CN106119388B - A kind of PCR primer identifying lily cultivar Huang Tempo is to, kit and method - Google Patents
A kind of PCR primer identifying lily cultivar Huang Tempo is to, kit and method Download PDFInfo
- Publication number
- CN106119388B CN106119388B CN201610701006.0A CN201610701006A CN106119388B CN 106119388 B CN106119388 B CN 106119388B CN 201610701006 A CN201610701006 A CN 201610701006A CN 106119388 B CN106119388 B CN 106119388B
- Authority
- CN
- China
- Prior art keywords
- pcr
- primer
- seq
- tempo
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to genetic engineering fields, and in particular to a kind of PCR primer for identifying lily cultivar Huang Tempo is to, kit and method.The PCR primer pair, a primer therein have the nucleotide sequence of the SEQ ID NO:1 in sequence table, and another primer has the nucleotide sequence of the SEQ ID NO:2 in sequence table；Or in which a primer there is the nucleotide sequence of the SEQ ID NO:3 in sequence table, another primer has the nucleotide sequence of the SEQ ID NO:4 in sequence table.The kit includes the PCR primer pair.This method comprises: pcr amplification reaction and detecting step.The present invention can identify whether the product to be measured is lily cultivar Huang Tempo from molecular level, more accurate compared to identifying from the appearance.
Description
Technical field
The invention belongs to genetic engineering fields, and in particular to a kind of PCR primer for identifying lily cultivar Huang Tempo is to, reagent
Box and method.
Background technique
OT type lily (Lilium spp.) is to be hybridized with oriental hybrid lily (O-shaped) with loudspeaker (T-type) lily for parent
Breeding forms, and the east series lily cultivar that compares is easy to degenerate, the unfavorable factors such as more demanding to cultivation technique, OT type hundred
Closing has obvious advantage, and such as: flower is big, smell faint scent, and the phase is short and easy for cultivation, resistance is strong, is not easy to degenerate.Cause
This, in recent years, the share that OT type lily occupies on the market is increasing, and is gradually liked by the majority of consumers.
Yellow Tempo (Manissa) is one of OT type lily cultivar more popular currently on the market, and flower is very large, pattern
Golden yellow, stalk is tall and straight sturdy, has good market prospects.Timber (Conca d ' or) is also OT type lily cultivar, pattern
Very much like with shape and yellow Tempo, the two kinds are all from Holland.Since yellow Tempo has higher ornamental value and excellent
Breediness, therefore bulb wholesale price is higher by 12.5% than timber, and single flower price 1-2 member higher than timber, is timber
The 120-150% of price.So many lily growers and many florist's shops retail dealer utilize the similar spy of both of which appearance
Point palms off yellow Tempo with timber, cheats vast consumer.Moreover, only both differentiations accuracy is poor from the appearance, it is not enough to
For customs's cultivar identification, technically legal basis etc. is provided to the higher field of identification result precise requirements.
So needing one kind that can effectively, easily distinguish lily cultivar Huang day from molecular level currently on the market
The method of despot and timber and other common OT type lily cultivars, and such method at home and abroad there is no report.
Summary of the invention
The object of the present invention is to provide a kind of PCR primers for identifying lily cultivar Huang Tempo to, kit and method.
The purpose of the present invention is what is be achieved through the following technical solutions:
A kind of PCR primer pair identifying lily cultivar Huang Tempo, a primer therein have the SEQ ID in sequence table
The nucleotide sequence of NO:1, another primer have the nucleotide sequence of the SEQ ID NO:2 in sequence table；Or in which one
Primer has the nucleotide sequence of the SEQ ID NO:3 in sequence table, and another primer has the SEQ ID NO:4 in sequence table
Nucleotide sequence.
A kind of specific band identifying lily cultivar Huang Tempo carries out PCR by the primer pair and reacts to obtain；The specificity
Band, the nucleotide sequence with the SEQ ID NO:5 in sequence table；Or the nucleosides with the SEQ ID NO:6 in sequence table
Acid sequence.
A kind of PCR kit identifying lily cultivar Huang Tempo, comprising: above-mentioned PCR primer pair；
In a preferred embodiment, which further includes dNTP, magnesium chloride, archaeal dna polymerase and PCR buffer；
In a preferred embodiment, the component which includes is final concentration of in PCR reaction system: described to draw
The primer of object centering two each 0.2-0.8mmol/L, the dNTP 5-20 μm ol/L, the magnesium chloride 0.1-2mmol/L, it is described
Described in archaeal dna polymerase 0.2-0.5U/ μ L, Tris-HCL (pH7.5-9.0) 1-5 mmol/L and KCL0.6-5 mmol/L is used as
PCR buffer.
In a preferred embodiment, the component which includes is in PCR reaction system, the volume of PCR premixed liquid
Percentage is 85-95%, each 0.1-1.5 μm of ol/L of two primers in the primer pair.
A method of identifying lily cultivar Huang Tempo, comprising the following steps:
PCR reaction step: utilizing above-mentioned PCR primer pair or above-mentioned PCR kit, using Plant Genome to be measured as template,
PCR reaction is carried out, pcr amplification product is obtained；
Detecting step: the pcr amplification product is detected, as contained specific band in the pcr amplification product,
Then described to measuring plants is the lily cultivar Huang Tempo.
In a preferred embodiment, the response procedures of the pcr amplification reaction are as follows:
Denaturation: 94-95 DEG C 2-5 minutes；Amplification: 94-95 DEG C 10-50 second, 54-60 DEG C 15-50 seconds, 72 DEG C 25-50 seconds, be total to
30-35 circulation of meter；Extend: 72 DEG C 4-10 minutes.
In a preferred embodiment, in this method:
When the PCR primer pair are as follows: a primer therein has the nucleotide base of the SEQ ID NO:1 in sequence table
Sequence, when another primer has the nucleotide base sequence of the SEQ ID NO:2 in sequence table, the specific band has
The nucleotide sequence of SEQ ID NO:5 in sequence table；
When the PCR primer pair are as follows: a primer therein has the nucleotide base of the SEQ ID NO:3 in sequence table
Sequence, when another primer has the nucleotide base sequence of the SEQ ID NO:4 in sequence table, the specific band has
The nucleotide sequence of SEQ ID NO:6 in sequence table.
The invention has the benefit that
1, the present invention utilizes specific PCR primer pair, and the genome for treating measuring plants carries out PCR reaction, and detection amplification produces
Whether contain specific band in object；So can identify whether the product to be measured is lily cultivar Huang day from molecular level
Despot, it is more accurate compared to identifying from the appearance.
2, PCR reaction is carried out present invention only requires the genome for treating measuring plants and detected, so easy, efficient.
3, the present invention has wide range of applications, especially suitable for the higher field of identification result accuracy requirement, such as: (1)
Can be used for that customs is assisted to carry out cultivar identification；(2) can be used for providing foundation and method for national lily cultivar Markers for Detection；
(3) can be used for providing detection foundation for production dispute.
Detailed description of the invention
Fig. 1 is PCR reaction product electrophorogram of the two kinds of lilies of embodiment 1 in different primers.
Fig. 2 is the PCR reaction product electrophorogram of the lower 3 RAPD primers of different annealing temperature of embodiment 1.
Fig. 3 is the PCR reaction product electrophorogram of the bacterium colony PCR of embodiment 1.
Fig. 4 be embodiment 1 sequencing after 6 pairs of primers PCR reaction product electrophorogram.
Fig. 5 is 6 kinds of common lily cultivar PCR reaction product electrophorograms of embodiment 2.
Fig. 6 is two kinds of common lily cultivar PCR reaction product electrophorograms of embodiment 3.
Specific embodiment
In a first aspect, the present invention provides a kind of PCR primer pair for identifying lily cultivar Huang Tempo.Primer tool therein
The nucleotide sequence of SEQ ID NO:1 in ordered list, another primer have the nucleosides of the SEQ ID NO:2 in sequence table
Acid sequence；Or in which a primer there is the nucleotide sequence of the SEQ ID NO:3 in sequence table, another primer has sequence
The nucleotide sequence of SEQ ID NO:4 in list.
Second aspect, the present invention provide a kind of specific band for identifying lily cultivar Huang Tempo.The specific band by
Above-mentioned primer pair SEQ ID NO:1 and SEQ ID NO:2 carries out pcr amplification reaction and obtains, with the SEQ ID in sequence table
The nucleotide sequence of NO:5；Or pcr amplification reaction is carried out by above-mentioned primer pair SEQ ID NO:3 and SEQ ID NO:4 and is obtained, have
The nucleotide sequence of SEQ ID NO:6 in ordered list.
The third aspect, the present invention provide a kind of PCR kit for identifying lily cultivar Huang Tempo.Included by the kit
Component is final concentration of in PCR reaction system: above-mentioned PCR primer is to (SEQ ID NO:1 and SEQ ID NO:2 or SEQ ID
NO:3 and SEQ ID NO:4) in two each 0.2-0.8mM of primer, further include dNTP 5-20 μm ol/L, magnesium chloride 0.1-
2mmol/L, archaeal dna polymerase 0.2-0.5U/ μ L；The kit also contains PCR buffer, and (the PCR buffer contains in reactant
The Tris-HCL (pH7.5-9.0) of the final concentration of 1-5 mM and KCL of final concentration of 0.6-5mM in the reaction system in system)；It should
PCR buffer is diluted by former PCR premixed liquid, and the concentration of original PCR premixed liquid is generally in the 1.1-10 for the PCR buffer
Times.
It further include the template DNA of final concentration of 1-3.75ng/ μ L in above-mentioned PCR reaction system.
Preferably, component included by above-mentioned dose of box is final concentration of in PCR reaction system: above-mentioned PCR primer pair
Two each 0.6mM of primer in (SEQ ID NO:1 and SEQ ID NO:2 or SEQ ID NO:3 and SEQ IDNO:4) further include
10 μm of ol/L of dNTP, magnesium chloride 0.5mmol/L, archaeal dna polymerase 0.25U/ μ L, PCR buffer (contain 2 mM Tris-HCL
(pH8.0) and 1.5mM KCL)；It preferably, further include the template of final concentration of 1.5ng/ μ L in above-mentioned PCR reaction system
DNA。
Illustratively, the final concentration of each component in above-mentioned reaction system can be with are as follows: template DNA 1ng/ μ L, 1.5 ng/
μ L, 2 ng/ μ L, 2.5 ng/ μ L, 3 ng/ μ L, 3.5 ng/ μ L, the model in 3.75 ng/ μ L between any number and any number
Enclose, each 0.2 mM of two primers in primer pair, 0.4 mM, 0.5 mM, 0.6 mM, in 0.8 mM any number and any number it
Between range, magnesium chloride 0.1mmol/L, 0.5 mmol/L, 1 mmol/L, any number and appoint in 1.5 mmol/L, 2mmol/L
The range anticipated between numerical value, 5 μm of ol/L of dNTP, 10 μm of ol/L, 15 μm of ol/L, any number and any number in 20 μm of ol/L
Between range, archaeal dna polymerase 0.2U/ μ L, 0.25U/ μ L, 0.3U/ μ L, 0.4U/ μ L, any number and any in 0.5U/ μ L
Range between numerical value, in Tris-HCL (pH7.5-9.0) 1mM, 2mM, 3mM, 4mM, 5mM between any number and any number
Range, the range in KCL0.6mM, 1mM, 2mM, 3mM, 4mM, 5mM between any number and any number.
It is highly preferred that component included by above-mentioned dose of box is final concentration of in PCR reaction system:
The 2XEasyTaq PCR SuperMix (+dye) that percent by volume is 40-60% (is preferably purchased from Beijing Quan Shijin
Bioisystech Co., Ltd), each 0.2-0.8mM of forward and reverse primer；It further include final concentration of 1- in above-mentioned PCR reaction system
The template DNA of 3.75ng/ μ L.
It is further preferred that component included by above-mentioned dose of box is final concentration of in PCR reaction system:
The 2X EasyTaq PCR SuperMix (+dye), each 0.625mM of forward and reverse primer that percent by volume is 50%；
It preferably, further include the template DNA of final concentration of 1.25ng/ μ l in above-mentioned PCR reaction system；
Such as: the reaction system of 20 μ L includes: the positive and negative of 2X EasyTaq PCR SuperMix (+dye) 10 μ L, 5mM
To primer each 2.5 μ L, 10ng/ μ l template DNA 2.5 μ L, ddH2O is enough.
Illustratively, the final concentration of each component in above-mentioned reaction system can be with are as follows: template DNA 1ng/ μ L, 1.5
Ng/ μ L, 2 ng/ μ L, 2.5 ng/ μ L, 3 ng/ μ L, 3.5 ng/ μ L, in 3.75 ng/ μ L between any number and any number
Range, each 0.2 mM of two primers in primer pair, 0.4 mM, 0.5 mM, 0.6 mM, any number and arbitrary number in 0.8 mM
Range between value, the percent by volume of 2X EasyTaq PCR SuperMix (+dye) is 40%, 45%, 50%, 55%,
Range in 60% between any number and any number.
Component included by PCR kit of the invention, final concentration in PCR reaction system can be with are as follows: volume hundred
Point than the PCR premixed liquid for 85-95% (the PCR premixed liquid of the new industry TSE101- gold medal Mix (1.1X) of section is specially held up, is purchased from northern
Jing Qingkexin industry Bioisystech Co., Ltd), each 0.1-1.5 μM of forward and reverse primer；It further include 5- in the PCR reaction system
The template DNA of 20ng/ μ L；
Preferably, component included by the agent box is final concentration of in PCR reaction system: percent by volume is 91%
PCR premixed liquid (specially holds up the PCR premixed liquid of the new industry TSE101- gold medal Mix (1.1X) of section), and each 0.9 μM of forward and reverse primer；
It further include the template DNA of 13.6ng/ μ L in the PCR reaction system；
Such as: the reaction system of 11 μ L includes: that the PCR premixed liquid that percent by volume is 91% (specially holds up the new industry of section
The PCR premixed liquid of TSE101- gold medal Mix (1.1X)) 10 μ L, 20 μM 0.5 μ L of forward and reverse primer mixed liquor (including just,
Each 20 μM of reverse primer)；It further include the 0.5 μ L of template DNA of 300ng/ μ L in the PCR reaction system.
Illustratively, the final concentration of each component in above-mentioned reaction system can be with are as follows: template DNA 5ng/ μ L, 10ng/ μ
L, the range in 15ng/ μ L, 20ng/ μ L between any number and any number, two primers are 0.1 μM each in primer pair, 0.5 μ
M, 0.8 μM, 1 μm of M, 0.2 μM, the range in 1.5 μM between any number and any number, PCR premixed liquid (it is new specially to hold up section
The PCR premixed liquid of industry TSE101- gold medal Mix (1.1X)) percent by volume be 85%, 88%, 90%, 92%, 95% in appoint
The range anticipated between numerical value and any number.
Fourth aspect, the present invention provide a kind of method for identifying lily cultivar Huang Tempo, method includes the following steps:
Step 1: pcr amplification reaction: above-mentioned PCR primer pair or above-mentioned PCR kit are utilized, with Plant Genome to be measured
For template, pcr amplification reaction is carried out, pcr amplification product is obtained；
The response procedures of the pcr amplification reaction are as follows:
Denaturation: 94-95 DEG C 2-5 minute (illustratively, can be 2min, 3min, 4 min, in 5 min any number and
Range between any number)；Amplification: 94-95 DEG C 10-50 second (illustratively, can be 10s, 20s, 30s, 35s, 40s,
Range in 45s, 50s between any number and any number), 54-60 DEG C (illustratively, can for 54 DEG C, 55 DEG C, 56 DEG C,
Range in 57 DEG C, 58 DEG C between any number and any number) 15-50 seconds (illustratively, can for 15s, 30s, 35s,
Range in 40s, 45s, 50s between any number and any number), 72 DEG C 25-50 seconds (illustratively, can for 25s,
30s, 35s, 40s, 45s, 50s) in range between any number and any number, amounting to 30-35, (exemplary, can be with
For the range between 30,31,32,33,34,35 middle any numbers and any number) circulation；Extend: 72 DEG C
4-10 minutes；
Preferably, the response procedures of the pcr amplification reaction are as follows:
Denaturation: 95 DEG C 3 minutes；Amplification: 95 DEG C 30 seconds, 58 DEG C 30 seconds, 72 DEG C 40 seconds, amount to 30 circulation；Extend: 72 DEG C
7 minutes.
Or:
Denaturation: 98 DEG C 2 minutes；Amplification: 98 DEG C 10 seconds, 58 DEG C 15 seconds, 72 DEG C 25 seconds, amount to 30 circulation；Extend: 72 DEG C
4 minutes.
Step 2: detection: pcr amplification product being detected, if utilizing primer pair SEQ ID NO:1 and SEQ ID
NO:2 expands to have obtained specific band SEQ ID NO:5, and/or is expanded using primer pair SEQ ID NO:3 and SEQ ID NO:4
Increasing has obtained specific band SEQ ID NO:6；, then it is lily cultivar Huang Tempo to measuring plants.
Detailed description of the preferred embodiments by the following examples.
Embodiment 1
The present embodiment is the acquisition methods for identifying the PCR primer pair of lily cultivar Huang Tempo.The present embodiment has selected 77 altogether
A molecular labeling to distinguish on a molecular scale to lily cultivar Huang Tempo and timber, select 3 amplifications and produce by finishing screen
Object difference is obvious, the good RAPD label of repeatability.Using these three labels, in 37-47 DEG C of section, in three kinds of different brands
PCR instrument on timber and yellow Tempo can be clearly distinguished；By two specific amplifieds of pair of primers therein (BD3)
Product sequencing, 6 pairs of primers is devised according to sequencing result, wherein there is 2 pairs of primers can be clearly by yellow Tempo and other 5 altogether
Common OT type lily commodity kind distinguishes.Details are as follows:
One, material and method:
1, material:
OT type lily Huang Tempo (Manissa), timber (Conca d ' or), shady deal (Black out), bursting point
(Flashpoint), it is pleasantly surprised (Shocking), Luo Binna (robina) bulb is purchased from Beijing Pu Langte gardening Co., Ltd；This
6 commodity kinds are imported from Holland.
2, method:
2.1, lily extracting genome DNA:
Win the blade of above-mentioned 6 kinds, -40 DEG C freezing 1 day or more, be subsequently placed in vacuum drying instrument (CoolSafe
Dehydration in 55-4)；
20 μ g dry powder-shaped blades are taken again, extract DNA according to CTAB method, specific step is as follows；
CTAB extracting solution (2%CTAB, 1.4mM NaCl, 100mM Tris-HCl is added into the dry powder-shaped blade by I
PH8.0,20mM EDTA pH8.0,1%PVP-40,0.2% beta -mercaptoethanol), mix, in 65 DEG C water-bath 0.5 hour, obtain
Mixture A；
Mixture A is stopped water-bath by II, and isometric chloroform/isoamyl alcohol (24:1) extracting is added twice, obtains supernatant
A；
2/3 volume isopropanol is added into supernatant A and is used to precipitate DNA by III；It is washed again with washing buffer (75% ethyl alcohol)
Once, dry up, then plus TE buffer (10mM Tris-HCl, 1mM EDTA, pH7.4) dissolution, obtain solution A；
RNase A is added into solution A by IV, makes its final concentration up to 100 μ g/mL, then mixes 37 DEG C of water-baths 1 hour；It uses again
Isometric chloroform/isoamyl alcohol (24:1) extracting is primary, obtains supernatant B；
1/10 volume 3M sodium acetate pH7.5,2 times of volume dehydrated alcohols is added to taking in V in supernatant B, it is heavy to obtain DNA
It forms sediment；
VI is precipitated with 75% ethanol washing DNA, is air-dried, is added appropriate ddH2O dissolving DNA obtains material genomic DNA；
With micro-spectrophotometer with OD260It is worth (NanoDrop2000) and measures concentration, DNA working solution concentration is adjusted to
10ng/μL。
2.2, primer screening:
It has chosen 77 primers of total and carries out PCR amplification (table one), wherein primer 1-60 is Beijing SBS Genetech gene technology
Co., Ltd's RAPD primer, primer 61-77 select from respectively delivered document (Zhao Xiangyun, 1995, Yamagishi, 1995,
ANUSHRI, 2001, Zuo Zhirui, 2005), by Beijing, SBS Genetech gene technology Co., Ltd is synthesized.
PCR reaction system is 20 μ L, includes: 10 μ L 2X EasyTaq PCR SuperMix (+dye) (Quan Shijin),
2.5 μ L 5mM primers, 2.5 μ L template DNAs.Amplification program: 95 DEG C be denaturalized 3 minutes, amplified reaction be 95 DEG C 30 seconds, 41 DEG C 40
Second, 72 DEG C 50 seconds, amount to 35 circulation, 72 DEG C extend 7 minutes.
Table one: primer information
Above-mentioned document are as follows:
Zhao Xiangyun, 1995: Zhao Xiangyun, Chen Xinlu, Fang Hai, Zhang Yunfang.1995.It is marked with R A PD between evaluating lily cultivar
Genetic affinity.Beijing Agricultural College's journal, 10 (2): 58-63；
Zuo Zhirui, 2005: Zuo Zhirui, Mu Ding, Gao Junping, Liu Chun.2005.Lily genetic diversity and affiliation
RAPD analysis.Gardening journal, 32 (3): 468-472；
ANUSHRI VARSHNEY(2001)Establishment of genetic findelity of in vitro-
raised Lilium bulblets thorough RAPD markers.In Vitro Cell.Dev.Biol.-Plant
37:227-231；
Yamagishi (1995TAG): Detection of section-specific random amplified
polymorphic DNA(RAPD)marker in Lilium.Theor Appl.Genet.91:830-835；
2.3, primer amplification stability test:
2.3.1, influence of the different annealing temperature to amplified production
Selection carries out amplification stability test by the primer screened in the above method 2.2.Use thermoelectricity Veriti
6 gradients are arranged by 37 DEG C to 47 DEG C in grads PCR instrument, annealing temperature altogether, and the temperature difference between adjacent two gradients is 2 DEG C and is expanded
Increase.For PCR reaction system with described in the above method 2.2, other PCR reaction conditions are also identical as the above method 2.2.
2.3.2, influence of the different brands PCR instrument to amplified production
Using gene 9700, Bole C1000, tri- manufacturers of thermoelectricity Veriti PCR instrument, annealing temperature be 41 DEG C, primer
To draw 43, drawing 49, drawing 52, PCR reaction system with described in the above method 2.2, other PCR reaction conditions also with the above method
2.2 identical.
2.4, the recycling of RAPD specific amplified product, clone and sequencing
PCR reaction system is 20 μ L, includes: 10 μ L 2X EasyTaq PCR SuperMix (+dye) (Quan Shijin),
2.5 μ L 5mM primers, 2.5 μ L template DNAs.Amplification program: 95 DEG C be denaturalized 3 minutes, amplified reaction be 95 DEG C 30 seconds, 41 DEG C 40
Second, 72 DEG C 50 seconds, amount to 35 circulation, 72 DEG C extend 7 minutes.1.4% agarose gel electrophoresis.By length be about 1400bp and
Two specific bands of 900bp cut recycling.
It is operated according to Quan Shi King Company " pEASY-T1 Cloning Kit " kit specification, screening obtains the positive
Clone.Selection positive colony entrusts AudioCodes prosperous Biotechnology Co., Ltd in Beijing to be sequenced respectively.According to sequencing result benefit
With 3 sections of software designs, 6 pairs of primers (table two), Sheng Gong bio-engineering corporation is transferred to be synthesized.
Table two: specific primer sequences information
The application detection of 2.5 special primers
PCR reaction system is 20 μ L, includes 10 μ L 2X EasyTaq PCR SuperMix (+dye) (Quan Shijin), 2.5 μ
L 5mM special primer (table two), 2.5 μ L template DNAs.Amplification program: 95 DEG C be denaturalized 5 minutes, amplified reaction be 95 DEG C 30 seconds, 58
DEG C 40 seconds, 72 DEG C 50 seconds, amount to 35 circulations, 72 DEG C extend 10 minutes.
Two, result:
2.1, primer screening
(digital representation primer serial number, letter indicate kind, a: yellow Tempo as shown in Figure 1；B: timber), by 1 repetition
Afterwards, AFLP system of two kinds of lilies in 16 primers has larger difference, they are: draw 27, draw 43, drawing 46, drawing 49, drawing 52,
Draw 55, draw 61, drawing 63,64, draw 66, draw 68, draw 70-74, draw 77.
It is found after repeating three times, draws 27, to draw 61 amplified bands weak, unstable, eliminated, draw 46, draw 55, draw 63, draw
64, draw 70, draw 71, drawing 73 amplified bands and change greatly, being difficult to distinguish two parts of materials sometimes, therefore this 7 primers are also washed in a pan
It eliminates.
Two kinds of lilies are drawing 43, are drawing 49, drawing 52, drawing 68, drawing 74, drawing that comparison in difference in 77 is significant, stablizes.Due to wood
Door is drawing 68, is drawing 74, drawing amplified band number in 77 more, therefore chooses and draws 43, draws 49, drawing 52 and carry out amplification stability examination
It tests.
2.2, primer amplification stability test
Using thermoelectricity Veriti grads PCR instrument, as annealing temperature is stepped up by 37 DEG C to 47 DEG C, draw 43 in kind
The band number of amplified production also gradually increases in yellow Tempo and timber, wherein in 6 temperature stablize amplification be 1 about
For 1400bp band (as shown in Fig. 2, singular swimming lane be " yellow Tempo " amplified production, even number swimming lane is " timber " amplified production,
Rightmost side swimming lane is DNA marker；Primer BD3 is to draw 52) to draw 49, BD12 to draw 43, BD9.
2.3, the recycling of RAPD specific amplified product, clone and sequencing
(1) as shown in Fig. 2, when annealing temperature is between 37-47 DEG C, primer BD3 (drawing 43) share 4 it is more stable
Amplified production, their size are about 1400bp, 900bp, 750bp and 500bp respectively.Above-mentioned size is only selected to respectively may be about
The reason of 1400bp, 900bp band send to sequencing are as follows: the sequencing result of each about each 100bp in band both ends be it is insecure, because
The reliable data of this 750bp and 500bp only have 550bp and 300bp respectively.It is at least a pair of suitable to select in this section
Primer, 300bp possibility is too low, and although it is possible to but perhaps final amplified production only has 100-400bp to 550bp.If only
100bp, amplified production are not easy to distinguish with primer dimer.And it can be found out from the brightness of DNAmarker, same concentrations
Under, segment is smaller, and brightness is smaller, this point in Fig. 4 clearly.
(2) by two band recycling that length is 1400bp and 900bp, clone, conversion, and random 10 bacterium colonies of picking into
The detection of row positive colony.As shown in figure 3, wherein D1-D5 insertion be 1400bp large fragment, X1-X5 insertion be 900bp
Small fragment.
Wherein, code name be respectively as follows: D1, D4, X1, X3 tetra- sequencing bacterium colony sequencing result be respectively 1401bp,
1401bp,1463bp,954bp.Since X1 sequencing result differs larger with expection, so being omitted when design primer.D1,D4
Although meeting expection, and length is 1401bp, there are 156 bases to have differences, ratio 11.13%, this illustrates to survey
The poor accuracy of sequence result.Thus respectively using the sequencing result of D1, X3, D4 as foundation, every sequencing result has separately designed 2
It is right, 6 pairs of primers (table two) in total.Discovery simultaneously is the primer sequence according to design simultaneously to be present in X1 with D1.
Wherein, above-mentioned D1 bacterium colony sequencing result is following (SEQ ID NO:7): total 1401bp；Wherein primer SEQ ID NO:
1,2 marked with box, primer and its between sequence size be 1020bp (as SEQ ID NO:5), primer SEQ ID
NO:3,4 are marked with underscore, primer and its between sequence size be 1209bp (as SEQ ID NO:6)；It is oblique with overstriking
Body word mark indicates base different in same position between bacterium colony D1 and D4:
Above-mentioned X1 sequencing result is following (SEQ ID NO:8): total 1463bp；Wherein primer SEQ ID NO:1,2 are with side
Collimation mark note, primer and its between sequence size be 1020bp (as SEQ ID NO:5), primer SEQ ID NO:3,4 are used
Underscore label, primer and its between sequence size be 1209bp (as SEQ ID NO:6):
TCGAATTCGCGTGTCGCCCTTGAGCCTGCGATATGGCTATG
AGGAGTTTACGGCTTGTGCATTCTCCGTCCTTGAGTGGTATGATCAGACTCTGACCACTCACAAGCAGTCTTTGTG
CAGTTCTTGTGTGGAAGAGTGGAAGGATGACCTGGATAAGGAGATTACATAGCTTCAGAAGAATCATACATGAGAG
TTGGTGACACTTCCAAGAGGCAAGCGGTCGATCGGGTGCAAATGGGTATTCTCGGTGAAGGACGGTGCTTCGGTTT
CCAAAGGTACTAGCGCTGGTATACACTATAAGGCAATATTGGTGGCAAAAGGGTATGCACAAAGGGAGGGTAAAGA
CTACAATGAGGAATTTTCTCCTGCGGTCAAGCACACCTCTATCCGGGTCCTTTTGGCACTAGTTGTGCATTTTGAC
ATGAAGCTCGAGCAAATGAATGTCAAGACCGCATTCTTGCATAGAGACTTGAAGGAGGATATTTACATGTCACAGC
CCGAAGGTTATGCTGTTGCTGGGAAGGAAGATCAGGTGTGCACGCCTCAGAAATCACTGTACGGGTTGAAGCAGGC
TTCAAGGCAGTGGTACAAGAGGTTTGACAATTTCATGATCGAACATGGGTATGCGAGGAGCTCTTTTGATCCCTGT
ATGTACAGTAGGCTGCTCGATGATGGATCCCTTGTGTGTCTCTTGCTCTATGTTGATGACATGCTGATTGCTGTGA
GGAGCATGGTGGAGATTGATAAGTTGAAGTCGATGTTCAGCAGGGAGTTTGAGATGAAGGATCTAGGTTCCGTGAG
GAAGATACTCGGGATGGAGATTGTCAGAGATAGAGGTGAGGGCAGACTGTCTTTGTCACAGCGGGGGTACTTAGAG
AAGTTGCTTTGTCGGTTTGAAATGGATGCAGCTAAGCCGGTGTCTACTCCCCTAGCTGCACACTTCAAACTCTCGG
TGATAGCATCTCCTAGCACTGACGAGGACAGGGAGTACATGGCTAGTGTTCCCTTTGATATATGCCATGGTTTGTACTCGGCCGGATATCGCACATACGGTT
AGTCTCGTGTATCGGTATATGGCGAATCCGGGAAGGCAGTAATGGCAGGCAGTCAAGTGGATATTGAGATATCTTT
GGGGGATGCTAAATAGGAGCATTATCTATTAGAGAGGAGCTGGTTCTGATATGGTACAGGGATACATTAACTCTGA
TTATGCTGGAGATCTTGATAGGTGCCGATCTACTACAAGTTTCTGTTTTACCTTGACACATGGTCCGGTGAGCTGA
AAGTCTCAGTTACAGTCTATTGTTGCTCTATCCACGACGGAGGCGGAGTACATGGCTCTGACGGAGGCGATAAAGG
AAACCATCTGGCTTCGGGGCTCAAGGGCGACACGCGAATTCGATATCAAGCTCAGACGAGGCAA。
(3) above-mentioned 6 pairs of primers are subjected to PCR amplification by template of yellow Tempo complete genome DNA respectively.As shown in figure 4, drawing
The amplification of object M1, M2 meet expection；Primer S1, B1, B2 do not have an amplified production, primer S2 amplified production and its faint.By
The two lily cultivars can be clearly distinguished in primer M1 and M2, thus selected primer M1 and M2 as specific primer to
In differentiation lily cultivar Huang Tempo.
Embodiment 2:
The present embodiment is by above-mentioned two group-specific primers to (M1:SEQ ID NO:1 and SEQ ID NO:2, M2:SEQ
ID NO:3 and SEQ ID NO:4) it is applied to distinguish lily cultivar Huang Tempo and other 5 common OT type lily cultivars, inspection
It surveys in its genome and whether contains specific band.
Detection method includes the following steps:
(1) Plant Genome to be measured is extracted: identical as in embodiment 1 2.1 method；6 kinds are obtained to measuring plants (Huang Tian
Despot, shady deal, bursting point, is pleasantly surprised, Luo Binna at timber) genome.
(2) PCR reacts: respectively using M1 and M2 as primer, using above-mentioned 6 kinds of genomes to measuring plants as template, carrying out PCR
Reaction, obtains pcr amplification product.
The PCR reaction system is 20 μ L, includes: 2X EasyTaq PCR SuperMix (+dye) is (purchased from the full formula in Beijing
Golden Bioisystech Co., Ltd) 10 μ L, 5mM forward and reverse primer each 2.5 μ L, 10ng/ μ l template DNA 2.5 μ L, ddH2O foot
Amount.
PCR response procedures are as follows:
Denaturation: 94-95 DEG C 3-5 minutes；Amplification: 94-95 DEG C 30-50 second, 54-60 DEG C 30-50 seconds, 72 DEG C 30-50 seconds, be total to
30-35 circulation of meter；Extend: 72 DEG C 4-10 minutes.
In " 2.2, primer amplification stability test " of embodiment 1, selected 41 DEG C are because initially use is random few core
Nucleotide sequence, annealing region are 37-47 DEG C；The whole banding pattern comprehensive consideration obtained at 41 DEG C is best, and characteristic bands exist
It is all stabilized between 37-47 DEG C；Design, synthesis, using 2 pairs of special primers after, annealing temperature increases, and section is 54-
It is 60 DEG C, general to use 58 DEG C；In view of the difference of each laboratory monitoring, so the primer of selection is all that stability is good；If
2 pairs of primers of meter are due to specific high, so requiring PCR reaction more relaxed, can obtain under conditions of very wide in range
Stable result.
PCR response procedures as a preferred technical solution, are as follows: denaturation: 95 DEG C 3 minutes；Amplification: 95 DEG C 30 seconds, 58 DEG C 30
Second, 72 DEG C 40 seconds, amount to 30 circulation；Extend: 72 DEG C 7 minutes.
(3) electrophoresis detection: by 1.2% Ago-Gel of the amplified production, being separated by electrophoresis 0.5h in 90V invariable power,
It takes a picture and observes under ultraviolet lamp later；
As shown in Figure 5: A1-A6 primer is M1, and B1-B6 primer is M2.A1, B1 template DNA are yellow Tempo；A2, B2 template
DNA is timber；A3, B3 template DNA are bursting point；A4, B4 template DNA are to be pleasantly surprised；A5, B5 template DNA are Luo Binna；A6,B6
Template DNA is shady deal), when using M1 as primer, yellow Tempo has 1 target stripe, and range estimation size ratio 1Kbp is bigger, is actually
1020bp(SEQ ID NO:5)；Timber, bursting point, be pleasantly surprised no any amplified production；Luo Binna indistinctly has 1 near 800bp
Weak band, shady deal have 2 bands, and one is less than 1Kbp, and in addition one significantly more than 1200bp.When using M2 as primer, yellow Tempo tool
There is 1 target stripe, range estimation size is about 1200bp, and practical is 1209bp (SEQ ID NO:6)；Timber, bursting point, be pleasantly surprised and
Luo Binna does not have any amplified production；Shady deal has 2 bands, treaty a 1100bp, a treaty 1700bp.
It can be seen that utilizing primer M1 or M2 due to having the amplified band of specificity in the amplified production of yellow Tempo
Significantly, accurately yellow Tempo and the lily of other 5 kinds common OT types can be distinguished.
Embodiment 3:
The present embodiment is by above-mentioned two group-specific primers to (M1:SEQ ID NO:1 and SEQ ID NO:2, M2:SEQ
ID NO:3 and SEQ ID NO:4) it is applied to distinguish lily cultivar Huang Tempo and timber, it whether detects in its genome containing spy
Anisotropic band.
Detection method includes the following steps:
(1) Plant Genome to be measured is extracted: identical as in embodiment 1 2.1 method；2 kinds are obtained to measuring plants (Huang Tian
Despot, timber) genome.
(2) PCR reacts: respectively using M1 and M2 as primer, using above-mentioned 2 kinds of genomes to measuring plants as template, carrying out PCR
Reaction, obtains pcr amplification product.
The total volume of the PCR reaction system is 11 μ L, wherein including " holding up the new industry TSE101- gold medal Mix (1.1X) of section " PCR
10 μ L of premixed liquid (is purchased from Beijing Qing Kexin industry Bioisystech Co., Ltd), and primer mixed liquor (contains each 20 μM of forward and reverse primer)
0.5 μ L, 300ng/ μ L DNA0.5 μ L；
The program of pcr amplification reaction are as follows: denaturation: 98 DEG C 2 minutes；Amplification: 98 DEG C 10 seconds, 58 DEG C 15 seconds, 72 DEG C 25 seconds, altogether
Count 30 circulations；Extend: 72 DEG C 4 minutes.
Pcr amplification reaction in the present embodiment shortens the time of PCR reaction significantly.
(3) electrophoresis detection: by 1.2% Ago-Gel of the amplified production, being separated by electrophoresis 0.5h in 90V invariable power,
It takes a picture and observes under ultraviolet lamp later；See Fig. 6: wherein the template DNA of M1 is timber, does not contain specific band；The template of H4, H5
DNA is yellow Tempo, and when using M1 as primer, with the specific band that 1 range estimation is more bigger than 1Kbp, practical is 1020bp (SEQ
ID NO:5), when using M2 as primer, the specific band for being about 1200bp with 1 range estimation, practical is 1209bp (SEQ ID
NO:6)。
It can be seen that utilizing primer M1 or M2 due to having the amplified band of specificity in the amplified production of yellow Tempo
Significantly, accurately yellow Tempo and the similar timber lily of appearance can be distinguished.
Obviously, above embodiment of the invention is only intended to clearly illustrate examples of the invention, and is not
Restriction to embodiments of the present invention.For those of ordinary skill in the art, on the basis of the above description also
Other various forms of variations or variation can be made.Here all embodiments can not be exhaustive.It is all to belong to this
The obvious changes or variations that the technical solution of invention is extended out are still in the scope of protection of the present invention.
Claims (10)
1. a kind of PCR primer pair for identifying lily cultivar Huang Tempo, in the nucleotide sequence of a primer therein such as sequence table
SEQ ID NO:1 shown in, the nucleotide sequence of another primer is as shown in the SEQ ID NO:2 in sequence table；Or
The nucleotide sequence of a primer therein is as shown in the SEQ ID NO:3 in sequence table, the nucleotide of another primer
Sequence is as having shown in the SEQ ID NO:4 in sequence table.
2. a kind of specific band for identifying lily cultivar Huang Tempo, the primer pair as described in claim 1 carries out PCR and reacts
It arrives, using the genome of lily cultivar Huang Tempo as template.
3. identifying the specific band of lily cultivar Huang Tempo as claimed in claim 2, in nucleotide sequence such as sequence table
Shown in SEQ ID NO:5；Or
Its nucleotide sequence is as shown in the SEQ ID NO:6 in sequence table.
4. a kind of PCR kit for identifying lily cultivar Huang Tempo, it is characterised in that: include: that PCR as described in claim 1 draws
Object pair.
5. it is according to claim 4 identify lily cultivar Huang Tempo PCR kit, it is characterised in that: further include dNTP,
Magnesium chloride, archaeal dna polymerase and PCR buffer.
6. PCR kit according to claim 5, it is characterised in that: the component that the kit includes is in PCR reaction system
In it is final concentration of: two primer each 0.2-0.8mmol/L, the dNTP 5-20 μm ol/L, the chlorination in the primer pair
Magnesium 0.1-2mmol/L, archaeal dna polymerase 0.2-0.5U/ μ L, Tris-HCL (pH7.5-9.0) 1-5mmol/L and the KCL 0.6-
5mmol/L is as the PCR buffer.
7. PCR kit according to claim 4, it is characterised in that: the component that the kit includes is in PCR reaction system
In, the percent by volume of PCR premixed liquid is 85-95%, each 0.1-1.5 μm of ol/L of two primers in the primer pair.
8. a kind of method for identifying lily cultivar Huang Tempo, it is characterised in that: the described method comprises the following steps:
PCR reaction step: PCR reagent described in any one of PCR primer pair described in claim 1 or claim 4-7 is utilized
Box carries out PCR reaction, obtains pcr amplification product using Plant Genome to be measured as template；
Detecting step: the pcr amplification product is detected, as contained such as Claims 2 or 3 in the pcr amplification product
The specific band, then described to measuring plants is the lily cultivar Huang Tempo.
9. method according to claim 8, it is characterised in that: the response procedures of the pcr amplification reaction are as follows:
Denaturation: 94-95 DEG C 2-5 minutes；Amplification: 94-95 DEG C 10-50 second, 54-60 DEG C 15-50 seconds, 72 DEG C 25-50 seconds, it is total
30-35 circulation；Extend: 72 DEG C 4-10 minutes.
10. method according to claim 8 or claim 9, it is characterised in that:
When the PCR primer pair are as follows: the nucleotide base sequence of a primer therein such as the SEQ ID NO:1 institute in sequence table
Show, the nucleotide base sequence of another primer is as shown in the SEQ ID NO:2 in sequence table, the nucleosides of the specific band
Base sequence is as shown in the SEQ ID NO:5 in sequence table；
When the PCR primer pair are as follows: the nucleotide base sequence of a primer therein such as the SEQ ID NO:3 institute in sequence table
Show, when the nucleotide base sequence of another primer is as shown in the SEQ ID NO:4 in sequence table, the core of the specific band
Thuja acid base sequence is as shown in the SEQ ID NO:6 in sequence table.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610701006.0A CN106119388B (en) | 2016-08-22 | 2016-08-22 | A kind of PCR primer identifying lily cultivar Huang Tempo is to, kit and method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610701006.0A CN106119388B (en) | 2016-08-22 | 2016-08-22 | A kind of PCR primer identifying lily cultivar Huang Tempo is to, kit and method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106119388A CN106119388A (en) | 2016-11-16 |
| CN106119388B true CN106119388B (en) | 2019-10-11 |
Family
ID=57279981
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610701006.0A Active CN106119388B (en) | 2016-08-22 | 2016-08-22 | A kind of PCR primer identifying lily cultivar Huang Tempo is to, kit and method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106119388B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104263835A (en) * | 2014-10-09 | 2015-01-07 | 凯里学院 | Method for identifying varieties of lilium brownii by adopting SSR (simple sequence repeat) molecular marking technology |
-
2016
- 2016-08-22 CN CN201610701006.0A patent/CN106119388B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104263835A (en) * | 2014-10-09 | 2015-01-07 | 凯里学院 | Method for identifying varieties of lilium brownii by adopting SSR (simple sequence repeat) molecular marking technology |
Non-Patent Citations (2)
| Title |
|---|
| 百合品种鉴定技术规程SSR分子标记法;中华人民共和国农业部;《中华人民共和国农业行业标准》;20131213;全文 * |
| 适于百合遗传多样性分析的ＲAPD 引物筛选;陈名红等;《种子》;20140330;第33卷(第3期);1-3 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106119388A (en) | 2016-11-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105624321B (en) | Differentiate the method for yellow stalwart tea tree breed using SSR finger-prints | |
| CN103361425B (en) | Primer and method for identifying purity of cucumber 'Yuexiu No.3' hybrid seed | |
| CN105624328B (en) | The high-throughput molecular labeling and its labeling method of identification leaf muld of tomato resistance and application | |
| CN106676179A (en) | Molecular marker for paddy recessive genic male sterility gene cyp704b2 and application thereof | |
| Cui et al. | Identification of chromosomes in Thinopyrum intermedium and wheat Th. intermedium amphiploids based on multiplex oligonucleotide probes | |
| CN108754009A (en) | Utilize the method for the anti-balck shank chromosome nonhomologous plant of molecular marker screening tobacco | |
| CN107630103A (en) | A kind of CAPS molecule labelling methods for identifying rice varieties and application | |
| CN105821154B (en) | A kind of SSR primer and its method for the identification of sponge gourd hybrid seed purity | |
| CN105671190A (en) | High-throughput molecular marker for identifying neck rot and root rot resistance of tomatoes and marking method and application thereof | |
| CN110029191A (en) | The primer sets of the monocaryon mating type of a kind of identification mushroom Shen 215 strains of perfume and its Essentially derived variety, identification method and application | |
| CN106119388B (en) | A kind of PCR primer identifying lily cultivar Huang Tempo is to, kit and method | |
| CN102719543B (en) | Method for identifying plant varieties by utilizing chemical molecular formulas of nucleotides | |
| CN102586306A (en) | Standard plasmid molecules for transgenetic soybean BPS-CV127-9 detection, constructing method thereof and application thereof | |
| CN102888398A (en) | Flanking sequence of exogenous insertion fragment of transgenic rice variety Bar68-1 and application thereof | |
| CN107815502A (en) | A kind of dCAPS marker developments for identifying waterlogging tolerance of chrysanthemum and application | |
| KR102283638B1 (en) | Random Amplified Polymorphic DNA primer for discrimination of tobacco cultivars | |
| CN110079632A (en) | A kind of InDel Molecular marker kit of single 609 purity detectings in corn variety Shan | |
| CN107058494A (en) | Simplify the method for Jian Kuo Foreign Banks' Entries Purities using SCoT molecular labelings | |
| Li et al. | Chromosome identification in Cucumis anguria revealed by cross-species single-copy gene FISH | |
| CN108998551A (en) | Tea tree quadruple fluorescence SSR molecular marker detection method | |
| CN103290107A (en) | Construction method of SSR fingerprint suitable for identification of rice hybrid authenticity | |
| CN105018487A (en) | Molecular marker for major QTL of chromosome-3 ear row number of corn and application thereof | |
| CN104561364B (en) | A kind of method of rapid detection saccharum SPSB gene pleiomorphism and application | |
| Falistocco et al. | Cytogenetic characterization by in situ hybridization techniques and molecular analysis of 5S rRNA genes of the European hazelnut (Corylus avellana) | |
| CN106520995A (en) | LAMP primer group for fast detecting and identifying aphelenchoides ritzemabosi and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |