleotide of chain, can just explain intra-Apoa2cm-Seq (S-508, As- (S- almost ideally in this way 474) formation mechenism).In addition, PCR and sequencing result demonstrate intra-Apoa2cm-Seq's (S-508, As- (S-474)) In the presence of (Fig. 3 K).

The formation model of chimeric sequences (intra-cm-Seq (S-As)) in this justice-antisense connection mode cDNA gene See Fig. 3 L.

These results indicate that justice-antisense connection mode chimeric sequences (intra-cm-Seq (S-As)) can be in gene By endogenous RNA primed reverse transcription, the synthesis of the second chain and PCR formation, and to confirm that intramolecular RNA interaction provides Positive evidence.Meanwhile distribution characteristics of the chimeric sequences intra-cm-Seq (S-As) on a certain gene, also reflect this Distribution situation of the RNA interaction on the gene in types of molecules.

Embodiment 4 verifies justice-antisense connection mode cDNA chimeric sequences in gene by mutation and bridge-type primer

In order to further confirm that justice in this gene-antisense connection mode chimeric sequences (intra-cm-Seq (S-As)) Interaction in revealed RNA molecule, for related with intra-Cat cm-Seq (S-2054, As- (S-2037)) and Relevant loop-stem structure (Fig. 3 F and Fig. 3 J), devises bridge-type and draws with intra-Apoa2cm-Seq (S-508, As- (S-474)) Object reverse transcription method confirms its presence.

According to bridge-type primer action character, when forming loop-stem structure, bridge-type primer will be inverted across loop-stem structure Record reaction, will obtain the shorter product without containing loop-stem structure regional sequence in this way；And it is mutated when being introduced in critical sites After causing loop-stem structure to be destroyed, bridge-type primer is then possible to part annealed pairs to open loop-stem structure area when reverse transcription Domain, to obtain the longer RT-PCR product (Fig. 5 A and 5C) compared with wild type product.

Using this principle, the plasmid for carrying and forming loop-stem structure sequence and mutant nucleotide sequence has been transfected respectively in cell PRL-Cat-WT and pRL-Cat-Mut.The total serum IgE for extracting Transfected cells, carries out RT-PCR with corresponding Cat bridge-type primer.This Inventors have found that the RT-PCR product of cell total rna of the transfection containing mutant nucleotide sequence plasmid wants longer really, and its RT-PCR The corresponding sequencing result of product is also (9B) completely the same with expection.This result shows that, in sequence critical sites mutation after destroy The formation of loop-stem structure suggested by intra-Cat cm-Seq (S-2054, As- (S-2037)).That is, this is chimeric Cat mRNA intramolecular interaction suggested by sequence is implicitly present in.

Equally, for loop-stem structure suggested by intra-Apoa2cm-Seq (S-508, As- (S-474)), phase is devised The bridge-type primer and mutant plasmid (pRL-Apoa2-WT and pRL-Apoa2-Mut) of pass, and carried out respective transfection and RT-PCR Experiment.The results show that mutation after cell total rna RT-PCR product it is longer, corresponding sequencing result also with expection complete one It causes, it is shown that Apoa2mRNA intramolecular interaction suggested by intra-Apoa2cm-Seq (S-508, As- (S-474)) In the presence of (Fig. 5 D).

These results further demonstrate that, the inventors discovered that intra-cm-Seq (S-As) type intramolecular RNA phase Interaction is accurately credible.

Antisense-justice connection mode cDNA chimeric sequences analysis and verifying in embodiment 5, gene

To study antisense-justice connection mode chimeric sequences intra-cm-Seq (As-S) in gene, by high throughput In sequencing result in gene chimeric sequences in-depth analysis, obtain in Fig. 2 that antisense-justice connection mode is fitted into the gene that refers to The all information of sequence, and list the highest preceding 20 kinds of genes (Fig. 6 A) of abundance.More contain antisense-justice connection mode The list of the gene of chimeric sequences is referring to table 6.Cat and Apoa2 has been selected to carry out from the highest preceding 20 kinds of genes of abundance again detailed Subdivision analysis, the chimeric sequences of specific Apoa2 gene are referring to table 2.Cat chimeric sequences intra-Cat cm-Seq's (As-S) is embedding Coincidence point is mainly distributed on 3 ' UTR regions near terminator codon, and is also distributed (Fig. 6 B) in 5 ' UTR regions.And Apoa2 chimeric sequences (intra-Apoa2cm-Seq (As-S)) are then mainly distributed on the 5 ' areas UTR and CDS (Fig. 6 C).

In order to find this antisense-justice connection mode cDNA chimeric sequences generational verctor, from Cat chimeric sequences Intra-Cat cm-Seq (As- (S-1951), S-1978) progress is picked in (intra-Cat cm-Seq (As-S)) at random Detailed analysis (Fig. 6 D), and list the corresponding Cat mRNA sequence of the chimeric sequences (Fig. 6 E).It is corresponding to the chimeric sequences MRNA original series have carried out secondary structure prediction, it is found that the sequence between U1951 and U1978 can form loop-stem structure (figure 6F).The structure of reference prediction and the chimeric sequences of acquisition, have been found that reverse transcription reaction using U1978 as template strand last A nucleotide, and it is finally coupled to U1951, it can just explain intra-Cat cm-Seq (As- (S- almost ideally in this way 1951), S-1978) formation mechenism (Fig. 6 F).

In addition, being that template carries out PCR amplification and right by the product with mouse liver mRNA through endogenous RNA primed reverse transcription Amplified fragments are sequenced, and depositing for chimeric sequences intra-Cat cm-Seq (As- (S-1951), S-1978) is further demonstrated At (Fig. 6 G).

Likewise, analyzing the chimeric sequences intra-Apoa2cm-Seq (As- (S-55), S-110) of Apoa2, and list The mRNA sequence (Fig. 6 H and 6I) of its corresponding Apoa2.In the secondary structure prediction to the mRNA sequence of Apoa2, G55 is found Sequence between U110 can form loop-stem structure (Fig. 6 J).The chimaeric sequence that the structure of reference prediction and the present inventor obtain Column have been found that reverse transcription reaction using U110 as the last one nucleotide of template strand, and is finally coupled to G55, so just The formation mechenism (Fig. 6 J) of intra-Apoa2cm-Seq (As- (S-55), S-110) can be explained almost ideally.In addition, same Sample product with mouse liver mRNA through endogenous RNA primed reverse transcription be that template carries out PCR and is sequenced, further demonstrate embedding Close the presence (Fig. 6 K) of segment intra-Apoa2cm-Seq (As- (S-55), S-110).

According to these as a result, establish said gene in antisense-justice connection mode chimeric sequences (intra-cm-Seq (As-S)) the model such as Fig. 6 L formed.

These results indicate that antisense-justice connection mode chimeric sequences intra-cm-Seq (As-S) is same in this gene Sample can be by endogenous RNA primed reverse transcription, the synthesis of the second chain and PCR formation, and can be used for RNA in analyzing molecules Interaction.In addition, distribution characteristics of the chimeric sequences intra-cm-Seq (As-S) on a certain gene also reflects this kind Distribution situation of the type intramolecular RNA interaction on the gene.

Antisense-justice-antisense connection mode cDNA chimeric sequences analysis and verifying in embodiment 6, gene

In order to study antisense-justice in more peculiar gene-antisense connection mode cDNA chimeric sequences (intra-cm- Seq (As-S-As)) (Fig. 2 C and 2D), the highest preceding 20 kinds of genes (Fig. 7 A) of abundance in the mode sequences are listed, it is more to wrap The list of genes containing antisense-justice-antisense connection mode is referring to table 7.Coding is chosen from the highest preceding 20 kinds of genes of abundance to feed The Albumin (Alb) and coding fatty acid binding protein 1 (NM_017399.4) of newborn animal serum albumin (NM_009654.3) Fabp1 analysed in depth, wherein the corresponding chimeric sequences of Alb are referring to table 3 and table 4.Alb chimeric sequences intra-Alb The distribution of cm-Seq (As-S-As) and Fabp1 chimeric sequences intra-Fabp1cm-Seq (As-S-As) are respectively by respective Intra-cm-Seq (As-S) and intra-cm-Seq (S-As) distribution constitutes (Fig. 7 B and 7C), finds intra-cm-Seq (As- S distribution) is tended to compared with intra-cm-Seq (S-As) is distributed close to 5 ' ends.

Firstly, in order to explain antisense-justice in peculiar three-stage gene-antisense connection mode chimeric sequences intra- The Crack cause of cm-Seq (As-S-As), from intra-Alb cm-Seq (As-S-As) and intra-Fabp1cm-Seq (As- S-As chimeric sequences intra-Alb cm-Seq (As- (S-28), S-57 are had chosen in) respectively；S-381, As- (S-602)) and Chimeric sequences intra-Fabp1cm-Seq (As- (S-46), S-86；S-336, As- (S-417)), and it is embedding to analyze these respectively Close the information and corresponding mRNA original series (Fig. 7 D, 7E, 7I and 7J) of sequence.By to intra-Alb cm-Seq (As- (S-28), S-57；S-381, As- (S-602)) corresponding original series carry out secondary structure prediction, it finds between C28 and U57 And the sequence between C381 and A602 can form loop-stem structure (Fig. 7 F).

The structure and chimeric sequences intra-Alb cm-Seq (As- (S-28), S-57 of reference prediction；S-381, As- (S- 602)), it is found that if carrying out endogenous RNA primed reverse transcription by prime end of A602, and using C381 as the first of template strand A nucleotide can just form intra-Alb cm-Seq (As- (S-28), S-57 in this way；S-381, As- (S-602)) Right half part intra-Alb cm-Seq (S-381, As- (S-602))；Also, if reverse transcription reaction is using U57 as template strand The last one nucleotide, and it is finally coupled to C28, intra-Alb cm-Seq (As- (S-28), S- can be just formed in this way 57；S-381, As- (S-602)) left-half intra-Albcm-Seq (As- (S-28), S-57).Above-mentioned supposition just may be used To explain intra-Albcm-Seq (As- (S-28), S-57 almost ideally；S-381, As- (S-602)) formation mechenism (figure 6F)。

Similarly, to intra-Fabp1cm-Seq (As- (S-46), S-86；S-336, As- (S-417)) corresponding mRNA When former sequence secondary structure analysis, finds between U46 and C86 and the sequence between G336 and A417 can form loop-stem structure (Fig. 7 K).Structure and chimeric sequences intra-Fabp1cm-Seq (As- (S-46), S-86 of reference prediction；S-336, As- (S- 417) it), has been found that and carries out endogenous RNA primed reverse transcription by prime end of A417, and using G336 as the first of template strand A nucleotide can just form intra-Fabp1cm-Seq (As- (S-46), S-86 in this way；S-336, As- (S-417)) Right half part intra-Fabp1cm-Seq (S-336, As- (S-417))；Also, if reverse transcription reaction is using C86 as template strand The last one nucleotide, and be finally coupled to U46, can just form intra-Fabp1cm-Seq (As- (S-46), S- 86；S-336, As- (S-417)) left-half intra-Fabp1cm-Seq (As- (S-46), S-86).Supposition above-mentioned in this way Intra-Fabp1cm-Seq (As- (S-46), S-86 can be just explained almost ideally；S-336, As- (S-417)) shape At mechanism (Fig. 7 K).

Intramolecular RNA representated by antisense-justice-antisense connection mode chimeric sequences in these genes is examined in order to confirm Interact necessary being, to chimeric sequences intra-Alb cm-Seq (As- (S-28), S-57 selected；S-381, As- (S- ) and chimeric sequences intra-Fabp1cm-Seq (As- (S-46), S-86 602)；S-336, As- (S-417)) it has carried out PCR and has tested Card.According to the sequence characteristic of the two three-stage Chimeric fragments, the position for avoiding tie point is set at both ends just for Antisense cDNA Corresponding special primer has been counted to avoid there is non-specific matching.Endogenous RNA primer is carried out using the mouse liver mRNA of extraction The products as templates of reverse transcription and the synthesis of the second chain, has carried out PCR and has detected and (Fig. 7 G and Fig. 7 L) is sequenced.PCR fragment size and Sequencing result is all consistent with the result of high-flux sequence.This result shows that, these bases detected in high-flux sequence Because the interaction of intramolecular RNA-RNA represented by interior antisense-justice-antisense connection mode chimeric sequences is necessary being.

In order to further confirm that the Crack cause of this chimeric sequences intra-cm-Seq (As-S-As), devise following Experiment: it firstly, carrying out endogenous RNA primed reverse transcription, the synthesis of the second chain by the Alb mRNA segment to in-vitro transcription, obtains The cDNA library of the Alb mRNA segment.Secondly, utilizing intra-Alb cm-Seq (As- (S-28), S-57；S-381, As- (S-602)) both ends specific primer carries out PCR amplification and is connected in carrier T that (Fig. 7 H) is sequenced to the cDNA library. Sequencing result is consistent with high-flux sequence result and Fig. 7 G, and has higher positive colony ratio (Fig. 7 H).This explanation three Segmentation chimeric sequences intra-Alb cm-Seq (As- (S-28), S-57；S-381, As- (S-602)) it really can be by endogenous RNA primed reverse transcription, the synthesis of the second chain and PCR are generated.

With reference to the above experimental result, the three-stage chimeric sequences of foundation are embedded from antisense-justice-antisense connection mode gene Close model such as Fig. 7 M that sequence (intra-cm-Seq (As-S-As)) is formed.

Although from the point of view of the RNA secondary structure figure of prediction, endogenous RNA primed reverse transcription a possibility that ratio since A417 Smaller (Fig. 7 K), but PCR and sequencing result (Fig. 7 L) based on mouse mRNA and contain this intra-Fabp1cm-Seq (As- (S-46), S-86；S-336, As- (S-417)) site numerous high-flux sequence sequences effectively support in gene it is anti- The presence of the interaction of intramolecular RNA-RNA representated by justice-justice-antisense connection mode chimeric sequences, more prompts The true secondary structure of Fabp1mRNA and the existing difference of prediction.

These results indicate that chimeric sequences intra-cm-Seq (As-S-As) can be anti-by endogenous RNA primer in gene Transcription, the synthesis of the second chain and PCR formation, and further illustrate intra-cm-Seq (S-As) and intra-cm-Seq (As-S) Crack cause, while can be used for studying the interaction of intramolecular RNA.In addition, chimeric sequences intra-cm-Seq (As-S-As) this type intramolecular RNA interaction is also reflected on the gene in the distribution characteristics on a certain gene Distribution situation.

The analysis and verifying of chimeric sequences between embodiment 7, gene

Further to analyze chimeric sequences (inter-cm-Seq) (Fig. 2 B) between gene, highest first 20 kinds of abundance are listed Gene information (Fig. 8 A), and therefrom selected part chimeric sequences carry out analysis verifying.Firstly, chimeric sequences between analysis gene The information (Fig. 8 B) of Rn28s1-Sepp1cm-Seq (S-4716, As- (S-617)), it is two bases by Rn28s1 and Sepp1 Because segment forms.Then, the product using mouse liver mRNA after endogenous RNA primed reverse transcription and the synthesis of the second chain is as mould Plate carries out PCR and is sequenced, and has further confirmed that the presence (Fig. 8 D) of this intermolecular chimeric sequences.

For the formation for explaining this intermolecular chimeric sequences, between the corresponding mRNA sequence segment of Rn28s1 and Sepp1 Interaction has carried out forecast analysis (on Fig. 8 C).Reference prediction result and Rn28s1-Sepp1cm-Seq (S-4716, As- (S- 617) sequence information) has been found that two kinds of molecules are formed by base pairing and interacts, is to draw with the U4716 of Rn28s1 Object end carries out endogenous RNA primed reverse transcription, and using the C617 of Sepp1 as first nucleotide of template strand, can thus solve Release the formation mechenism of Rn28s1-Sepp1cm-Seq (S-4716, As- (S-617)) (under Fig. 8 C).

At the same time, Rn28s1-Alb cm-Seq (S-4716, As- (S-1722)) and Rn28s1-Plgcm- is also analyzed Seq (S-4716, As- (S-481)) (Fig. 8 E and 8H).Rn28s1-Alb, the corresponding mRNA sequence of Rn28s1-Plg are predicted respectively Interaction model between column-slice section (on Fig. 8 F and 8I).For Rn28s1 and Alb, have been found that two kinds of molecules are matched by base It interacts to being formed, carries out endogenous RNA primed reverse transcription by prime end of the U4716 of Rn28s1, and with Alb's C1722 is first nucleotide of template strand, can thus explain Rn28s1-Alb cm-Seq (S-4716, As- (S- 1722) formation mechenism) (under Fig. 8 F).

Equally, for Rn28s1 and Plg, the inventors discovered that, if using the U4716 of Rn28s1 as in prime end progress Source RNA primed reverse transcription, and using the C481 of Plg as first nucleotide of template strand, it can thus explain Rn28s1- The formation mechenism of Plg cm-Seq (S-4716, As- (S-481)) (under Fig. 8 I).

It is carried out by product of the mouse liver mRNA after endogenous RNA primed reverse transcription and the synthesis of the second chain as template PCR is simultaneously sequenced, and has further confirmed that the presence (Fig. 8 G and 8J) of both intermolecular chimeric sequences.

These results indicate that chimeric sequences (inter-cm-Seq) can pass through endogenous RNA primed reverse transcription, between gene The synthesis of two chains and PCR are obtained, and can be used in the intermolecular RNA-RNA interaction of full-length genome level research.

Embodiment 8, being interacted according to RNA-RNA carries out disease-related research

1, intra-Apoa2cm-Seq (S-508, As- (S-474) and intra-Fabp1cm-Seq (As- (S-46), S- 8) abundance with it is disease associated

4 week old C57BL/6 male mices are purchased from Slac company and use chow diet respectively after chow diet is fed 2 weeks (Chow, D12450B, Research diets) and high lipid food (High-fat diet, HFD, D12451, Researchdiets after) feeding 10 weeks, mouse blood detection blood glucose and triglyceride levels and intra-Apoa2cm- are taken Seq (the abundance of S-508, As- (S-474) and the corresponding secondary structure of intra-Fabp1cm-Seq (As- (S-46), S-8).Blood Sugar is detected using blood glucose meter (FreeStyle), and triglycerides is examined with the triglycerides detection kit of claim You Fu company It surveys.(S-508, As- (S-474) and intra-Fabp1cm-Seq (As- (S-46), S-8) are corresponding by intra-Apoa2cm-Seq The measuring method of secondary structure abundance is as follows: blood total serum IgE is extracted with Trizol LS (Invitrogen), after ERP-RT reaction, With primer 5 '-CTTCTGCCTGTTTTCTCCAATAAATGCG-3 ' (SEQ ID NO:1) and 5 '- GAGATGTGCCAGGCCCAGTCTTCCC-3 ' (SEQ ID NO:2) expands intra-Apoa2cm-Seq (S-508, As- (S- 474), with primer 5 '-CCTGGCTCTGCAATTGGTAC-3 ' (SEQ ID NO:3) and 5 '-CAGGAAGGGAAAGACCTACT- 3 ' (SEQ ID NO:4) expand intra-Fabp1cm-Seq (As- (S-46), S-8), and carry out quantitative PCR detection.

Intra-Apoa2cm-Seq (S-508, As- (S-474) and intra-Fabp1cm-Seq (As- (S-46), S-8) Assay of the abundance in normal and high fat diet animal it is as shown in Figure 9.It can be seen that high fat diet makes intra- Apoa2cm-Seq (the horizontal significant raising of S-508, As- (S-474), so that intra-Fabp1cm-Seq (As- (S-46), S-8) Level significantly reduces, it is seen that intra-Apoa2cm-Seq (S-508, As- (S-474) and intra-Fabp1cm-Seq (As- (S- 46), S-8) there are correlations with hyperglycemia and hyperlipidemia.

2, there are correlations with liver cancer for the abundance of intra-Cat cm-Seq (S-2054, As- (S-2037))

LO2 normal liver cell and HepG2 human liver cancer cell Trizol extracted total RNA use primer after ERP-RT reaction 5 '-GAGAATAGTGTATTCTCGCC-3 ' (SEQ ID NO:5) and 5 '-TGACTACATTTAAAATGATTACAAG-3 ' (SEQ ID NO:6) amplification intra-Catcm-Seq (S-2054, As- (S-2037)), and carry out quantitative PCR detection.

As a result such as Figure 10, intra-Cat cm-Seq's (S-2054, As- (S-2037)) is rich in HepG2 human liver cancer cell The significant raising than LO2 normal liver cell is spent, corresponding secondary structure in HepG2 human liver cancer cell is prompted to dramatically increase.

The justice that table 1, Apoa2 genetic test are arrived-antisense connection mode chimeric sequences (Apoa2 (S-As))

Antisense-justice connection mode chimeric sequences that 2. Apoa2 genetic test of table is arrived

Table 3, Albumin genetic test to antisense-justice-antisense connection mode chimeric sequences in antisense-justice (the SEQ ID in table 3 and table 4 is that correspondingly, a SEQ ID corresponding is the sequencing of high-flux sequence both-end to catenation sequence When two sequences at both ends for obtaining of measurement, the two sequences share the same SEQ ID)

4. Albumin genetic test of table to antisense-justice-antisense connection mode chimeric sequences in justice-antisense (the SEQ ID in table 3 and table 4 is that correspondingly, a SEQ ID corresponding is the sequencing of high-flux sequence both-end to catenation sequence When two sequences at both ends for obtaining of measurement, the two sequences share the same SEQ ID)

Table 5. is detected (only to be listed reading to be greater than containing justice in gene-antisense chimeric sequences gene and corresponding readings 314 gene)

Table 6. is detected (only to be listed reading to be greater than containing antisense in gene-sense chimeric sequence gene and corresponding readings 54 gene)

Table 7 detects and (only lists reading containing antisense-justice-antisense chimeric sequences gene and corresponding readings in gene Gene greater than 30)

It discusses

The inventors discovered that end and the unmatched RNA of template can be used as the primer of reverse transcription reaction.Utilize this hair It is existing, it establishes a kind of new method based on endogenous RNA primed reverse transcription and high-flux sequence and goes to directly research full-length genome RNA- RNA interaction.With this method, the present inventor mainly has found chimeric sequences in the gene of three kinds of different connection modes, And the presence of corresponding intramolecular RNA interaction through experimental confirmation.Furthermore pass through the analysis between chimeric sequences gene And verifying, obtain the information of intermolecular RNA interaction.This method is further to study intramolecular and intermolecular RNA- RNA interaction provides a more direct approach.

Before this, many methods are interacted by chemical modification or digestion come RNA-RNA in analyzing molecules, main using anti- Responsive transcription can stop at chemical modification site or restriction enzyme site, then by detecting these termination sites and calculating analysis removal Random reverse transcription termination site finally determines possible RNA-RNA interaction.Latest report RAP-RNA method is to pass through inspection The site that reverse transcription stops at crosslinking is surveyed systematically to study specific RNA-RNA interaction.But above method is not Intramolecular or intermolecular RNA-RNA interaction directly can be identified from sequencing sequence, it is still necessary to further analysis.In this hair In bright method, primer is done with the endogenous RNA by base pairing and RNA interaction, by reverse transcription or similar reversion Record has obtained a large amount of chimeric sequences (Fig. 2A and 2B).Because the chimeric site in chimeric sequences is the position of similar reverse transcription starting Point or reverse transcription or similar reverse transcription product with template strand is complementary completely or partially and the tie point of RNA connection that matches, And there are base pairings or RNA that is complementary completely or partially with template strand and matching also to deposit with template ribonucleic acid for endogenous RNA primer In base pairing, intramolecular can be directly obtained from sequencing result with the inventive method for institute or intermolecular RNA-RNA is mutual The relationship (Fig. 1 D, Fig. 3 L, Fig. 6 L and Fig. 7 M) of effect.RNA-RNA is studied with chimeric sequences are formed by RNA-RNA connection method The CLASH method of interaction is similar, and method of the invention is also RNA-RNA interaction of being analyzed and researched by chimeric sequences (Fig. 2).However compared with the chimeric sequences for 0.46% or 2% ratio that CLASH method obtains, result of the invention has about 10% to be Chimeric sequences (Fig. 2 B).And CLASH method is that the sequence closed on is connected with each other, and when connection is not rely on base pairing, because This non-specificity can be relatively high；And the chimeric sequences that CLASH is obtained all are justice-sense chimeric connection modes, and the present invention It is entirely different.And compared with HITS-CLIP and CLASH method, method of the invention does not need to implement by immunoprecipitation.When A high proportion of and direct identifiable chimeric sequences so can be obtained in view of method of the invention, if first passed through as HITS- ERP-RT and high-flux sequence are carried out again after immunoprecipitation processing as CLIP with CLASH method, it is believed that will be obtained more straight Connect the information effectively to interact in more detail about RNA-RNA.

It has been reported that template exchange occurs in the reverse transcription of retroviral gene group and has homologous dependence. The template commutativity of this reverse transcriptase results in intramolecular or intermolecular template exchanges and passes through the missing or again of template Group can form chimeric sequences.However, the template exchange of intramolecular would generally generate the connection of intramolecular justice-justice cDNA segment Mode and the chimeric sequences for having base deletion with centre, this intra-cm-Seq (S-As) obtained with the present inventor, Three kinds of chimeric sequences such as intra-cm-Seq (As-S) and intra-cm-Seq (As-S-As) are entirely different (Fig. 2).And It should be noted that there is other of about 38.3% not exactly match sequence (Fig. 2 B) in result of the invention, result in this section In be likely that there are many increasingly complex sequences for being produced from ERP-RT method or template exchange.Some researches show that have quite big There is anti-sense transcripts for the mammalian genome of ratio.Although present invention discover that intra-cm-Seq (S-As) and Intra-cm-Seq (As-S) theoretically can exchange to be formed by the template of justice and anti-sense transcript, but intra-cm- The common relatively low abundance expression of the high abundance expression and anti-sense transcript that Seq possesses, dramatically reduces this possibility Property.Furthermore intra-cm-Seq (S-As) and intra-cm-Seq (As-S) can be simultaneously by being transcribed in vitro and purifying in experiment RNA segment formed through endogenous RNA primed reverse transcription, also further prompt template exchange a possibility that extremely low (Fig. 7 G and 7L). Although the intramolecular of sense strand transcript can also generate the chimeric sequences that justice-justice cDNA is connected with intermolecular montage, this Kind of chimeric sequences and the inventors discovered that main chimeric sequence composition it is not identical.Although sense strand transcript and anti-sense transcript Intermolecular trans-splicing can form justice-antisense-or antisense-justice connection mode chimeric sequences, however in view of antisense The low abundance of transcript and more rare trans-splicing there's almost no this possibility.Therefore, the research of the present inventor In chimeric sequences should be mainly from endogenous RNA primed reverse transcription without being generated from mould between gene in obtained gene Plate exchange or trans-splicing.

Some researches show that the 3 ' UTR regions of Vascular endothelial growth factor A (VEGFA) mRNA just contain one section of 125 base Structural region is formed, can change and dynamic change under IFN γ effect with oxygen environment locating for cell, prompt cell state Change be likely to that RNA structure can be caused to change.It is of the invention the study found that for specific gene, it is somewhat different embedding In the gene of coincidence point there is the phenomenon that partly overlaps in chimeric sequences, and this neighbouring chimeric site prompts the RNA bis- in the region There are dynamic changes for level structure.In addition, studies have found that the 3 ' of a kind of p27 (cyclin-dependent kinase inhibitors) mRNA The variation of RNA secondary structure can occur under the action of Pumilio1 (PUM1) for UTR region, to influence mir-221 and mir- 222 and target sequence combination, interaction and intramolecular interaction are related between RNA molecule.It can be seen that of the invention Representative intramolecular or intermolecular RNA-RNA's chimeric sequences interact for depth respectively in the gene of people's discovery or between gene Entering to understand intracellular a variety of biological functions relevant to RNA structure has great significance.In addition, the inventors discovered that In intermolecular chimeric sequences, the srRNA base of Rn28s1 more times appearance and its sequence information and the discovery of the present inventor's early-stage study This is consistent, this is also believable from the intermolecular RNA interaction that a side shows that the present inventor detects.It is subsequent for This method is widely used, it is believed that may consequently contribute to the more intermolecular RNA interactions of discovery.

It is studied in conclusion the present invention provides one kind based on endogenous RNA primed reverse transcription and high throughput sequencing technologies Full-length genome RNA-RNA interaction new method, this method can accurately, efficiently from a chimeric sequences directly It identifies the relationship of RNA-RNA interaction, and can obtain in a series of gene molecule and intermolecular chimeric sequences.Benefit The chimeric sequences being naturally not present with these can carry out the diagnosis and neurological susceptibility detection of various diseases.In the research in future It may further be used to determine some RNA-RNA interactions relevant to disease or special physiological situation with method of the invention, help In furtheing elucidate effect of the RNA-RNA interaction in pathology and physiology, can also carry out nondiagnostic or diagnostic Application.

All references mentioned in the present invention is incorporated herein by reference, independent just as each document It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims It encloses.

Claims (33)

1. a kind of RNA reverse transcription method characterized by comprising use the unmatched RNA in 3 ' ends as primer, using anti- Transcription system carries out the reaction of reverse transcription；And the starting base of the reverse transcription reaction is the alkali in RNA primer with template strand pairing Base.

2. connecting the method for RNA when a kind of RNA reverse transcription characterized by comprising use RNA as primer, by it and template Chain part complementation is connected with the RNA of pairing, and no matter should with the 5 ' ends of template strand partial complementarity and the RNA of pairing whether and Template strand matching；Wherein, with have in template strand partial complementarity and the RNA of pairing one with template strand pairing base and reverse transcription Product connection.

3. the method as described in claim 1 characterized by comprising the starting base and the pairing of template strand this principle It is used to judge nondiagnosticly that RNA-RNA interacts.

4. method as claimed in claim 3 characterized by comprising judge the further side of RNA-RNA interaction Method is the chimeric sequences obtained using reverse transcription reaction.

5. method according to claim 2 characterized by comprising the pairing of the base and template strand is used for non-diagnostic Property judge RNA-RNA interact.

6. method as claimed in claim 5 characterized by comprising judge the further side of RNA-RNA interaction Method is the chimeric sequences obtained using reverse transcription reaction.

7. method according to claim 1 or 2, RNA primer is that external source addition or sample are endogenous.

8. method according to claim 1 or 2 characterized by comprising the method is synthesized with subsequent second chain cDNA Step is mutually connected.

9. method according to claim 1 or 2 characterized by comprising the method is synthesized with subsequent second chain cDNA After step is mutually connected, step is further also repaired with the end of cDNA product or is directly mutually connected with PCR reaction.

10. method according to claim 1 or 2 characterized by comprising with subsequent second chain cDNA synthesis step phase After linking, step further also is repaired with the end of cDNA product and is mutually connected, and further expand with connector Connection Step, PCR Increase step, DNA base Sequence Detection step is mutually connected.

11. method according to claim 1 or 2, which is characterized in that the template of reverse transcription includes: artificial synthesized RNA sample Product, or extract tissue or cell RNA sample, the RNA includes total serum IgE, mRNA, non-coding RNA.

12. the method that one kind identifies RNA-RNA interaction nondiagnosticly, which is characterized in that the described method includes:

(1) cDNA product is obtained；

(2) Sequence Detection, including but not limited to DNA sequencing are carried out to the cDNA product that step (1) obtains；

(3) analytical sequence testing result determines that RNA-RNA interacts according to the chimeric sequences of acquisition.

13. method as claimed in claim 12, which is characterized in that (3) in, the determination RNA-RNA interaction includes: Intramolecular RNA-RNA interaction and intermolecular RNA-RNA interaction.

14. method as claimed in claim 13, which is characterized in that the intramolecular RNA-RNA interacts according to detection The corresponding chimeric sequences obtained are judged that the mode of these chimeric sequences includes but is not limited to: justice-antisense is fitting to connection Mode, antisense-sense chimeric connection mode, antisense-justice-antisense are fitting to connection mode.

15. method as claimed in claim 13, which is characterized in that the intermolecular RNA-RNA interaction is identical base Because intermolecular or different genes are intermolecular.

16. method as claimed in claim 15, which is characterized in that the intermolecular RNA-RNA interaction is according to inspection Survey what the corresponding chimeric sequences obtained were judged, the mode of these chimeric sequences includes but is not limited to: justice-antisense is embedding Close connection mode, antisense-justice fitting connection mode, antisense-justice-antisense fitting connection mode.

17. method as claimed in claim 12, which is characterized in that (2) in, carry out Sequence Detection to cDNA product, including normal Rule sequencing, high-flux sequence.

18. method as claimed in claim 17, which is characterized in that use high-flux sequence, including both-end or single-ended high throughput Sequencing.

19. method as claimed in claim 18, which is characterized in that the sequencing is both-end high-flux sequence, in cDNA double-strand Both ends add sequence measuring joints, to carry out high-flux sequence.

20. in the natural not existing gene molecule that the method as described in claim 12-17 is any obtains with it is intermolecular embedding Close sequence, which is characterized in that the mode of chimeric sequences includes but is not limited to: justice-antisense fitting connection mode, antisense-is just The fitting connection mode of justice, antisense-justice-antisense fitting connection mode.

21. chimeric sequences as claimed in claim 20, which is characterized in that obtained using the method for claim 1,2 and 12 Include selected from the group below, natural not existing chimeric sequences: SEQ ID NO:49~SEQ ID NO:59；SEQ ID NO: 620~SEQ ID NO:630；NO:1012~1022 SEQ ID；SEQ ID NO:1734~SEQ ID NO:1744.

22. chimeric sequences as claimed in claim 21, which is characterized in that include or part is comprising using claim 1,2 and The raw sequencing data NCBI Sequence Read Archive accession number that 17 method obtains It is rejected in SRX973697 in the natural not existing gene molecule obtained after low quality sequence and joint sequence or intermolecular Chimeric sequences.

23. chimeric sequences as claimed in claim 20, which is characterized in that include or part is comprising using claim 1,2 and The height that 17 method obtains is similar to raw sequencing data NCBI Sequence Read Archive accession In natural not existing gene molecule after rejecting low quality sequence and joint sequence in number SRX973697 or molecule Between chimeric sequences.

24. a kind of reagent that the sequence according to claim 20 is detected.

25. reagent as claimed in claim 24, which is characterized in that include but is not limited to that the sequence according to claim 20 is set Meter or the PCR reaction reagent developed, sequencing reagent, high-flux sequence reagent, hybridization probe reagent.

26. it is a kind of for detecting the reagent or kit of the metabolic diseases such as hyperglycemia, hyperlipidemia or associated risk factors, it is special Sign is that it includes the primers of the specific Apoa2 chimeric sequences of specific amplification；The specific Apoa2 chimeric sequences are Apoa2 Just cDNA the 508th is connected to the chimeric sequences of antisense sequences the 474th composition.

27. reagent as claimed in claim 26 or kit, which is characterized in that the nucleotide sequence of the primer such as SEQ ID Shown in NO:1 and SEQ ID NO:2.

28. it is a kind of for detecting the reagent or kit of the metabolic diseases such as hyperglycemia, hyperlipidemia or associated risk factors, it is special Sign is, it includes the primer of the specific Fabp1 chimeric sequences of specific amplification, the specific Fabp1 chimeric sequences are Fabp1 Antisense cDNA the 46th is connected to the chimeric sequences of Sense sequences the 8th composition.

29. reagent as claimed in claim 28 or kit, which is characterized in that the nucleotide sequence of the primer such as SEQ ID Shown in NO:3 and SEQ ID NO:4.

30. a kind of for detecting the reagent or kit of tumour or associated risk factors, which is characterized in that it includes specificity to expand Increase the primer of specific catalase Catalase chimeric sequences, the specific catalase Catalase chimeric sequences are The enzyme Catalase justice cDNA the 2054th of hydrogen peroxide is connected to the chimaeric sequence that the 2037th corresponding antisense sequences are constituted Column.

31. reagent as claimed in claim 30 or kit, which is characterized in that the nucleotide sequence of the primer such as SEQ ID Shown in NO:5 and SEQ ID NO:6.

32. the purposes of any reagent of claim 26-29, which is characterized in that be used to prepare diagnosis hyperglycemia, hyperlipidemia The kit of equal metabolic diseases or test for metabolic disorders neurological susceptibility.

33. the purposes of reagent described in claim 30 or 31, which is characterized in that be used to prepare diagnosing tumour or detection tumour is easy The kit of perception.