CN106119259B

CN106119259B - Gentiana rigescens leaf surface secretion formation associated protein EgMIXTA1 gene

Info

Publication number: CN106119259B
Application number: CN201510459421.5A
Authority: CN
Inventors: 张旸; 解莉楠; 李玉花
Original assignee: Northeast Forestry University
Current assignee: Northeast Forestry University
Priority date: 2015-07-31
Filing date: 2015-07-31
Publication date: 2021-03-12
Anticipated expiration: 2035-07-31
Also published as: CN106119259A

Abstract

A secretion on the surface of leaves of Gentiana rigescens forms a related protein EgMIXTA1 gene, which belongs to the technical field of plant genetic engineering. The gene coding region of the invention is 1128bp in length and codes 375 amino acids, and sequence homology BlastX analysis shows that the protein has certain difference with the MIXTA protein of other species on the sequence, and the homology with the protein sequence of protein 1(GenBank: CAA78386.1) of petunia is 65 percent at most. The gene overexpression and RNAi interference plant is obtained through genetic transformation, and the result shows that: compared with the wild type, the interfered Gentiana pratensis plant has curled leaves, is thin and long and has rare surface secretion; compared with wild type, the over-expressed Gentiana pratensis plant has flat and large leaves and obviously thickened surface secretion. Therefore, the gene forms a related protein gene for a surface secretion layer.

Description

Gentiana rigescens leaf surface secretion formation associated protein EgMIXTA1 gene

Technical Field

The invention belongs to the technical field of genetic engineering, and relates to a secretory formation related protein gene on the surface of leaves of a stephania sinica diels.

Background

The application of plant transgenic technology to the improvement of flower color and flower type of ornamental plants to obtain higher quality flowers is undoubtedly an effective way, and there have been many reports of patent applications of various genes so far. The cloning technology of the gene is to determine the target gene to be cloned, then obtain the segment of the required gene by RT-PCR technology, and obtain the full length of the required gene by RACE technology for the gene segment. The MIXTA gene, as a related gene regulating the synthesis of a MYB transcription factor, has received extensive attention and has been studied and discussed in different species of test materials since the first cloning in Goldwort was reported in 1994. The MIXTA gene not only controls the formation of cone-shaped cells of various plants such as Goldwort herb and the like, but also regulates the growth of cone-shaped cells and multicellular gland trichomes in different tissue parts by ectopic expression of the MIXTA gene, and the difference of the spatial-temporal expression of the MIXTA determines the functional specificity of the MIXTA gene in different plant tissues. It has now been found that a number of homologous genes having the same or similar conserved sequence as MIXTA exert similar functions to the MIXTA gene already reported, but there are few reports on whether the MIXTA gene has other specific functions, and the function of the MIXTA gene cannot be fully understood.

Gentiana scabra (Eustoma grandiflorum), also known as Eustoma grandiflorum, is native to the central south of the United states and is a herbaceous species of angiosperm with high ornamental value. Partial cell morphology on the surface of the petals of the gentiana pratensis also presents a cone-shaped characteristic, and the existence of the cone-shaped cells makes the research on the function of the MIXTA gene possible,

disclosure of Invention

The invention aims to clone a grassland gentian protein EgMIXTA1 gene, which belongs to a MIXTA family gene and has the function of increasing the formation of secretion on the surface of leaves, the gene can be used for scientific research and production, is used for comprehensively and specifically researching the function of the MIXTA gene, is a supplement for the reported research on the function of the MIXTA gene, and can be used for cultivating a new variety of grassland gentian by a transgenic technology. The secretory formation related protein EgMIXTA1 on the surface of the leaves of the gentiana pratensis has a coding region nucleic acid and an amino acid sequence shown in a sequence table. The secretion on the surface of the leaf can effectively prevent and treat water loss, avoid organ fusion, resist plant diseases and insect pests and prevent pathogen invasion. The secretory formation related protein EgMIXTA1 gene coding region of the surface of the leaves of the gentiana rigescens of the grassland has the length of 1128bp and codes 375 amino acids. Parameters of the protein were analyzed using the ExPASY ProtParam program: molecular formula C₁₈₁₉H₂₈₄₀N₅₃₈O₅₇₅S₁₃The total number of atoms is 5785, the molecular mass is 41.86KDa, and the protein belongs to unstable and hydrophilic protein. Sequence homology BlastX analysis shows that the protein has certain difference with the MIXTA protein of other species in sequence, and has the highest 65 percent of sequence homology with protein 1(GenBank: CAA78386.1) of petunia. Then constructing an overexpression and RNAi interference vector, and performing electrotransferIt is introduced into agrobacterium and used for genetic transformation of rough gentian leaf. The results show that: compared with the wild type, the interfered Gentiana pratensis plant has curled leaves, slender leaves and lacking surface secretion; compared with wild type, the over-expressed gentiana pratensis plant has flat, large and round leaves and obviously thickened surface secretion. Therefore, the protein EgMIXTA1 gene has a different function from the reported MIXTA gene.

Drawings

FIG. 1 shows PCR detection of transgenic regenerated plantlets of Gentiana pratensis, wherein the first lane is M: DL2000marker, the second lane is a positive result, lanes 3-5 are PCR results of overexpression plants, lanes 7-9 are RNAi interference plant PCR results, and lane 10 is wild type; FIG. 2 is a microscopic observation of wild type and transgenic grassland gentian plant root green fluorescent protein, wherein A is a wild type plant and B is an intervention strain i 3; c is an overexpression strain O1; FIG. 3 wild type and transgenic grassland gentian plants, wherein A is the wild type plant and B is the intervention line i 3; c is an overexpression strain O1; FIG. 4 is an electron microscope observation of the leaf surface of wild type and transgenic grassland gentian plants, wherein A is the wild type plant and B is the intervention strain i 3; c is an overexpression strain O1; FIG. 5 is an electron microscope observation of stomata on the surface of leaves of wild type and transgenic grassland gentian plants, wherein A is a wild type plant and B is an intervention strain i 3; c is an overexpression strain O1; FIG. 6 is an electron microscope observation of the surface secretion of wild type and transgenic grassland gentian plants, wherein A is a wild type plant and B is an intervention strain i 3; c is the overexpression strain O1.

Detailed Description

The first embodiment is as follows: the embodiment is realized as follows:

(I) extracting total RNA of gentiana pratensis

a. 0.2g of the sample was taken, ground well by liquid nitrogen snap freezing, and 1mL of TRIzol reagent (ex Invitrogen) and 20. mu.L of beta-mercaptoethanol were added, ground and agitated to a homogenate. Poured into 1.5mL RNase Free EP tube and gently agitated.

b. Placing the EP pipe horizontally for 5min at room temperature; centrifuging at 12000rpm for 2min at room temperature; and taking the supernatant.

c. 0.1mL of 5M NaCl was added; then adding 0.3mL of chloroform, and fully stirring; centrifuge at 12000rpm for 10min at 4 ℃.

d. Sucking supernatant, adding equivalent isopropanol, and standing at room temperature for 10 min; centrifuge at 12000rpm for 10min at 4 ℃.

e. Discarding the supernatant, and adding 1mL of 70% ethanol; centrifuging at 12000rpm for 1min at room temperature, and removing ethanol; centrifuging at 12000rpm for 1min again, completely removing ethanol, standing on ice for 15min, and drying; addition of ddH₂O25. mu.L was dissolved.

f. The RNA samples were stored in a freezer at-40 ℃ or-80 ℃ for further use.

Egmixta1 gene related to waxy layer formation of gentiana scabra leaf

Using the obtained RNA, carrying out reverse transcription to obtain cDNA, then comparing the sequence homology according to the mRNA sequences of the MIXTA and MIXTA-LIKE genes of Goldwort (AY821655, AJ006292, X79108, AY661654), apple (DQ074464), upland cotton (AF336283) and petunia (Z13996) in GenBank by CLUSTALW online software, designing a degenerate primer F in a sequence conservation region: 5 'AATTATTTGAGACCNGAYATHAA 3'; r: 5 'TGGGTCACCGGRTCDATNCCCAT 3' and then carrying out PCR by taking the reverse transcription cDNA as a template, wherein the reaction program is 94 ℃ for 5 min; 30s at 94 ℃, 30s at 50 ℃, 30s at 72 ℃ and 35 cycles; 72 ℃ for 7 min. And (3) recovering and purifying the amplified PCR fragment product by using a gel recovery kit, connecting the product with a PMD-18T vector, transforming the product into DH5a escherichia coli competent cells, extracting recombinant plasmids, performing PCR detection and sequencing, wherein the measured sequence length is 203bp, and the sequence is as follows:

sequence of conserved region of > EgMIXTA1

5’AATTATTTGAGACCGGATATTAAGAGAGGAAAATTCACTTTGCAAGAGGAGCAAACTATTATCCAACTTCATGCTCTCTTAGGAAACAGGTGGTCGGCAATTGCAACTCATTAGTCTAAACGAACAGACAACGAGATCAAGAACTACTGGAACACACATCTTAAAAAACTATTACTCAAAATGGGAATAGATCCGGTGACCCA3’

Designing RACE primers according to the obtained fragment sequences, wherein 5 'RACE primer GSP 5' 1: 5 'GTCACCGGATCTATTCCCATTTTG 3'; GSP 5' 2: 5 'GCAATTGCCGACCACCTGTTTCC 3'; 3 'RACE primer GSP 3' 1: 5 'GATGGCCAATCCAAACATGC 3'; GSP 5' 2: 5 'AAAGCGCCAGGCTCGAAG 3'. Anchor primer AP 1: 5 'GTACTAGTCGACGCGTGGCCTTTTTTTTTTTTTT 3'; adaptor primer AP 2: 5 'GTACTAGTCGACGCGTGGCC 3'.

For cloning the 5 'sequence of the Gentiana pratensis Egmixta1 gene, two 5' RACE upstream primers GSP5 '1 and GSP 5' 2 are designed according to the sequence of the conserved region of the Gentiana pratensis Egmixta1 gene obtained by cloning. Firstly, a reverse transcription Product is purified by using a High Pure PCR Product Purification Kit of Promega company, then a reverse transcription Product is tailed by using TDT (Terminal deoxynucleotidyl Transferase 1) and dATP of Takara company, and finally nested PCR amplification is carried out by using tailed cDNA as a template. The first round of PCR reaction primers are GSP 5' 1 and AP1, and the reaction program is 94 ℃ for 5 min; 30s at 94 ℃, 30s at 55 ℃, 1min at 72 ℃ and 35 cycles; 72 ℃ for 7 min. The second round of PCR reaction primers are GSP 5' 2 and AP2, and the reaction program is 94 ℃ for 5 min; 30s at 94 ℃, 10s at 55 ℃, 30s at 72 ℃ and 35 cycles; 72 ℃ for 7 min. And recovering and purifying the product after electrophoresis by using a gel recovery kit for the amplified PCR fragment product, connecting the product with a PMD-18T vector, transforming the product into DH5a escherichia coli competent cells, extracting recombinant plasmids, performing PCR detection and sequencing, wherein the measured sequence length is 338bp, and the sequence is as follows:

sequence of > EgMIXTA15

GTACTAGTCGACGCGTGGCCTTTTTTTTTTTTTTTTTGCTGATCAAATCAGTCGTCCATGGGGCGTTCTCCATGTTGCGCTAAAGTTGGGCTTAAGAAAGGACCTTGGACACCCGAAGAAGATCAGAAGCTCTTAGCTTACATTGAAGAACATGGTCATGGAAGCTGGCGTGCTCTCCCTTTCAAAGCTGGACTTCAAAGGTGTGGAAAGAGTTGTAGACTAAGATGGACTAACTATTTGAGACCTGACATCAAGAGAGGAAAATTCACTTTGCAAGAGGAGCAAACTATTATTCAACTTCATGCTCTCTTAGGAAACAGGTGGTCGGCAATTGCAAT

For cloning 3 'sequence of the Gentiana pratensis EgmixTA1 gene, two 3' RACE upstream primers GSP3 '1 and GSP 3' 2 are designed according to the sequence of the conserved region of the Gentiana pratensis EgmixTA1 gene obtained by cloning, and then nested PCR amplification is carried out by taking reverse transcription cDNA as a template. The first round of PCR reaction primers are GSP 3' 1 and AP1, and the reaction program is 94 ℃ for 5 min; 30s at 94 ℃, 30s at 55 ℃, 1min at 72 ℃ and 35 cycles; 72 ℃ for 7 min. The second round of PCR reaction primers are GSP 3' 2 and AP2, and the reaction program is 94 ℃ for 5 min; 30s at 94 ℃, 10s at 55 ℃, 30s at 72 ℃ and 35 cycles; 72 ℃ for 7 min. The PCR fragment product after amplification is recovered and purified by using a gel recovery kit, is connected with a PMD-18T vector, is transformed into a DH5a escherichia coli competent cell, extracts a recombinant plasmid, is subjected to PCR detection and then is sequenced, the measured sequence length is 856bp, and the sequence is as follows:

sequence of > EgMIXTA13

AAAGCGCCAGGCTCGAAGCGGAAGCCCGATTGGTCCGCCAATCAAAGTTGCGCTCCAACACTTTCTCTAACCCATTGGGCTCAACCGAGTTCTCCTCTCCATCGAGCCCCCTGGTCCACAAGGCCATGAGCCTGGTGCCACGCTGTTTTGATATAGCAAGCAATGAGGTGTGGGCCAGAAGGAAAACCCCCGCTACCGAGTCAGTCGGAATTGGCGCCGATCTTGAATCTCCGACGTCTACCCTTAGCTATTCCGAGAATCAACCATGTGGGATGGGAGAGAATTCCACAGCATTTATAGAGTTTGTTGGAAATTCTTCTGAAGGAGATATAATGAAAGAAGAAGGTGAAGAAAATCGGAAAGGCTTCGAAATCTCTAATAATTTGACAGAATATAAAGACGGCATGGAAAATACAATCTCTTTTACATGGCCGCCGGAGCCACTCAGGCCAAATTCAGAACAAGATGCAAGTGGGAATTTCGTGCAGAGATTTACAGACCTTTTGCTTAATAATTCCGGTGATCAACGGAGCTTTTCTGAGGGGTGTGGAGGGTCCGAGAACGGCGACGGAAGTGGAAGTGAGTATTTGGAAGACAATAAGAATTACTGGAACAGCATTCTTAATATGGTGAATTCTTCACCTTCTGATTCCCCAATATTTTAGCAAAGATTTCAATTCAAATGCAATCAACAGTGACCTTCCTCGACTTCTCCATCATTGCAGTCTCCATCAAATATGAATAATCGTTAACCAAGGTTTTTCTTTAGCCATTTGTCTTTAGCAAGAAATTCCATCTAAGACATGTAAATTTGTAAAAAAAAAAAAAAAAAAGTACTAGTCGACGCGTGGCCAAT

The obtained sequence is spliced, an ORF Finder tool in NCBI is used for analyzing the sequence of the EgMIXTA1 gene, the result shows that the length of an Open Reading Frame (ORF) of the gene is 1128bp, 375 amino acids are coded, and sequence homology BlastX analysis shows that the gene has certain difference with the MIXTA gene of other species on the sequence, and the homology with the protein sequence of protein 1(GenBank: CAA78386.1) of petunia is 65 percent at most. The sequence is as follows:

cDNA sequence of coding region of Egmixta1 gene of waxy layer formation associated protein of gentian leaf of gentian

(III) conversion of waxy layer formation associated protein Egmixta1 gene of leaves of Gentiana pratensis into Gentiana pratensis

The Gentiana pratensis EgMIXTA1 gene is constructed into an overexpression vector pH7WG2D-EgMIXTA1 and an interference vector pH7GWIWG2(I) -EgMIXTA1, and is introduced into agrobacterium by an electrotransformation method, and Gentiana pratensis leaves are genetically transformed by an agrobacterium-mediated method. The obtained resistant strains are subjected to PCR detection (see the attached figure 1 in the specification), and the transgenes have bands compared with wild plants. Meanwhile, the green fluorescent protein detection is carried out on roots of transgenic and wild plants (see the attached figure 2 in the specification), and compared with wild plants, the green fluorescent protein can be observed in transgenic lines. Finally, phenotype identification (see attached figure 3 in the specification) and electron microscope detection (see attached figures 4-6 in the specification) are carried out on the transgenic plants. The results show that: compared with the wild type, the interfered Gentiana pratensis plant has curled leaves, slender leaves and lacking surface secretion; compared with wild type, the over-expressed gentiana pratensis plant has flat, large and round leaves and obviously thickened surface secretion. Therefore, the gene was identified as a gene related to secretion formation on the leaf surface.

Claims

1. The surface secretion formation related protein EgMIXTA1 gene of the leaf of gentiana pratensis is characterized in that the cDNA sequence of the coding region of the gene is as follows:

5’ATGGGGCGTTCTCCATGTTGCGATAAAGTTGGTCTTAAGAAAGGACCTTGGACACCTGAAGAAGATCAGAAGCTCTTAGCTTACATTGAAGAACATGGTCATGGAAGCTGGCGAGCCCTCCCTTCCAAAGCTGGGCTTCAAAGGTGTGGAAAGAGTTGCAGACTAAGATGGACTAACTATTTGAGACCTGATATCAAGAGAGGAAAATTCACTTTGCAAGAGGAGCAAACTATTATTCAACTCCATGCTCTGTTGGGAAACAGGTGGTCGGCAATTGCAACTCATTTGACTAAACGAACAGACAACGAGATCAAGAACTACTGGAATACACATCTTAAGAAACGACTAGCTGAAATGAGAATAGATCCAGTGACCCACAGGCCCAAAAACGATGCCCTCTTATCCAACGGCGACGGTCAATCAAAACACGCAGCTAATCTAAGCCACATGGCTCAATGGGAAAGTGCGAGGCTTGAAGCCGAAGCTCGATTGGTCCGCCAATCAAAGTTGCGCTCAAACACTTTTCCGAACCCGTTGGGTTCATCCCAGTCAAGCCCACTGGCCCACAAGCCCATGGGTTTGGTCCCACCACGCTGTTTTGATATGCTAAAAGGAGCGTGGGCTAGAAGAGAAGTCGCTGCCAGCGAGCCAGTCGTCGGAATCGGCGCCGACCTTGGATCTCCGACGTCTACGCTTAGCTATTCCGAGAACCCATCAAGTGGGATGGGGGAGAATTCCACAGCATTTATAGAATTTGTTGGAAATTCTTCTGAGGGATCTATATTGAAAGAAGAAGGTGACGAAAACTGGAAAGGCTTCGAAAGCCCTAATAATTTGATTGAAAATAAAGACGGCAGGGAAAATAAAATCTCTTTCACATGGCCGATGGAGCCACTCAGGCCAAATTCAGATCAAGTTACAAATGGGAATTTCGTGCAGAGATTTACAGACCTTTTGCTTAATAATTCGGGTGATCAACGGAGCTTCTCCGAGAGGTGTGGAGAGTTCGACAACAGCGACGGCGACGGCGACGGAAGTGGAAGCGAGTATTTGGAAGACAACAAGAATTACTGGAACAGCATTCTTAATTTGGTGAATTCTTCACCTTCTGATTCCCCAATATTTTAG3’。