CN106119270A - The construction method of the genetic engineering bacterium of antibacterial peptide HirJM79 and application thereof - Google Patents
The construction method of the genetic engineering bacterium of antibacterial peptide HirJM79 and application thereof Download PDFInfo
- Publication number
- CN106119270A CN106119270A CN201610488179.9A CN201610488179A CN106119270A CN 106119270 A CN106119270 A CN 106119270A CN 201610488179 A CN201610488179 A CN 201610488179A CN 106119270 A CN106119270 A CN 106119270A
- Authority
- CN
- China
- Prior art keywords
- hirjm79
- antibacterial peptide
- genetic engineering
- construction method
- engineering bacterium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/315—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses construction method and the application thereof of a kind of antibacterial peptide HirJM79 genetic engineering bacterium.The antibacterial peptide gene of the present invention is probiotic bacteria enterococcus antibacterial peptide gene HirJM79.The gene order of the present invention first synthetic antibacterial peptide HirJM79, and be cloned in lactococcus lactis expression vector, build and obtain recombinant expression carrier；Importing the abduction delivering carrying out antibacterial peptide HirJM79 in lactococcus lactis after the recombinant expression carrier of structure is imported escherichia coli amplification vector again, it is respectively provided with stronger bacteriostatic activity to pathogen.The antibacterial peptide HirJM79 expressed by genetic engineering bacterium of restructuring that the present invention builds, can be used as animal feed additive, have safe and nontoxic, have no side effect, the advantage such as antibiotic-free drug resistance.
Description
Technical field
The invention belongs to gene engineering technology field, be specifically related to the structure side of the genetic engineering bacterium of antibacterial peptide HirJM79
Method and application thereof.
Background technology
In recent years, the antibiotic a large amount of abuses in animal farming industry, cause antibiotic-resistant strains constantly to occur, medicine
Problems, serious threat to human health and the development of animal husbandry such as thing residual, environmental pollution and ecological disruption.Therefore, seek
The novel antibacterial preparation looking for a kind of energy substitute antibiotics is extremely urgent.Antibacterial peptide has good anti-bacterial effect, Heat stability is good, nothing
Poison, noresidue, have no side effect, safe and efficient, environmentally safe and be not likely to produce the advantages such as bacterial drug resistance, be expected to become solution
The certainly effective ways of this difficult problem of abuse of antibiotics.
Antibacterial peptide is the peptide matters resisting exogenous pathogen produced in biological defensive system, be biological natural,
The important component part of system of defense.Antibacterial peptide source is extremely extensive, from plant, insecticide, birds, mammal, microorganism all
Have been observed that the generation of antibacterial peptide.Up to now, existing nearly thousand kinds of antibacterial peptides are by the most isolated and purified and qualification.
Bacteriogenic antibacterial peptide is to have bacteriostatic activity by what Ribosome biogenesis mechanism produced in its metabolic process
Polypeptides matter.Antibacterial peptide is the most universal in probiotic bacteria.It is antibacterial that almost all of probiotic bacteria can produce one or more
Peptide material.In recent years, Chinese scholars is from Lactobacillus plantarum, bacillus acidophilus, bacillus bifidus, streptococcus thermophilus, lactic acid breast
Isolated and purified in many probiotic bacterias such as coccus obtain multiple antibacterial peptide material.
Antibacterial peptide HirJM79 is from the isolated and purified antibacterial peptide obtained of enterococcus hirae DCH5, named HirJM79.Anti-
74 amino acid whose propetides of the structural gene coding of bacterium peptide HirJM79.Its propetide includes 30 amino acid whose signal peptides and 44
Amino acid whose mature peptide.Antibacterial peptide HirJM79 has a wider antimicrobial spectrum, especially to Listeria monoeytogenes, golden yellow
The pathogen such as color staphylococcus have obvious inhibition, have preferable application prospect.
Antibacterial peptide HirJM79 content in its producing strains enterococcus hirae DCH5 is extremely low, extracts antibacterial peptide from producing strains
Yield poorly, time-consuming length, complex process and somewhat expensive, it is impossible to realize large-scale production, thus restrict the reality of antibacterial peptide HirJM79
Border is applied.Use gene engineering method to study and solve the actual application problem of antibacterial peptide HirJM79 can provide one new
Effective technology means.HirJM79 channel genes probiotic lactic acid Lactococcus will obtain genetic engineering bacterium and efficiently express,
This genetic engineering bacterium is used for feed fermentation as fermentation strain, can be used as, in animal feed additive, improving the nutrition of feedstuff
It is worth and animal disease resistant ability.
Summary of the invention
The present invention is to solve tradition antibacterial peptide HirJM79 production method yield of antibacterial peptides length low, time-consuming, complex process and
Somewhat expensive, it is impossible to realize the problems such as large-scale production, will obtain gene in HirJM79 channel genes probiotic lactic acid Lactococcus
Engineering bacteria is also efficiently expressed.
The first aspect of the invention provides the construction method of genetic engineering bacterium of a kind of antibacterial peptide HirJM79, including with
Lower step:
Step 1: the acquisition of genes of interest
Antibacterial peptide HirJM79 gene after restriction enzyme site is modified is cloned on expression vector, expression vector is imported
Extract plasmid after escherichia coli, reclaim genes of interest after enzyme action, save backup at being placed on-20 DEG C；
Step 2: the genes of interest reclaimed in step 1 and linearization plasmid are connected and obtains connecting product；
Step 3: obtain the genetic engineering bacterium expressing antibacterial peptide HirJM79
After connection product step 2 obtained converts competent escherichia coli cell, extract recombiant plasmid, through PCR and enzyme
Plastid transformation Lactococcus lactis bacterium competence cell correct after cutting qualification, then screen by the culture medium containing chloromycetin, and warp
PCR checking, enzyme action obtain expressing the genetic engineering bacterium of antibacterial peptide HirJM79 after identifying.
Construction method according to claim 2, it is characterised in that in described step 1, restriction enzyme site is pst I He
HindⅢ。
Preferably, in above-mentioned steps 1, expression vector is the expression vector pNZ8148 through nisin induction.
Preferably, in above-mentioned steps 3, escherichia coli are escherichia coli MC1061；Described lactococcus lactis is Lactococcus lactis
Bacterium NZ9000.
Preferably, the method that correct after PCR and enzyme action identify in above-mentioned steps 3 plasmid uses electricity to convert imports lactic acid
In Lactococcus.
Preferably, in above-mentioned steps 3, the processing parameter of electricity method for transformation is 2.0kV, 25 μ F, 200 Ω, 5ms.
Second aspect of the present invention provides the antibacterial peptide HirJM79 genetic engineering bacterium built in preparing feed additive
Application.
The third aspect of the invention provides a kind of method producing antibacterial peptide HirJM79, and fermentation strain is above-mentioned the
The genetic engineering bacterium that the method related in one aspect builds.
Preferably, take above-mentioned fermentation strain activation, after cultivating in seed culture medium, be transferred in fermentation medium raw
Produce prebiotic type antibacterial peptide HirJM79.
Compared with prior art, the method have the advantages that
1. the antibacterial peptide of the present invention is from the enterococcus of effect raw to animal health, it is contemplated that in animal feed additive
Animal has preferably effect and probiotic effects, and the mature peptide molecular weight about 5.1KDa of HirJM79 antibacterial peptide has aobvious
The anti-microbial pathogen effect write.
2. the antibacterial peptide HirJM79 expressed by the present invention comes from enterococcus, and animal body is not had toxicity, therefore with this
Antibacterial peptide prepared by bright gene, compared with traditional antibiotic medicine, will be the small peptide class of a kind of safer anti-microbial pathogen
Material.
3. the genetic engineering bacterium that the present invention builds with conventional probiotic lactic acid Lactococcus for Host Strains, lactococcus lactis is originally
Body is exactly the probiotic bacteria favourable to animal health, and antibacterial peptide HirJM79 obtains in lactococcus lactis effective point simultaneously
Secreting expression, therefore, the constructed genetic engineering bacterium of the present invention not only has the prebiotic effect of lactococcus lactis itself, also has
Antibacterial peptide HirJM79 obvious anti-microbial pathogen effect, can preferably safely and effectively apply as prebiotic type feed additive
In animal feed.
Accompanying drawing explanation
Fig. 1 is containing genes of interest bacillus coli DH 5 alpha plasmid double digestion electrophoretogram.
Fig. 2 is pNZ8148 plasmid double digestion electrophoretogram.
Fig. 3 is escherichia coli MC1061 recombinant bacterium PCR primer electrophoretograms.
Fig. 4 is that escherichia coli MC1061 recombiant plasmid extracts electrophoretogram.
Fig. 5 is containing genes of interest Hir JM79 escherichia coli MC1061 recombiant plasmid pNZ8148-HirJM79 double digestion electricity
Swimming figure.
Fig. 6 is lactococcus lactis recombinant bacterium PCR primer electrophoretogram.
Fig. 7 is that lactococcus lactis NZ9000 recombiant plasmid pNZ8148-HirJM79 extracts electrophoretogram.
Fig. 8 is containing genes of interest Hir JM79 lactococcus lactis NZ9000 recombiant plasmid pNZ8148-HirJM79 double digestion
Electrophoretogram.
Fig. 9 is the recombination engineering bacteria antibacterial figure to staphylococcus aureus；Restructuring base after 1-3:Nisin abduction delivering
Because of engineering bacteria supernatant；Comparison: the recombination engineering bacteria supernatant do not induced.
Figure 10 is the recombination engineering bacteria antibacterial figure to Listeria monoeytogenes；1-3:Nisin abduction delivering
Rear recombination engineering bacteria supernatant；Comparison: the recombination engineering bacteria supernatant do not induced.
Figure 11 is the recombination engineering bacteria antibacterial figure to Salmonella；Recombination work after 1-3:Nisin abduction delivering
Journey bacterium supernatant；Comparison: the recombination engineering bacteria supernatant do not induced.
Detailed description of the invention
Below in conjunction with specific embodiment, the present invention is expanded on further.Should be understood that these embodiments be only used for the present invention and not
For limiting the scope of the present invention.
Embodiment 1
Main material used in the present invention is as follows:
Bacterial strain and carrier: escherichia coli MC1061, lactococcus lactis NZ9000 and pNZ8148 plasmid bacterial are purchased from Germany Mo
Bi Tec company；DNAMarker is purchased from Shanghai JaRa company limited；Listeria monoeytogenes, staphylococcus aureus
And Salmonella is laboratory and separates preservation.Antibacterial peptide HirJM79 gene is by Sangon Biotech (Shanghai) Co., Ltd.
Synthesize and proceed to bacillus coli DH 5 alpha；Primer is synthesized by Sangon Biotech (Shanghai) Co., Ltd..
Main agents and test kit: M17 broth bouillon is purchased from Qingdao Hai Bo company；Restricted enzyme Pst I and Hind
III, T4DNALigase, EX Taq is purchased from TaKaRa Biotech company；Chloromycetin, plasmid extraction and DNA gel reclaim reagent
Box is purchased from Tian Gen company；Nisin is purchased from Sigma company.
The preparation of main agents:
121 DEG C of autoclaving 15min of GM17:M17 broth bouillon, add the glucose of filtration sterilization to the denseest after cooling
Degree is 0.5% (mass volume ratio).
SGM17:M17 meat soup adds final concentration of 0.5M sucrose, 2.5% glycine, 0.5% glucose.M17 meat soup adds
Enter 121 DEG C of autoclaving 15min after sucrose and glycine, add the glucose of 0.22 μm filtration sterilization after cooling to final concentration of
0.5% (mass volume ratio).
0.5M sucrose/10% glycerol: 17.115g sucrose is dissolved in 80ml ultra-pure water, after adding 10ml glycerol, mixing is fixed
Hold to 100ml, 0.22 μm filtration sterilization.
LB fluid medium: 10g peptone, 5g yeast extract, 1g NaCl are dissolved in 900ml distilled water, regulates pH
It is worth after 7.0, is settled to 121 DEG C of autoclaving 15min after 1L
Key instrument: High speed refrigerated centrifuge, pipettor, PCR instrument are all purchased from Eppendorf company of Germany；Nucleic acid electrophoresis
Groove, electrophresis apparatus, electricity conversion instrument are purchased from Bio-Rad company；Gel imaging instrument is purchased from Shanghai Tian Neng company；Aseptic filtration film (0.22 μ
M) purchased from What Man company.
The nucleotide sequence of the antibacterial peptide HirJM79 in the present invention as shown in SEQ NO:1, the ripe antibacterial peptide of coding
The aminoacid sequence of HirJM79 is as shown in SEQ NO:2.
Obtain and connect specifically comprising the following steps that of product
1. antibacterial peptide HirJM79 gene is synthesized by Sangon Biotech (Shanghai) Co., Ltd., and both sides add Pst I and Hind
The restriction enzyme site of III importing bacillus coli DH 5 alpha.Extract by the large intestine bar containing genes of interest according to plasmid extraction kit
Bacterium DH5 α plasmid.
2. according to the plasmid extracted in TaKaRa Biotech restricted enzyme Pst I and Hind III double digestion step 1,
Digestion products is through 1% agarose gel electrophoresis (Fig. 1), and genes of interest fragment uses Tian Gen company DNA to reclaim reagent and operation side
Method carries out glue recovery, and-20 DEG C save backup.
Plasmid pNZ8148 linearisation:
Use TaKaRa Biotech restricted enzyme Pst I and Hind III operating instruction double digestion pNZ8148 plasmid,
Linearisation product is through 1% agarose gel electrophoresis (Fig. 2), and genes of interest fragment uses Tian Gen company DNA to reclaim reagent and operation
Method carries out glue recovery, and-20 DEG C save backup.
The genes of interest reclaimed and linearization plasmid connect
According to the T4DNA ligase test kit operating instruction of TaKaRa Biotech, recovery genes of interest and plasmid are entered
Row connects, it is thus achieved that connect product.
Embodiment 2 prepares escherichia coli MC1061 competent cell
The present embodiment prepares escherichia coli MC1061 competent cell, specifically comprises the following steps that
1, the LB fluid medium of 1% inoculation MC1061, cultivates in 37 DEG C of shaken overnight；
2, take incubated overnight bacterium solution 1% and be inoculated in LB fluid medium, shaken cultivation 4h at 37 DEG C (now antibacterial be in right
Number trophophase), place 10min on ice；
3,4000g, 4 DEG C of centrifugal 10min collect logarithmic (log) phase cell, abandon supernatant, collect bacterium cell pellet；
4, with 1/10 in the 0.1M CaCl of the pre-cooling of fluid medium volume before2Thalline, places 30min on ice；
5,4000g, 4 DEG C of centrifugal 5min abandon supernatant, collect bacterium cell pellet；
6, with 1/100 in fluid medium volume before containing 0.1M CaCl2The resuspended thalline of solution；
7, draw 200 μ L and be sub-packed in centrifuge tube ,-80 DEG C of preservations.
Embodiment 3 connects product and converts escherichia coli MC1061 competent cell
The present embodiment converts escherichia coli MC1061 competent cell for connecting product, specifically comprises the following steps that
(1). take 100 μ l escherichia coli MCI061 competent cells, add 10-50 μ l and connect product, after softly mixing, ice
Bath 30min
(2). EP pipe is put into and is preheated to 90S in the water-bath of 42 DEG C；
(3). quickly EP pipe is transferred in ice bath, make cell cool down 1-2min；
(4). often pipe adds 900 μ lLB cultivation liquid bases, and 37 DEG C of shaking table gentlenesses concussions are cultivated 1.5h, made bacteria resuscitation the most fully
Antibiotic-resistance marker's gene of expression plasmid coding；
(5). draw 100 μ l recovery cultivation bacterium solution and be respectively coated on the LB culture medium flat plate containing 10 μ g/mL chloromycetin；
(6). flat board is placed in room temperature and absorbs to liquid, be inverted flat board, cultivate 12-24h until single bacterium colony occurs for 37 DEG C.
Embodiment 4 escherichia coli MC1061 recombiant plasmid bacterium colony PCR and double digestion are identified
The present embodiment is escherichia coli MC1061 recombiant plasmid bacterium colony PCR and double digestion is identified.
1. single bacterium colony that on picking, step obtains carries out PCR qualification
Primer for PCR amplification
Forward primer: AACTTGTCTAGCTGGCATC
Reverse primer: CTCCAAATACCAATAGAAGCC
Amplification purpose fragment length is 481bp.
2. as follows with single bacterium colony PCR reaction system as DNA profiling:
Amplification program: 94 DEG C, 5min, then 30 circulations (94 DEG C, 1min；58 DEG C, 50S；72 DEG C, 1min)；72 DEG C are prolonged
Stretch 10min.PCR primer carries out 1% agarose gel electrophoresis (Fig. 3).
3. recombiant plasmid enzyme action is identified:
Picking through the PCR correct single bacterium colony of checking in LB liquid culture based on the good bacterium solution of 37 DEG C of shaken cultivation, according to sky
Root plasmid extraction kit operating instruction carries out 1% agarose gel electrophoresis (Fig. 4) after extracting plasmid, extract plasmid and use
TaKaRa Biotech restricted enzyme Pst I and Hind III operating instruction double digestion plasmid, product is through 1% agarose gel
Electrophoresis (Fig. 5).
Embodiment 5 prepares lactococcus lactis NZ9000 competent cell
The present embodiment prepares lactococcus lactis NZ9000 competent cell, specifically comprises the following steps that
1, lactococcus lactis 1% is inoculated in SGM17 (GM17 sucrose Han 0.5M, 2.5% glycine), cultivates to OD600 ≈
0.5-0.8；
2,5000g, 4 DEG C of centrifugal 10min collect thalline；
3, the solution washing thalline of the ice-cold 0.5M sucrose containing 10% glycerol 2 times；
4, with the resuspended thalline of 0.5M sucrose solution containing 10% glycerol of 1/100 with culture volume before, in-80 DEG C of guarantors
Deposit.
Embodiment 6 lactococcus lactis electricity converts
Originally it is embodied as lactococcus lactis electricity to convert, specifically comprises the following steps that
After taking the correct recombiant plasmid of 2 μ L empirical tests and the mixing of 40 μ L competent cells, proceed in the electric revolving cup of pre-cooling, ice
Upper placement 10min.Electricity conversion condition: voltage 2000V, electric capacity 25 μ F, resistance 200 Ω.After electric shock, immediately toward electricity revolving cup in
Add 1mL GM17 culture medium (containing 20mM MgCl2, 2mM CaCl2After), 30 DEG C of quiescent culture 2h, coat containing 5 μ g/ml chlorine mould
On the GM17 flat board of element, cultivate until single bacterium colony occurs for 30 DEG C.
Embodiment 7 lactococcus lactis NZ9000 recombiant plasmid bacterium colony PCR and double digestion checking
1. single bacterium colony that on picking, step obtains carries out PCR checking
As follows for the primer of PCR amplification:
Forward primer: AACTTGTCTAGCTGGCATC
Reverse primer: CTCCAAATACCAATAGAAGCC
Amplification purpose fragment length is 481bp.
2. as follows with single bacterium colony PCR reaction system as DNA profiling:
Amplification program: 94 DEG C, 5min, then 30 circulations (94 DEG C, 1min；58 DEG C, 50S；72 DEG C, 1min)；72 DEG C are prolonged
Stretch 10min.PCR primer carries out 1% agarose gel electrophoresis (Fig. 6).
3. picking through the PCR correct single bacterium colony of checking in GM17 liquid culture based on the good bacterium solution of 30 DEG C of shaken cultivation, press
Carry out 1% agarose gel electrophoresis (Fig. 7) after extracting plasmid according to sky root plasmid extraction kit operating instruction, extract plasmid and use
TaKaRa Biotech restricted enzyme Pst I and Hind III operating instruction double digestion plasmid, product is through 1% agarose gel
Electrophoresis (Fig. 8).
The abduction delivering of embodiment 8 lactococcus lactis NZ9000 recombinant bacterium
It is to be grown to OD that recombinant bacterium 4% is inoculated in the GM17 fluid medium containing 5 μ g/ml chloromycetin600nmAdd when being about 0.5
Entering final concentration of 10ng/ml nisin inducing culture 4h and obtain cultivation bacterium solution, 4000g is centrifuged 10min and takes supernatant, by obtain
Supernatant carries out 0.22 μm and filters the sterile supernatant after obtaining induction, for next step bacteriostatic experiment.
Embodiment 9 recombinant antibacterial peptide bacteriostatic experiment
This experiment uses agar diffusion method to detect the bacteriostatic activity of recombinant expressed antibacterial peptide HirJM79.At Jiang
100 μ L coatings are respectively taken in the staphylococcus aureus of exponential phase, Listeria monoeytogenes, Salmonella cultures
With 20ml solid medium, then punch with the card punch of 8mm, add the testing sample supernatant of 200 μ L, with without nisin
The lactococcus lactis supernatant containing antibacterial peptide HirJM79 gene of induction is comparison, cultivates for 37 DEG C and observes.
Using agar diffusion method to detect the bacteriostatic activity of recombinant antibacterial peptide, after 37 DEG C are cultivated, result shows, weight
Salmonella, staphylococcus aureus and Listeria monoeytogenes are pressed down by group antibacterial peptide HirJM79 genetic engineering bacterium
Bacterium effect is substantially (Fig. 9-11).
Embodiment 10 expresses the fermentation culture of the genetic engineering bacterium of antibacterial peptide HirJM79
The seed of the present embodiment and fermentation medium:
Utilize GM17 culture medium as seed and the culture medium of fermentation.Feed supplement liquid: 500g/L glucose.
Sweat comprises the following steps:
1) picking recombinant antibacterial peptide HirJM79 genetic engineering bacterium list bacterium colony is in 5ml GM17 fluid medium, 30 DEG C of trainings
Support 12-16 hour.
2), during 2ml first order seed is inoculated in 200ml seed culture medium, cultivate 12-14 hour for 30 DEG C.
3), during secondary seed is inoculated in the fermentation tank of 3.5L, 30 DEG C, mixing speed 320-600 rev/min, dissolved oxygen is maintained at
More than 35%, control pH about 6.8 with NaOH.After glucose exhausts, supplement glucose with 5g/L.h speed.
4) final concentration of 15ng/ml nisin is added during fermentation liquid thalline about OD600nm=8,30 DEG C of cultivations, 80 hours
After slow down Glucose feed rate, to terminating fermentation.
5) after testing 80 hours fermentation ends time, product antibacterial peptide in recombinant antibacterial peptide HirJM79 genetic engineering bacterium
HirJM79 at concentrations up to 96.21mg/L.
Being described in detail the specific embodiment of the present invention above, but it is intended only as example, the present invention does not limit
It is formed on particular embodiments described above.To those skilled in the art, any equivalent modifications that the present invention is carried out and
Substitute the most all among scope of the invention.Therefore, the impartial conversion made without departing from the spirit and scope of the invention and
Amendment, all should contain within the scope of the invention.
Claims (10)
1. a construction method for the genetic engineering bacterium of antibacterial peptide HirJM79, comprises the following steps:
Step 1: the acquisition of genes of interest
Antibacterial peptide HirJM79 gene after restriction enzyme site is modified is cloned on expression vector, expression vector is imported large intestine
Extract plasmid after bacillus, reclaim genes of interest after enzyme action, save backup at being placed on-20 DEG C；
Step 2: the genes of interest reclaimed in step 1 and linearization plasmid are connected and obtains connecting product；
Step 3: obtain the genetic engineering bacterium expressing antibacterial peptide HirJM79
After connection product step 2 obtained converts competent escherichia coli cell, extract recombiant plasmid, reflect through PCR and enzyme action
Plastid transformation Lactococcus lactis bacterium competence cell correct after fixed, then screen by the culture medium containing chloromycetin, and test through PCR
Card, enzyme action obtain expressing the genetic engineering bacterium of antibacterial peptide HirJM79 after identifying.
Construction method the most according to claim 1, it is characterised in that in described step 1, restriction enzyme site is pst I and Hind
Ⅲ。
Construction method the most according to claim 1, it is characterised in that in described step 1, expression vector is to induce through nisin
Expression vector pNZ8148.
Construction method the most according to claim 1, it is characterised in that in described step 3, escherichia coli are escherichia coli
MC1061。
Construction method the most according to claim 1, it is characterised in that in described step 3, lactococcus lactis is Lactococcus lactis
Bacterium NZ9000.
Construction method the most according to claim 1, it is characterised in that correct after PCR and enzyme action identify in described step 3
The plasmid method that uses electricity to convert import in lactococcus lactis.
Construction method the most according to claim 6, it is characterised in that the processing parameter of electricity method for transformation in described step 3
It is 2.0kV, 25 μ F, 200 Ω, 5ms.
8. according to the genetic engineering bacterium of any one method structure application in preparing feed additive in claim 1-7.
9. the method producing antibacterial peptide HirJM79, it is characterised in that fermentation strain is according to any in claim 1-7
The genetic engineering bacterium that one method builds.
Method the most according to claim 9, it is characterised in that described method is to take described fermentation strain activation, is planting
After sub-culture medium is cultivated, it is transferred in fermentation medium produce prebiotic type antibacterial peptide HirJM79.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610488179.9A CN106119270A (en) | 2016-06-28 | 2016-06-28 | The construction method of the genetic engineering bacterium of antibacterial peptide HirJM79 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610488179.9A CN106119270A (en) | 2016-06-28 | 2016-06-28 | The construction method of the genetic engineering bacterium of antibacterial peptide HirJM79 and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106119270A true CN106119270A (en) | 2016-11-16 |
Family
ID=57284342
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610488179.9A Pending CN106119270A (en) | 2016-06-28 | 2016-06-28 | The construction method of the genetic engineering bacterium of antibacterial peptide HirJM79 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106119270A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106615622A (en) * | 2016-12-12 | 2017-05-10 | 东北农业大学 | Feed additive capable of promoting growth of chicks and enhancing capabilities of resisting infection of salmonella pullorum of chicks and application of feed additive |
| CN109385387A (en) * | 2018-12-28 | 2019-02-26 | 上海源耀生物股份有限公司 | The lactobacillus reuteri of anti-TGEV a kind of and its application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014052438A1 (en) * | 2012-09-25 | 2014-04-03 | Regents Of The University Of Minnesota | Methods for making and using antimicrobial peptides |
-
2016
- 2016-06-28 CN CN201610488179.9A patent/CN106119270A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014052438A1 (en) * | 2012-09-25 | 2014-04-03 | Regents Of The University Of Minnesota | Methods for making and using antimicrobial peptides |
Non-Patent Citations (2)
| Title |
|---|
| JORGE SA´NCHEZ等: "Cloning and Heterologous Production of Hiracin JM79, a Sec-Dependent Bacteriocin Produced by Enterococcus hirae DCH5, in Lactic Acid Bacteria and Pichia pastoris", 《APPLIED AND ENVIRONMENTAL MICROBIOLOGY》 * |
| JUAN BORRERO等: "Use of the usp45 lactococcal secretion signal sequence to drive the secretion and functional expression of enterococcal bacteriocins in Lactococcus lactis", 《APPL. MICROBIOL. BIOTECHNOL.》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106615622A (en) * | 2016-12-12 | 2017-05-10 | 东北农业大学 | Feed additive capable of promoting growth of chicks and enhancing capabilities of resisting infection of salmonella pullorum of chicks and application of feed additive |
| CN109385387A (en) * | 2018-12-28 | 2019-02-26 | 上海源耀生物股份有限公司 | The lactobacillus reuteri of anti-TGEV a kind of and its application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105861522A (en) | Antibacterial peptide Enterocin P and preparation method and application thereof | |
| CN108641979A (en) | A kind of enterococcus faecium, its high density fermentation cultural method and probiotics prepared therefrom | |
| CN108048373A (en) | One bacillus subtilis AH1005 and its application | |
| Tiwari et al. | Diversity and molecular characterization of dominant Bacillus amyloliquefaciens (JNU-001) endophytic bacterial strains isolated from native Neem varieties of Sanganer region of Rajasthan | |
| CN101880676A (en) | Constructing method of nifA gene-introduced rhizobium japonicum genetic engineering bacterial strain HD-SFH-01 | |
| CN106119270A (en) | The construction method of the genetic engineering bacterium of antibacterial peptide HirJM79 and application thereof | |
| CN108179122A (en) | A kind of probiotic enterococcus faecium of high adherency and its application | |
| CN106086041A (en) | A kind of preparation method and applications of prebiotic type antibacterial peptide Enterocin B | |
| CN106011153A (en) | Probiotic antimicrobial peptide Enterocin P, and preparation method and application thereof | |
| CN107254428A (en) | A kind of Expression Systems for Lactic Acid Bacteria for expressing antifreeze peptide builds and its applied | |
| CN107164256A (en) | A kind of method of Sphingol single-cell genetic transformation | |
| CN111763650A (en) | Nitrogen-fixing methylobacterium strain and application thereof | |
| CN106497958A (en) | A kind of method of rapid build recombiant plasmid | |
| CN109266676A (en) | A kind of method of electroporated Siam bacillus | |
| CN114480211A (en) | Wild enterococcus faecium ZK03, and electric shock transformation method and application thereof | |
| CN1195062C (en) | Non-antibiotics resistant shuttle plasmid expression carrier and its constructing method and uses | |
| CN114854629A (en) | Lactobacillus plantarum C-37 and application thereof in fermenting corn germ meal | |
| CN111139207B (en) | Brevibacillus brevis gene recombinant strain and preparation method and application thereof | |
| CN102080079B (en) | Preparation method and application of novel antimicrobial peptide Misgurin mutant | |
| CN104789515B (en) | The Bacillus subtilis genes engineering bacteria and its construction method and application that controllable gemma generates | |
| CN103993021B (en) | Type III effector gene of Xanthomonas campestris pathovar campestris and application of gene | |
| CN106995793A (en) | A kind of fermentation process in high density for recombinating bG-CSF engineering bacteria | |
| CN104962574B (en) | Arthrobacter expression plasmid and application | |
| Bainbridge et al. | Miscellaneous bacteria | |
| CN108265072A (en) | Composition and its application for gene editing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 2 Blocks 2268 Hanghe Road, Pudong New Area, Shanghai, 201317 Applicant after: Shanghai yuanyao Agriculture Co., Ltd Address before: 201316, No. 118, No. 5842 barley Bay Industrial Zone, head town, Shanghai, Pudong New Area Applicant before: SHANGHAI YUANYAO BIOLOGICAL CO., LTD. |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161116 |