CN106086235A - A kind of method that in qualitative detection CAR T product, VSVG sequence is polluted - Google Patents
A kind of method that in qualitative detection CAR T product, VSVG sequence is polluted Download PDFInfo
- Publication number
- CN106086235A CN106086235A CN201610457173.5A CN201610457173A CN106086235A CN 106086235 A CN106086235 A CN 106086235A CN 201610457173 A CN201610457173 A CN 201610457173A CN 106086235 A CN106086235 A CN 106086235A
- Authority
- CN
- China
- Prior art keywords
- vsvg
- car
- product
- sequence
- time pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/702—Specific hybridization probes for retroviruses
- C12Q1/703—Viruses associated with AIDS
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- AIDS & HIV (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of method of quality control applied in cellular immunization CAR T treats, be specifically related to a kind of method that in qualitative detection CAR T product, VSVG sequence is polluted.The present invention is directed to lentivirus production the deficiencies in the prior art, according to being actually needed that CAR T produces, devise the Real Time PCR primer of VSVG gene order in HIV.Using this primer that CAR T product is carried out Real Time pcr analysis, it is possible to VSVG gene order presence or absence in effectively monitoring CAR T, the safety for the application of CAR T immune cell therapy technology provides guarantee.
Description
Technical field
The present invention relates to a kind of method of quality control applied in cellular immunization CAR-T treats, be specifically related to one
The method that in qualitative detection CAR-T product, VSVG sequence is polluted.
Background technology
CAR-T, full name is Chimeric Antigen Receptor T-Cell Immunotherapy, and chimeric antigen is subject to
Body T cell immunotherapy.This is one and occurs in that a lot of year, but the most modified use is to novel cell clinically
Therapy.The treatment of acute leukemia and non-Hodgkin lymphoma there is significant curative effect it is considered to be the most promising swollen
One of tumor therapeutic modality.Technology as in all is the same, and CAR-T technology also experiences a very long evolutionary process, just at this
In a series of evolutionary process, CAR-T technology gradually moves to maturity.
CAR-T treatment is a kind of narrow spectrum targeted therapy, because it is according to via antibody, for the combination of antigen,
Or a target spot of special combination, it has narrow spectrum, thus the therapeutic effect of CAR-T have narrow spectrum one special
Targeting.Comparatively speaking, it is not site-specific that traditional cellular immunotherapy aspect CIK also has NK to be the most all belonging to, and belongs to
Immunotherapy regimens in commonplace property.Thus relative to if you tell it, the effect of CAR-T is that comparison is clear and definite, compared with
CIK, NK, be more direct a kind of means.
But, because preparation process needing use slow virus infection T cell, and generate CAR-T, therefore to quality control
It is shaped with higher requirement.Although the progress of slow virus packaging has gone through several generation, safety is greatly improved, but because of it
Source is HIV, so strict quality inspection is essential.
Jiang Licui etc. are in " T cell that mosaic antigen receptor is modified is to CD19～the killing of+shell type lymphoma cell "
Literary composition finds the T cell modified through CD19 Chimeric antigen receptor can specific recognition CD19 molecule, shell type positive for CD19 is drenched
The killing-efficiency of bar tumor cell is significantly higher than not by the T cell of genetic modification, demonstrates that CD19-CAR-T is thin at shell type lymph
The great potential of born of the same parents' immunotherapy of tumors.
Summary of the invention
Because needing to use the recombinant type no pathogenicity virus slow virus in HIV source when CAR-T produces, so needing
Before being expelled in the patient, the HIV in CAR-T is detected, to ensure the safety that CAR-T uses.The present invention is directed to
Lentivirus production the deficiencies in the prior art, according to being actually needed that CAR-T produces, devise VSVG gene order in HIV
Real-Time PCR primer.This primer is used to carry out Real-Time pcr analysis, it is possible in effectively monitoring CAR-T, VSVG's deposits
Whether, the safety for the application of CAR-T immune cell therapy technology provides guarantee.
The present invention is achieved through the following technical solutions above-mentioned technical purpose:
The present invention provides a kind of method that in qualitative detection CAR-T product, VSVG sequence is polluted, and it specifically includes following step
Rapid:
(1) Real-Time PCR design and selection: use Primer Premier 5 software to set for VSVG gene order
Count one group of Real-Time PCR primer and probe；And use the pMD2.G plasmid in slow virus packaging system to primer and probe
Carry out efficiency and specificity assessment, choose the preferable one group of Real-Time PCR primer of fluorescent effect and probe carries out follow-up inspection
Survey；
(2) making of standard curve sample: use pMD2.G plasmid as standard substance mother solution, extract the lymph before infecting thin
Born of the same parents DNA dilutes pMD2.G plasmid, is respectively prepared copy number 1.600E+08,1.600E+07,1.600E+06,1.600E+05,
One group of standard solution of 1.600E+04,1.600E+03,1.600E+02；Adding fluorescent agent in reaction tube, use is chosen
Real-Time PCR primer carries out Real-Time PCR to CAR-T product and negative control, determines each reaction tube fluorescence signal
Arrive and set period Ct that threshold value is experienced；
(3) CAR-T product gene group is extracted and Real-Time PCR: choose CAR-T product as testing sample, extraction
Genomic DNA, and carry out DNA concentration and purity analysis, meanwhile, extract the genomic DNA of naive T cell, quantitatively to 90ng/ μ L
As negative control；In reaction tube, add fluorescent agent, use the Real-Time PCR primer chosen to CAR-T product and the moon
Property comparison carry out Real-Time PCR, determine that each reaction tube fluorescence signal arrives and set period Ct that experienced of threshold value；
(4) qualitatively judge whether CAR-T product exists VSVG pollution: compare the Ct value of testing sample, each standard curve
The Ct value of Ct value and negative control, if testing sample is consistent with the amplification curve of negative control, and Ct value is more than positive control
Time, it is believed that this sample pollutes without VSVG and exists；If there is notable difference with the amplification curve of negative control in testing sample, and treats
Less than negative control, test sample product Ct value is thought in this sample that VSVG exists and is polluted.
Described VSVG gene order is sequence 4, and its nucleotide coding is:
GCAAGGAAAGCATTGAACAAACGAAACAAGGAACTTGGCTGAATCCAGGCTTCCCTCCTCAAAGTTGTGGATATGCA
ACTGTGACGGATGCCGAAGCAGTGATTGTCCAGGTGACTCCTC。
In qualitative checking method described above, selected VSVG_F primer is sequence 1, and its nucleotides sequence is classified as
GCAAGGAAAGCATTGAACAA, VSVG_R primer is sequence 2, and its nucleotides sequence is classified as GAGGAGTCACCTGGACAATCACT,
VSVG_Probe probe is sequence 3, and its nucleotide coding is: AGGAACTTGGCTGAATCCAGGCTTCC.
In qualitative checking method described above, described pMD2.G plasmid includes VSVG gene order.
In qualitative checking method described above, described genomic DNA enters by using genome DNA extracting reagent kit
Row extracts.Being extracted the genomic DNA concentration obtained is 44.3ng/ μ L, and purity 260/280 is between 1.80-1.90.
In qualitative checking method described above, described fluorescent agent is 2 × SuperReal PreMix.
In qualitative checking method described above, the described reaction system in Real-Time PCR reaction includes
Template2 μ L, Primer Mix 1.5 μ L, the 2 × SuperReal PreMix 12.5 μ L of 10 μMs, probe 0.5ul, ddH2O
8.5μL.The described response procedures in Real-Time PCR reaction is: the first stage, 95 DEG C, 900s, 1 circulation；Second-order
Section: be followed successively by 94 DEG C, 60s；70 DEG C, 30s；72,60s；Carry out 40 circulations altogether.
The present invention is also claimed a kind of method of quality control being applied to cellular immunization CAR-T treatment, and it includes right
Require the method that in the arbitrary described qualitative detection CAR-T product of 1-7, VSVG sequence is polluted.
Excellent the having the technical effect that the present invention is compared with prior art acquired
1) the wild-type virus problem being likely to occur for a new generation's immunotherapy techniques CAR-T production process, devises
High efficiency, the Real Time PCR of high specific react primer, achieve quality inspection purpose very well, have filled up technological gap.
2) method that in qualitative detection CAR-T product of the present invention, VSVG sequence is polluted is easy and simple to handle, visual result
Quickly, there is good potential applicability in clinical practice.
Accompanying drawing explanation
Fig. 1 uses the curve chart of the method that VSVG sequence is polluted in qualitative detection CAR-T product of the present invention.
Detailed description of the invention
Further describe technical scheme below by way of specific embodiment, but those skilled in the art should be able to know
Dawn, described embodiment also limits protection scope of the present invention never in any form.
The method that in embodiment a kind of qualitative detection CAR-T product, VSVG sequence is polluted
1. instrument and equipment
Superclean bench, Real-Time PCR instrument, desk centrifuge, vortex suspendible device, Nanodrop ultramicron light splitting light
Degree meter etc..
2. reagent
Genome DNA extracting reagent kit (Axygen), the PCR primer (GeneScript) of PAGE purification, positive control
PMD2.G plasmid (containing VSVG gene), 2 × SuperReal PreMix (sky root) etc..
3. checked operation
(1) making of template: choose CAR-T end product in gnotobasis as testing sample, use Axygen life
The genome DNA extracting reagent kit produced, extracts genomic DNA.Nanodrop instrument is used to carry out DNA concentration and purity after extraction
Analyze.After measured, described genomic DNA concentration is that 44.3ng/ μ L. purity 260/280 is between 1.80-1.90.
(2) Real-Time PCR reaction:
The VSVG_F primer of Real-Time PCR reaction is that GCAAGGAAAGCATTGAACAA, VSVG_R primer is
GAGGAGTCACCTGGACAATCACT, VSVG_Probe probe: AGGAACTTGGCTGAATCCAGGCTTCC.
Table 1Real-Time PCR reaction system (unit: μ L)
Table 2Real-Time PCR response procedures
4. detection method
1) Real-Time PCR design and selection: use Primer Premier 5 software to set for VSVG gene order
Count one group of Real-Time PCR primer and probe；And use the pMD2.G plasmid in slow virus packaging system to primer and probe
Carry out efficiency and specificity assessment, choose the preferable one group of Real-Time PCR primer of fluorescent effect and probe carries out follow-up inspection
Survey；
(2) making of standard curve sample: use pMD2.G plasmid as standard substance mother solution, extract the lymph before infecting thin
Born of the same parents DNA dilutes pMD2.G plasmid, is respectively prepared copy number 1.600E+08,1.600E+07,1.600E+06,1.600E+05,
One group of standard solution of 1.600E+04,1.600E+03,1.600E+02；Adding fluorescent agent in reaction tube, use is chosen
Real-Time PCR primer carries out Real-Time PCR to CAR-T product and negative control, determines each reaction tube fluorescence signal
Arrive and set period Ct that threshold value is experienced；
(3) CAR-T product gene group is extracted and Real-Time PCR: choose CAR-T product as testing sample, extraction
Genomic DNA, and carry out DNA concentration and purity analysis, meanwhile, extract the genomic DNA of naive T cell, quantitatively to 90ng/ μ L
As negative control；In reaction tube, add fluorescent agent, use the Real-Time PCR primer chosen to CAR-T product and the moon
Property comparison carry out Real-Time PCR, determine that each reaction tube fluorescence signal arrives and set period Ct that experienced of threshold value；
(4) qualitatively judge whether CAR-T product exists VSVG pollution: compare the Ct value of testing sample, each standard curve
The Ct value of Ct value and negative control, if testing sample is consistent with the amplification curve of negative control, and Ct value is more than positive control
Time, it is believed that this sample pollutes without VSVG and exists；If there is notable difference with the amplification curve of negative control in testing sample, and treats
Less than negative control, test sample product Ct value is thought in this sample that VSVG exists and is polluted.
According to above-mentioned experimental technique, the VSVG that whether deposits of detection testing sample pollutes.Fig. 1 is for using qualitative detection of the present invention
The curve chart of the method that VSVG sequence is polluted in CAR-T product.Specific experiment result is as shown in table 3: result shows, D09 institute is right
The CAR-T product answered does not has VSVG to pollute.
Whether table 3CAR-T product pollutes VSVG experimental result
SEQUENCE LISTING
<110>suitable clear-cells bio tech ltd
<120>a kind of method that in qualitative detection CAR-T product, VSVG sequence is polluted
<130>
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
gcaaggaaag cattgaacaa 20
<210> 2
<211> 23
<212> DNA
<213>artificial sequence
<400> 2
gaggagtcac ctggacaatc act 23
<210> 3
<211> 26
<212> DNA
<213>artificial sequence
<400> 3
aggaacttgg ctgaatccag gcttcc 26
<210> 4
<211> 120
<212> DNA
<213>VSVG gene order
<400> 4
gcaaggaaag cattgaacaa acgaaacaag gaacttggct gaatccaggc ttccctcctc 60
aaagttgtgg atatgcaact gtgacggatg ccgaagcagt gattgtccag gtgactcctc 120
Claims (8)
1. the method that in qualitative detection CAR-T product, VSVG sequence is polluted, it specifically includes following steps:
(1) Real-Time PCR design and selection: use Primer Premier 5 software to design for VSVG gene order
Group Real-Time PCR primer and probe；And use the pMD2.G plasmid in slow virus packaging system that primer and probe are carried out
Efficiency and specificity assessment, choose the preferable one group of Real-Time PCR primer of fluorescent effect and probe carry out subsequent detection；
(2) making of standard curve sample: use pMD2.G plasmid as standard substance mother solution, extract the lymphocyte before infecting
DNA dilutes pMD2.G plasmid, is respectively prepared copy number 1.600E+08,1.600E+07,1.600E+06,1.600E+05,
One group of standard solution of 1.600E+04,1.600E+03,1.600E+02；Adding fluorescent agent in reaction tube, use is chosen
Real-Time PCR primer carries out Real-Time PCR to CAR-T product and negative control, determines each reaction tube fluorescence signal
Arrive and set period Ct that threshold value is experienced；
(3) CAR-T product gene group is extracted and Real-Time PCR: choose CAR-T product as testing sample, extraction gene
Group DNA, and carry out DNA concentration and purity analysis, meanwhile, extract the genomic DNA of naive T cell, quantitatively to 90ng/ μ L conduct
Negative control；In reaction tube, add fluorescent agent, use the Real-Time PCR primer chosen right to CAR-T product and feminine gender
Shine into row Real-Time PCR, determine that each reaction tube fluorescence signal arrives and set period Ct that threshold value is experienced；
(4) qualitatively judge whether CAR-T product exists VSVG pollution: compare the Ct value of testing sample, the Ct value of each standard curve
And the Ct value of negative control, if testing sample is consistent with the amplification curve of negative control, and when Ct value is more than positive control, recognize
Exist for this sample pollutes without VSVG；If there is notable difference with the amplification curve of negative control in testing sample, and treats test sample
Less than negative control, product Ct value is thought in this sample that VSVG exists and is polluted.
The method that in qualitative detection CAR-T product the most according to claim 1, VSVG sequence is polluted, it is characterised in that institute
The VSVG_F primer chosen as shown in sequence 1, VSVG_R primer for as shown in sequence 2, VSVG_Probe probe such as sequence 3 institute
Show.
The method that in qualitative detection CAR-T product the most according to claim 1, VSVG sequence is polluted, it is characterised in that institute
The pMD2.G plasmid stated includes VSVG gene order.
The method that in qualitative detection CAR-T product the most according to claim 1, VSVG sequence is polluted, it is characterised in that institute
The genomic DNA stated is by using genome DNA extracting reagent kit to extract, and being extracted the genomic DNA concentration obtained is
44.3ng/ μ L, purity 260/280 is between 1.80-1.90.
The method that in qualitative detection CAR-T product the most according to claim 1, VSVG sequence is polluted, it is characterised in that institute
The fluorescent agent stated is 2 × SuperReal PreMix.
The method that in qualitative detection CAR-T product the most according to claim 1, VSVG sequence is polluted, it is characterised in that institute
State Real-Time PCR reaction in reaction system include Template 2 μ L, the Primer Mix 1.5 μ L of 10 μMs, 2 ×
SuperReal PreMix 12.5 μ L, probe 0.5ul, ddH2O 8.5μL。
The method that in qualitative detection CAR-T product the most according to claim 1, VSVG sequence is polluted, it is characterised in that institute
Response procedures in the Real-Time PCR reaction stated is: the first stage, 95 DEG C, 900s, 1 circulation；Second stage: successively
It is 94 DEG C, 60s；70 DEG C, 30s；72,60s；Carry out 40 circulations altogether.
8. the method for quality control being applied to cellular immunization CAR-T treatment, it is characterised in that it includes claim 1-7
The method that in described arbitrary described qualitative detection CAR-T product, VSVG sequence is polluted.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610457173.5A CN106086235A (en) | 2016-06-22 | 2016-06-22 | A kind of method that in qualitative detection CAR T product, VSVG sequence is polluted |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610457173.5A CN106086235A (en) | 2016-06-22 | 2016-06-22 | A kind of method that in qualitative detection CAR T product, VSVG sequence is polluted |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106086235A true CN106086235A (en) | 2016-11-09 |
Family
ID=57237411
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610457173.5A Pending CN106086235A (en) | 2016-06-22 | 2016-06-22 | A kind of method that in qualitative detection CAR T product, VSVG sequence is polluted |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106086235A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104619723A (en) * | 2012-07-13 | 2015-05-13 | 宾夕法尼亚大学董事会 | Methods of assessing the suitability of transduced T cells for administration |
-
2016
- 2016-06-22 CN CN201610457173.5A patent/CN106086235A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104619723A (en) * | 2012-07-13 | 2015-05-13 | 宾夕法尼亚大学董事会 | Methods of assessing the suitability of transduced T cells for administration |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Rechtien et al. | Systems vaccinology identifies an early innate immune signature as a correlate of antibody responses to the Ebola vaccine rVSV-ZEBOV | |
| CN106947838B (en) | African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method | |
| CN106636471B (en) | Multiplex PCR detection kit for simultaneously detecting WSSV, AHPND, EHP and IHHNV of prawns | |
| CN106957927A (en) | African swine fever fluorescence PCR detection reagent, African swine fever fluorescence PCR detection reagent kit and its application | |
| CN110791590A (en) | Dual real-time fluorescence detection primer probe set, kit and method for genes VP72 and CD2V of African swine fever virus | |
| CN103740855B (en) | Based on the eel species discrimination method of DNA bar code | |
| CN105861733A (en) | Primer, probe and method for detecting CAR-T transduction efficiency | |
| Zheng et al. | Population analysis of Streptococcus suis isolates from slaughtered swine by use of minimum core genome sequence typing | |
| CN112739833A (en) | Primer pair, probe and kit for detecting SARS-CoV-2 by utilizing nested RPA technology and application thereof | |
| CN107574261B (en) | Detection primer, detection kit and detection method for detecting hantavirus | |
| Katoh et al. | Rapid HIV-1 disease progression in individuals infected with a virus adapted to its host population | |
| CN109337995B (en) | PCR detection method and kit for eubacterium terrae and subspecies thereof | |
| CN111154903A (en) | Primer group for Brucella RPA amplification, visual detection kit and application | |
| Pflugradt et al. | A novel and effective separation method for single mitochondria analysis | |
| RU2471872C1 (en) | Method for differentiating yersinia pestis strains of various subspecies and biovars by polymerase chain reaction and multilocus sequence typing | |
| CN108998576B (en) | Specific primer pair, probe and detection kit for detecting spring carp virus | |
| CN106086235A (en) | A kind of method that in qualitative detection CAR T product, VSVG sequence is polluted | |
| RU2550257C2 (en) | METHOD OF DIFFERENTIATING TYPICAL AND ATYPICAL STRAINS Yersinia pestis OF MEDIEVAL BIOVAR BY PCR METHOD WITH HYBRIDISATION-FLUORESCENT RECORDING RESULTS | |
| CN105177121A (en) | Novel identification method for sex of pigeon | |
| CN102209794A (en) | Method for the specific detection of low abundance rna species in a biological sample | |
| CN114214455A (en) | Hepatitis B virus DNA rapid quantitative primer probe and CRISPR/Cas12b detection system thereof | |
| AU2019100071A4 (en) | Pcr detection kit for rapidly identifying salmonella of specific serotypes | |
| CN108359746B (en) | Method and primer for detecting cell cross contamination caused by Hela cells | |
| CN113308570A (en) | African swine fever virus nucleic acid extraction-free triple fluorescence quantitative PCR detection composition, method and kit | |
| RU2496882C2 (en) | Method to differentiate strains of plague agent of primary subtype of medieval and antique biovars by method of polymerase chain reaction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161109 |
|
| RJ01 | Rejection of invention patent application after publication |