CN106086075A - The construction method of CXCR4RNAi slow virus carrier - Google Patents

The construction method of CXCR4RNAi slow virus carrier Download PDF

Info

Publication number
CN106086075A
CN106086075A CN201610462279.4A CN201610462279A CN106086075A CN 106086075 A CN106086075 A CN 106086075A CN 201610462279 A CN201610462279 A CN 201610462279A CN 106086075 A CN106086075 A CN 106086075A
Authority
CN
China
Prior art keywords
sequence
plvx
shrna
carrier
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201610462279.4A
Other languages
Chinese (zh)
Other versions
CN106086075B (en
Inventor
胡志坚
陈愉生
李鸿茹
钟雪晶
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fujian Medical University
Original Assignee
Fujian Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fujian Medical University filed Critical Fujian Medical University
Priority to CN201610462279.4A priority Critical patent/CN106086075B/en
Publication of CN106086075A publication Critical patent/CN106086075A/en
Application granted granted Critical
Publication of CN106086075B publication Critical patent/CN106086075B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Abstract

The present invention provides the construction method of a kind of CXCR4RNAi slow virus carrier, by the mRNA complete sequence according to GenBank CXCR4, apply RNA structure 4.4 software that the secondary structure of said target mrna sequence is estimated after BLAST sequence analysis confirms specificity, obtain 19nt target sequence；Then its corresponding two shRNA oligonucleotide strands are synthesized for the design of each target sequence；After the most ring-type empty plasmid enzyme action, endonuclease bamhi connects PLVX.1 carrier and shRNA oligonucleotide double-strand, connect the recombinant vector formed, connect product and convert fresh competent cell E.coli DH5 α, choose positive colony after 37 DEG C of cultivation 16h and carry out bacterium colony PCR qualification, after sequencing result checking construction of recombinant plasmid success, extract recombiant plasmid.

Description

The construction method of CXCR4RNAi slow virus carrier
Technical field
The invention belongs to genetic engineering field, be specifically related to the construction method of a kind of CXCR4RNAi slow virus carrier.
Background technology
Current worldwide lung cancer morbidity rate rises year by year, the most about dies from pulmonary carcinoma more than a million people, Becoming one of most common cause of the death of malignant tumor, pulmonary carcinoma about 30% patient occurs cranium brain metastes, metastatic encephaloma Natural Survival in the course of disease Time is 1～3 months, is one of malignant tumor severe complication, and cranium brain metastes is one of major reason of lung cancer death.Chemotactic The factor is that a class has the chemotactic cytokine of biochemistry, and wherein SDF-1 and specific receptor CXCR4 thereof is thin in tumor The migration of born of the same parents played an important role in invasion and attack.The signal conduction of research display SDF-1 and receptor CXCR 4 composition thereof is logical Road may be in close relations with the generation of pulmonary carcinoma, development and cranium brain metastes.In nonsmall-cell lung cancer early diagnosis and therapy, invasion and attack It is the principal element of Treatment for Non-small Cell Lung poor effect with transfer.In order to preferably study CXCR4/SDF-1 biological axis In non-small cell lung cancerous invasion and the effect in shifting particularly brain metastes, this research uses the pulmonary carcinoma with brain metastes potential thin Born of the same parents PC-9 builds cell model, by design for the shRNA fragment of CXCR4 gene order, builds slow virus shRNA interference table Reach carrier, thus the expression of specific targeted silent lung carcinoma cell CXCR4 gene.The spy of the shRNA interference of lentivirus mediated Point is efficient, stable and silence durations is long, for research SDF-1/CXCR4 biological axis further at nonsmall-cell lung cancer cranium Effect in brain metastes provides instrument.
Summary of the invention
It is an object of the invention to provide the construction method of a kind of CXCR4RNAi slow virus carrier.
For achieving the above object, the present invention adopts the following technical scheme that
CXCR4RNAi slow virus carrier, described carrier contains CXCR4 genetic fragment.
The construction method of CXCR4RNAi slow virus carrier, includes the following:
(1) interference sequence design: according to the mRNA complete sequence of GenBank CXCR4, confirm specificity through BLAST sequence analysis The secondary structure of said target mrna sequence is estimated by rear application RNA structure 4.4 software, obtains 19nt target sequence；Then Its corresponding two shRNA oligonucleotide strands are synthesized for the design of each target sequence；Design a pair control sequence siRNAc simultaneously；
(2) structure of Lentiviral and qualification: empty carrier pGC-LV is with GFP labelling, by PLVX-shRNA-PURO Vector ring-type empty plasmid BamHAnd EcoRRestricted enzyme carries out double digestion, and reclaims PLVX-SHRNA-PURO Vector endonuclease bamhi, connects empty PLVX.1 carrier (from clontech company) and shRNA oligonucleotide double-strand, connects and formed Recombinant vector, connect product and convert fresh competent cell E.coli DH5 α, cultivate for 37 DEG C and choose positive colony after 16h and carry out Bacterium colony PCR identifies, after sequencing result checking construction of recombinant plasmid success, extracts recombiant plasmid；
(3) primer that QPCR primer is vector multiple cloning site two ends of QPCR screening shRNA:CXCR4 gene, cultivates 293 thin Born of the same parents, add plasmid and lipo2000 complex in six orifice plate 293 cells, extract the RNA of each group of cell, by RNA reverse transcription be CDNA, utilizes cDNA for template, utilizes the relative expression quantity of described QPCR primer detection CXCR4 gene, and fluorescent quantitation detection is each Group primer；PCR reaction condition: 95 DEG C of 30s, 1 circulation, 55 DEG C of 30s40 circulations, 95 DEG C of 5s, 60 DEG C of 1min, 95 DEG C of 15s.
Described in step (3), QPCR primer sequence is: Primer(+): 5 ' GGAGAGTTGTAGGATTCTAC-3 ', Primer(-):5’-CCTCGGTGTAGTTATCTGAAG-3’。
The ring-type empty plasmid of PLVX-shRNA-PURO vector is to be transformed by clontech company carrier PLVX-shRNA2 , concrete mode is: amplification puro expression cassette, is cloned into by puro expression cassette after PLVX-shRNA2 carrier ZSgreen.Public The green hyperfluorescence albumen recognized, those skilled in the art can according to said method obtain this plasmid.
It is an advantage of the current invention that:
Slow virus carrier is compared with retroviral vector, adenovirus vector, gland relevant viral vector etc., has following excellent Point: (1) can infect division cells and nondividing phase cell, such as the nondividing phase such as nervous system, hemopoietic system cell, immunity is anti- Should be less；(2) transferable genetic fragment is relatively big, can be inserted into the genetic fragment of about 10 kb；(3) virus mutation with have duplication The viral probability of ability is less, greatly reduces virus (the replication competent of replication capacity Virus, RCV)；(4) genes of interest and host genome are by integrating, and can realize the expression of genes of interest long period.Gene RNA perturbation technique in treatment has become the new method of oncotherapy, and tumor genes of interest can be shifted safely by slow virus carrier To body.By the RNAi technology of lentivirus-mediated, find the influence factor relevant to disease, and attempt thus setting about grinding The method studying carefully treatment, reaches to treat the effect of disease.Higher safety, validity and reliability is should also ensure that for this, and Progressively enter into clinical experimental stage from experiment in vitro and zoopery, it is believed that this technology is by research field from now on and clinic Actual application aspect has broader prospect.
Accompanying drawing explanation
Fig. 1 CXCR4-shRNA positive colony PCR identifies figure, 1: negative control (ddH2O)；2:Marker；3-8: CXCR4-shRNA clones.
Fig. 2 respectively organize in 293 cells CXCR4 express change (, n=3), *P < 0.01,**P =0.192 >0.05)。
Detailed description of the invention
1 materials and methods
1.1 material
Human lung adenocarcinoma PC9 cell strain is purchased from Yu Bo bio tech ltd, Shanghai.Cell DMEM 90%, Fetal Bovine Serum 10% culture medium, at 37 DEG C, 5%CO2Cell culture incubator in cellar culture.CXCR4 rabbit polyclonal antibody, GAPDH Mus multi-resistance is purchased from abcam company, and the goat antirabbit two of horseradish peroxidase-labeled is anti-purchased from abcam company
1.2 method
1.2.1 interference sequence design
MRNA complete sequence (Accession No:NM_003467) according to GenBank CXCR4, demonstrate,proves through BLAST sequence analysis Apply RNA structure 4.4 software that the secondary structure of said target mrna sequence is estimated after real specificity, obtain 3 19nt Target sequence.Then its corresponding two shRNA oligonucleotide strands are synthesized for the design of each target sequence.Design a pair comparison simultaneously Sequence siRNAc.Then two shRNA oligonucleotide strands are synthesized according to the sequential design of siRNA.Design as follows: BamHEnzyme Cut site+19 nt target nucleotide sequences+loop-stem structure (TTCAAGAGA)+target complement sequence sequence+RNA PolyPolymerase Transcription pausing site (TTTTTT)+EcoRSix regions of restriction enzyme site, be respectively designated as shRNA1, shRNA2, shRNA3, And shRNAc, particular sequence is shown in Table 1.ShRNA oligonucleotide chain is synthesized by Shanghai Sheng Gong company.
3 specificity SiRNA target sequences of table 1. CXCR4 gene
1.2.2 the structure of Lentiviral and qualification
Empty carrier pGC-LV is with GFP labelling.By ring-type for PLVX-shRNA-PURO vector empty plasmid BamHWith EcoR Restricted enzyme carries out double digestion, and reclaims PLVX-SHRNA-PURO vector endonuclease bamhi.Connect sky PLVX.1 carrier and shRNA oligonucleotide double-strand, connect the recombinant vector formed and be respectively labeled as: PLVX-CXCR4shRNA1, PLVX-CXCR4shRNA2、PLVX-CXCR4shRNA3、PLVX-CXCR4shRNAc.Connect product and convert fresh competent cell E.coli DH5α.Choose positive colony after 37 DEG C of cultivation 16h and carry out bacterium colony PCR qualification, serve Hai Shenggong and carry out DNA sequencing qualification. After sequencing result checking construction of recombinant plasmid success, extract recombiant plasmid.
1.2.3 the shRNA of QPCR screening optimum jamming effect
The primer that QPCR primer is vector multiple cloning site two ends of CXCR4 gene, sequence is Primer(+): 5, ' GGAGAGTTGTAGGATTCTAC3’, Primer (-): 5’CCTCGGTGTAGTTATCTGAAG3’,
Cultivate 293 cells, by plasmid (pLVX-CXCR4shRNA1, pLVX-CXCR4shRNA2, pLVX-CXCR4shRNA3, PLVX-acGFP-C1) add in six orifice plate 293 cells with lipo2000 complex, extract the RNA of each group of cell, RNA is inverted Record is cDNA, utilizes cDNA for template, and the relative expression quantity of detection CXCR4 gene, fluorescent quantitation detects each group of primer.PCR is anti- Answer condition: 95 DEG C of 30s, 1 circulation, 55 DEG C of 30s40 circulate, 95 DEG C of 5s, 60 DEG C of 1min, 95 DEG C of 15s.With 2-△△CtValue represents The relative expression levels of CXCR4 gene mRNA.
1.2.4 slow virus packaging
According to the result of interference screening, by the interference carrier PLVX-CXCR4-shRNA1 coated plate of optimum jamming effect, 37 DEG C of cultivations Overnight, picking list bacterium colony, it is inoculated in the LB culture medium of 200ml, 250rpm, 37 DEG C are shaken bacterium overnight incubation, large quantity extracting plasmid. Mass propgation 293T cell, day before transfection, with the 293T cell of trypsinization exponential phase, with without antibiotic DMEM complete medium inoculation 293FT cell in 60 mm plates, 2 × 106 cells of each ware inoculating cell, 37 DEG C, 5% 24 h are cultivated in CO2 incubator.By shRNAc, CXCR4-shRNA respectively with slow virus packaging plasmid cotransfection 293T cell. 48 h collect the 293T cell supernatant after transfection, and filtrate concentrates after ultracentrifugation, remove supernatant, retain precipitation below, add Enter appropriate PBS lytic virus precipitation, be saved in after subpackage in virus pipe ,-80 DEG C long-term preservations.
1.2.5 virus titer measures
Cultivating 293 cells, seed cells into 48 orifice plates, 105, every hole cell, 37 DEG C, 5%CO2 continues to cultivate 18h.Take 20 μ l Viral dilution to the DMEM culture medium of 200 μ l, 10 virus dilution i.e. (10 successively-3、10-4、10-5、10-6、10-7), mix dilute The virus released, is added separately in 48 holes, every hole 100 μ l, 37 DEG C, and 5%CO2 continues to cultivate 48h.Fluorescence inverted microscope is utilized to examine Survey the quantity adding up each pore area fluorecyte, in conjunction with extension rate calculating virus titer: titre (TU/m1)=fluorecyte number The effective extension rate of X.
1.2.6 the foundation of interference cell strain is stablized
Infect first 1 day trophophase of taking the logarithm PC9 cell in good condition by every hole 5 x105Individual it is inoculated in 6 orifice plates.During infection, Dilute slow virus according to MOI=100, hole is separately added into containing 8 mg L-12 kinds of dilution restrovirus liquid 1mL of polybrene, simultaneously Set blank target cell as comparison.After cultivating 16h, it is replaced by fresh DMEM complete medium 2mL and continues to cultivate, 48h Rear fluorescence microscopy Microscopic observation efficiency of infection.Single cell suspension is made, according to every ware after metainfective cell trypsinization The density of 1000 is inoculated in the culture dish of 10cm, cultivates to forming monoclonal cell group, selects monoclonal cell to enter again Row clone, then picking sufficient amount monoclonal cell carries out amplification cultivation, prepares for next step detection.Obtain is stable dry Disturb cell and be respectively designated as PC9/CXCR4-shRNA, the named PC9/shRNAc of negative control cell.
1.2.7 QPCR detects cell PC-9mRNA jamming effectiveness
Collect PC9/CXCR4-shRNA, PC9/shRNAc cell, by QIAGEN Rneasy Mini kit test kit description Experimental technique and step extract cell total rna, and according to Reverse Transcription box (PrimeScript RT reagent Kit) Carry out cDNA reverse transcription synthesis.With this cDNA as template, application PCR kit for fluorescence quantitative carries out PCR amplification, CXCR4 and GAPDH gene (internal reference) primer is by Sangon Biotech's design synthesis.CXCR4:Primer (+): 5, GGAGAGTTGTAGGATTCTAC3,,Primer(-):5,CCTCGGTGTAGTTATCTGAAG3,.PCR reacts bar Part: 95 DEG C of 30s, 1 circulation, 55 DEG C of 30s40 circulations, 95 DEG C of 5s, 60 DEG C of 1min, 95 DEG C of 15s.CXCR4 base is represented with 2^-ddCt value Relative expression levels because of mRNA.
1.2.8 Western blot detects cell PC-9 albumen jamming effectiveness
Collect PC9/CXCR4-shRNA, PC9/shRNAc cell, add cell pyrolysis liquid and crack 10 min on ice, take on albumen Clear by BCA determination of protein concentration concentration.Take 50～80g protein and carry out 10%SDS PAGE electrophoresis, the protein after separation Electrotransfer, on pvdf membrane, closes 2 h by the confining liquid room temperature containing 5% defatted milk powder；The rabbit adding 1:2000 dilution is anti-human CXCR4 polyclonal antibody and the mouse anti human GAPDH monoclonal antibody of 1:2000 dilution, 4 DEG C of reactions are overnight；After TBS washes film, It is separately added into two anti-(goat antirabbit of HRP labelling or goat anti-mouse IgG) of 1:3000 dilution, room temperature reaction 2h；TBS washes After washing, adding chemical illuminating reagent, cold CCD imaging system exposes, develops and fixing.Scanning film, is carried out each protein band Gray value is analyzed, and represents CXCR4 egg with the ratio of CXCR4 protein band gray value Yu internal reference GAPDH protein band gray value White relative expression levels.
2 results
The PCR of 2.1 recombinant slow virus plasmids and order-checking are identified
When PCR identifies recombinant slow virus plasmid, the positive colony PCR fragment size connecting into shRNA fragment is 200bp.By PCR Product carries out electrophoresis, and the 1st, 2,3 pairs of target sequence results all show positive colony (Fig1).The positive gram from each target sequence Respectively selecting one in grand to check order, result test result display sequence is correct.
The shRNA screening of 2.2 optimum jamming effects
The mrna expression level of the CXCR4 in each group 293 cells is as in figure 2 it is shown, result shows: by one factor analysis of variance, Compared with blank group, the expression of the CXCR4 of 293 cells in experimental group is all remarkably decreased (P=0.0001 < 0.01), CXCR4 expression change not statistically significant (P=0.192 > 0.05) of 293 cells of negative control vector group, explanation CXCR4-shRNA carrier can significantly lower the expression of CXCR4mRNA in 293 cells, and CXCR4-shRNA1 carrier is lowered the brightest Aobvious.
The foregoing is only presently preferred embodiments of the present invention, all impartial changes done according to scope of the present invention patent with Modify, all should belong to the covering scope of the present invention.
SEQUENCE LISTING
<110>Medical University Of Fujian
<120>construction method of CXCR4RNAi slow virus carrier
<130> 10
<160> 10
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
ggagagttgt aggattctac 20
<210> 2
<211> 21
<212> DNA
<213>artificial sequence
<400> 2
cctcggtgta gttatctgaa g 21
<210> 3
<211> 59
<212> DNA
<213>shRNA1(Top)
<400> 3
gatccggatc agcatcgact ccttttcaag agaaaggagt cgatgctgat ccttttttg 59
<210> 4
<211> 59
<212> DNA
<213>shRNA1(Bottom)
<400> 4
aattcaaaaa aggatcagca tcgactcctt tctcttgaaa aggagtcgat gctgatccg 59
<210> 5
<211> 59
<212> DNA
<213>shRNA2(Top)
<400> 5
gatccggatc agtatataca cttcttcaag agagaagtgt atatactgat ccttttttg 59
<210> 6
<211> 59
<212> DNA
<213>shRNA2(Bottom)
<400> 6
aattcaaaaa aggatcagta tatacacttc tctcttgaag aagtgtatat actgatccg 59
<210> 7
<211> 59
<212> DNA
<213>shRNA3(Top)
<400> 7
gatccgcaag gcagtccatg tcatttcaag agaatgacat ggactgcctt gcttttttg 59
<210> 8
<211> 59
<212> DNA
<213>shRNA3(Bottom)
<400> 8
aattcaaaaa agcaaggcag tccatgtcat tctcttgaaa tgacatggac tgccttgcg 59
<210> 9
<211> 59
<212> DNA
<213>shRNAc(Top)
<400> 9
ccggtgcttc gacatttaac caatttcaag agaattggtt aaatgtcgaa gcttttttg 59
<210> 10
<211> 59
<212> DNA
<213>shRNAc(Bottom)
<400> 10
aattcaaaaa agcttcgaca tttaaccaat tctcttgaaa ttggttaaat gtcgaagca 59

Claims (4)

  1. The construction method of 1.CXCR4RNAi slow virus carrier, it is characterised in that: described construction method includes the following:
    (1) interference sequence design: according to the mRNA complete sequence of GenBank CXCR4, confirm specificity through BLAST sequence analysis The secondary structure of said target mrna sequence is estimated by rear application RNA structure 4.4 software, obtains 19nt target sequence；Then Its corresponding two shRNA oligonucleotide strands are synthesized for the design of each target sequence；
    (2) structure of Lentiviral and qualification: empty carrier pGC-LV is with GFP labelling, by PLVX-shRNA-PURO The ring-type empty plasmid of vector, uses BamHAnd EcoRRestricted enzyme carries out double digestion, and reclaims PLVX-SHRNA-PURO Vector endonuclease bamhi, connects empty PLVX.1 carrier and shRNA oligonucleotide double-strand, connects the recombinant vector formed, connect and produce Thing converts fresh competent cell E.coli DH5 α, chooses positive colony and carry out bacterium colony PCR qualification, order-checking knot after 37 DEG C of cultivation 16h After fruit checking construction of recombinant plasmid success, extract recombiant plasmid pLVX-CXCR4shRNA；
    (3) primer that QPCR primer is vector multiple cloning site two ends of QPCR screening shRNA:CXCR4 gene, cultivates 293 thin Born of the same parents, add plasmid pLVX-CXCR4shRNA and the lipo2000 complex of acquisition in six orifice plate 293 cells, extract each group thin The RNA of born of the same parents, is cDNA by RNA reverse transcription, utilizes cDNA for template, utilizes the relative of described QPCR primer detection CXCR4 gene Expression, fluorescent quantitation each group of primer of detection；PCR reaction condition: 95 DEG C of 30s, 1 circulation, 55 DEG C of 30s40 circulations, 95 DEG C of 5s, 60 DEG C 1min, 95 DEG C of 15s.
  2. The construction method of CXCR4RNAi slow virus carrier the most according to claim 1, it is characterised in that: institute in step (3) Stating QPCR primer sequence is: Primer(+): 5 ' GGAGAGTTGTAGGATTCTAC-3 ',Primer(-):5’- CCTCGGTGTAGTTATCTGAAG-3’。
  3. The construction method of CXCR4RNAi slow virus carrier the most according to claim 1, it is characterised in that: described PLVX- The ring-type empty plasmid of shRNA-PURO vector is that carrier PLVX-shRNA2 transformation obtains.
  4. 4. construction method as claimed in claim 1 builds the carrier obtained.
CN201610462279.4A 2016-06-23 2016-06-23 The construction method of CXCR4RNAi slow virus carrier Active CN106086075B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610462279.4A CN106086075B (en) 2016-06-23 2016-06-23 The construction method of CXCR4RNAi slow virus carrier

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610462279.4A CN106086075B (en) 2016-06-23 2016-06-23 The construction method of CXCR4RNAi slow virus carrier

Publications (2)

Publication Number Publication Date
CN106086075A true CN106086075A (en) 2016-11-09
CN106086075B CN106086075B (en) 2019-08-06

Family

ID=57253312

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610462279.4A Active CN106086075B (en) 2016-06-23 2016-06-23 The construction method of CXCR4RNAi slow virus carrier

Country Status (1)

Country Link
CN (1) CN106086075B (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108424934A (en) * 2018-04-16 2018-08-21 和元生物技术（上海）股份有限公司 A kind of slow virus CAG-CMV double-promoters transformation vector construction and application
CN111235151A (en) * 2020-03-13 2020-06-05 广州百暨基因科技有限公司 shRNA of CXCR4 gene and application thereof
CN113684229A (en) * 2021-08-06 2021-11-23 江西省科学院生物资源研究所 Green fluorescent protein and porcine intestinal epithelial cell line construction method of porcine CDX2

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003102131A2 (en) * 2002-04-22 2003-12-11 Sirna Therapeutics Inc. Nucleic acid mediated disruption of hiv fusogenic peptide interactions
US20060052327A1 (en) * 2004-09-07 2006-03-09 Lin Liu Cell specific gene silencing using cell-specific promoters in vitro and in vivo
CA2767972A1 (en) * 2009-07-15 2011-01-20 Calimmune Inc. Dual vector for inhibition of human immunodeficiency virus
CN103501818A (en) * 2011-01-13 2014-01-08 巴塞罗那自治大学 Methods and reagents for efficient and targeted delivery of therapeutic molecules to cxcr4 cells
CN105431521A (en) * 2013-02-28 2016-03-23 哈佛学院校长同事会 Methods and compositions for mobilizing stem cells
CN105586358A (en) * 2007-05-29 2016-05-18 克里斯多佛·B·里德 Methods for production and uses of multipotent cell populations

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003102131A2 (en) * 2002-04-22 2003-12-11 Sirna Therapeutics Inc. Nucleic acid mediated disruption of hiv fusogenic peptide interactions
US20060052327A1 (en) * 2004-09-07 2006-03-09 Lin Liu Cell specific gene silencing using cell-specific promoters in vitro and in vivo
CN105586358A (en) * 2007-05-29 2016-05-18 克里斯多佛·B·里德 Methods for production and uses of multipotent cell populations
CA2767972A1 (en) * 2009-07-15 2011-01-20 Calimmune Inc. Dual vector for inhibition of human immunodeficiency virus
CN103501818A (en) * 2011-01-13 2014-01-08 巴塞罗那自治大学 Methods and reagents for efficient and targeted delivery of therapeutic molecules to cxcr4 cells
CN105431521A (en) * 2013-02-28 2016-03-23 哈佛学院校长同事会 Methods and compositions for mobilizing stem cells

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108424934A (en) * 2018-04-16 2018-08-21 和元生物技术（上海）股份有限公司 A kind of slow virus CAG-CMV double-promoters transformation vector construction and application
CN111235151A (en) * 2020-03-13 2020-06-05 广州百暨基因科技有限公司 shRNA of CXCR4 gene and application thereof
CN113684229A (en) * 2021-08-06 2021-11-23 江西省科学院生物资源研究所 Green fluorescent protein and porcine intestinal epithelial cell line construction method of porcine CDX2

Also Published As

Publication number Publication date
CN106086075B (en) 2019-08-06

Similar Documents

Publication Publication Date Title
CN107828738A (en) A kind of dnmt rna deficiency Chinese hamster ovary celI system and preparation method and application
CN107893076A (en) CRISPR Cas9 targeting knock outs human breast cancer cell RASSF2 genes and its specific sgRNA
CN106591306B (en) Application of the siRNA of targeting interference tumour PTN-PTPRZ1 access in immunotherapy of tumors
CN108165549B (en) Universal expression framework of artificial circular RNA and application thereof
CN105586320A (en) Recombinant adeno-associated virus as well as construction method and application thereof
CN106191067B (en) Circular rna circ-NFATC3 and application thereof
CN108486060A (en) It is a kind of to be used to treat excretion body of tumour and its preparation method and application
CN106086075B (en) The construction method of CXCR4RNAi slow virus carrier
CN107760784A (en) Circular rna circ FOXP1 purposes
Li et al. Establishment of a neuroendocrine prostate cancer model driven by the RNA splicing factor SRRM4
CN107828888A (en) Circular rna circ PTPRA purposes
CN109055374A (en) Specificity inhibits shRNA and the application of OCT1 gene expression
CN102747096B (en) Gene search vector, random gene mutation control method and application thereof
CN108660212A (en) Application of the WDR1 genes in preparing Treatment for Non-small Cell Lung and detecting product
CN110317878B (en) Long-chain non-coding RNA for diagnosis and treatment monitoring of bladder cancer and application thereof
CN107217071A (en) A kind of adenovirus of recombinant rat phospholipase C γ 2, construction method and its application
CN111850123A (en) PCR reagent for detecting gene expression of cell angiogenesis signal pathway and application thereof
CN102747038B (en) NOX4 knock-down A375 stably-transfected cell line and construction method thereof
CN109364249A (en) Application using MANF as the substance of target spot in preparation treatment intrahepatic cholangiocarcinoma product
CN108465108A (en) A kind of specific gene target spot prevented or treat glioma
CN108743521A (en) A kind of RNA nano-hydrogels and its preparation method and application for targeted therapy of lung cancer
CN104630221B (en) Suppress shRNA and its recombinant vector and the application of growth of tumour cell
CN107858352A (en) A kind of shRNA cluster sequences and its expression vector and purposes
CN106729756A (en) Application of the biomarker as target in adenocarcinoma of lung diagnosis and treatment
CN103952406B (en) The siRNA of targeting STAT3 gene of suppression people&#39;s malignant glioma propagation and expression vector thereof and application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant