CN106086066A - A kind of histone deacetylases gene converts willow and improves the method for its salt tolerance and the application of this gene - Google Patents
A kind of histone deacetylases gene converts willow and improves the method for its salt tolerance and the application of this gene Download PDFInfo
- Publication number
- CN106086066A CN106086066A CN201610716123.4A CN201610716123A CN106086066A CN 106086066 A CN106086066 A CN 106086066A CN 201610716123 A CN201610716123 A CN 201610716123A CN 106086066 A CN106086066 A CN 106086066A
- Authority
- CN
- China
- Prior art keywords
- willow
- gene
- histone deacetylases
- pcr
- poplar
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
- C12N9/80—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in linear amides (3.5.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
- C12Y305/01—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in linear amides (3.5.1)
- C12Y305/01098—Histone deacetylase (3.5.1.98), i.e. sirtuin deacetylase
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
A kind of histone deacetylases gene converts willow and improves the method for its salt tolerance and the application of this gene, and it relates to the application of a kind of method improving its salt tolerance and this gene.The method of the present invention: obtain comospore poplar histone deacetylases gene by PCR method, construct plant expression vector, be transformed in Agrobacterium tumefaciems；It is transformed in willow, and has obtained transgenic poplar strain；Transgenic poplar is carried out PCR qualification, i.e. completes.This gene is for improving the salt tolerance of willow.The research of comospore poplar histone deacetylases gene is found by the present invention, and it has good resistance to salt stress characteristic, therefore, have good using value, the resistance to salt stress of willow is had the highest using value.
Description
Technical field
The present invention relates to a kind of method improving its salt tolerance.
Background technology
Salt damage is the significant problem of the urgent need solution that agricultural faces with production of forestry.In the world, due to excessively
Cut cut down trees at random, expand cultivated area, the factor such as unreasonable irrigation causes salt lick area and constantly expands.Under normal circumstances, woody
Plant has lowering of watertable because there being the root system of prosperity, prevents burn into from improving the function of microecological environment, coerces soil salt
The toleration compeled is higher than crops.Therefore, the highly effective method solving soil salinization problem is by soil
Improvement, conceding the land to forestry.Willow is a kind of xylophyta that countries in the world are extensively planted, and is not only reproducting tree species, is also important
Industrial cut stock seeds.Owing to its growth cycle is short, genome is little, xylophyta can be had become as grind with features such as asexual propagation
The model plant studied carefully.The willow of Different climate region growing, its physiological property and the toleration of salt stress is also had the biggest difference
Different.Therefore, improving salt tolerance is to cultivate high-quality and an important method of the anti-new varieties of poplar of height.
Histon deacetylase (HDAC) (histone deacetylase, HDAC) catalysis DNA methylase inhibitor, with histone
Acetyltransferase (histone acetyltransferase, HAT) effect regulation acetylation of histone state jointly, and then
Affect transcribing of chromatinic structure and gene, multiple vital movement has highly important regulating and controlling effect.HAT is by second
Acetyl group on acyl-CoA is transferred on the lysine residue of histone, and this acetylation can weaken histone and band
Interaction between the DNA of negative charge, makes chromatin Structure be in extended configuration；On the other hand nucleosome surface can be changed
The combination of structure, beneficially transcription regulaton factor.Therefore, it is considered that HAT is relevant with the transcriptional activation of gene.And the work of HDAC
With being the acetyl group on istone lysine residue to be removed, cause chromatin Structure condensing, be unfavorable for transcription factor or turn
Record regulatory factor is combined with DNA.It is, therefore, usually considered that HDAC is relevant with the suppression of gene or silence.In recent years, histone goes second
The functional study of acylase (HDAC) increasingly comes into one's own.At present, xylophyta HDAC environment stress (as high salt, low temperature,
Arid) reaction in function the most unclear.To xylophyta HDAC biological function explore in salt stress reacts, for cultivating high-quality
New varieties of poplar anti-with height is significant.
Summary of the invention
In order to solve the problem of above-mentioned existence, the invention provides a kind of histone deacetylases gene and convert willow
84K poplar the method improving its salt tolerance, utilize the method can significantly improve the willow toleration to high salt, and to other property
Shape not adversely affects.
The present invention uses following steps to solve the problems referred to above:
Step one: obtain comospore poplar histone deacetylases gene, wherein, drawing used by PCR reaction by PCR method
Thing is:
Primer 1:5'gctctagaatggacactggtggcaactc 3'；
Primer 2: 5 ' ggggtacctcatgacttggagaacatct 3'；
Step 2: comospore poplar histone deacetylases gene step one obtained is inserted in plasmid pROK2, builds
Go out plant expression vector, the plant expression vector of structure is transformed in Agrobacterium tumefaciems EHA105；
Step 3: use agrobacterium-mediated transformation by this histone deacetylases gene genetic transformation to willow, and
Arrive transgenic poplar strain；
Step 4: the transgenic poplar blade obtaining step 3 carries out DNA extraction and PCR identifies, and transgenic poplar
Leaves sheet RNA extract and Real-time PCR identify, qualified after, i.e. complete described histone deacetylases gene
Convert the method that willow improves its salt tolerance.
The application of a kind of histone deacetylases gene of the present invention, it is for improving the salt tolerance of willow, described
Histone deacetylases gene is to adopt to obtain with the aforedescribed process, described histone deacetylases gene gene order
As shown in sequence table Seq ID No:1.
The present invention comprises following beneficial effect:
Willow resistance physiological and biochemical analysis after the method using the present invention processes shows: transgenic poplar is to high salt
Toleration significantly improves.300mM NaC1 is used to process willow, when salt stress processes 5 days, transgenic poplar well-grown, rather than
There is serious salting stain (Fig. 4) in transgenic poplar blade, and salting stain area is relatively big, and even blade is completely withered (Fig. 5, Fig. 6).
When NaC1 processes 10 days, nontransgenic plants blade is the most withered, and transgenic poplar is relatively light (Fig. 7) by salt damage, transgenic
Plant fresh weight (Fig. 8) and survival rate (Fig. 9) are significantly higher than nontransgenic plants.These results show resistance to salt of transgenic poplar
Significantly improved by property.
The research of comospore poplar histone deacetylases gene is found by the present invention, and it has good resistance to salt stress characteristic,
Therefore, there is good using value, the resistance to salt stress of willow is had the highest using value.
Accompanying drawing explanation
Fig. 1 shows the plant expression vector figure carrying willow histone deacetylases gene；
Fig. 2 shows transgenic poplar PCR qualification result figure, and M is DNAmarker, and 1 is that positive control (carries willow
The plant expression vector of HDAC gene), 2-14 is different transgenic poplar strain, and 15 and 16 is non-transgenic poplar, and 17 are
Negative control (water)；
Fig. 3 shows transgenic poplar Real-time PCR qualification result figure, and WT is non-transgenic poplar, and 1-13 is not
Same transgenic poplar strain；
Fig. 4 shows the transgenic poplar growing state figure when salt treatment 5 days, and WT is non-transgenic poplar, and Tr represents
Transgenic poplar；
Fig. 5 shows that the blade of transgenic poplar salt damage grade different with non-transgenic willow (can under condition of salt stress
It is divided into 0,1 and 2 Three Estates)；
Fig. 6 shows transgenic poplar and hundred shared by the grade blades such as the non-transgenic different salt damagies of willow under condition of salt stress
Point rate, A be WT be non-transgenic poplar, B be Tr-1, C be Tr-2 be different transgenic poplar strains；
Fig. 7 shows the transgenic poplar growing state figure when salt treatment 10 days, and a is transgenic poplar and non-transgenic
Willow growing state under collating condition (non-salt treatment), b is that transgenic poplar and non-transgenic willow are in salt treatment condition
Under growing state, A be WT be non-transgenic poplar, B be Tr-1, C be Tr-2 be different transgenic poplar strains；
Fig. 8 shows transgenic poplar measurement result figure of plant fresh weight when salt treatment 10 days, A be WT be non-transgenic
Willow, B be Tr-1, C be Tr-2 be different transgenic poplar strains；
Fig. 9 shows transgenic poplar survival rate figure of plant when salt treatment 10 days, A be WT be non-transgenic poplar, B
For Tr-1, C be Tr-2 be different transgenic poplar strains.
Detailed description of the invention
Detailed description of the invention one: a kind of histone deacetylases gene of present embodiment converts willow and improves its salt tolerant
The method of property, it follows the steps below:
Step one: obtain comospore poplar histone deacetylases gene, wherein, drawing used by PCR reaction by PCR method
Thing is:
Primer 1:5'gctctagaatggacactggtggcaactc 3'；
Primer 2: 5 ' ggggtacctcatgacttggagaacatct 3'；
Step 2: comospore poplar histone deacetylases gene step one obtained is inserted in plasmid pROK2, builds
Go out plant expression vector, the plant expression vector of structure is transformed in Agrobacterium tumefaciems EHA105；
Step 3: use agrobacterium-mediated transformation by this histone deacetylases gene genetic transformation to willow, and
Arrive transgenic poplar strain；
Step 4: the transgenic poplar blade obtaining step 3 carries out DNA extraction and PCR identifies, and transgenic poplar
Leaves sheet RNA extract and Real-time PCR identify, qualified after, i.e. complete described histone deacetylases gene
Convert the method that willow improves its salt tolerance.
Detailed description of the invention two: present embodiment is unlike detailed description of the invention one: in step one, PCR reacts
PCR system is as follows:
PCR amplification condition: 94 DEG C of denaturations 5min；94 DEG C of degeneration 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min, 30
Circulation；Last 72 DEG C extend 10min.
Other is identical with detailed description of the invention one.
Detailed description of the invention three: present embodiment is unlike detailed description of the invention one: in step 4, PCR identifies
PCR system is as follows:
PCR amplification condition: 94 DEG C of denaturations 5min；94 DEG C of degeneration 30s, 58 DEG C of annealing 30s, 72 DEG C extend 60s, and 35 are followed
Ring；Last 72 DEG C extend 10min.
Other is identical with detailed description of the invention one.
Primer used by present embodiment is as follows:
5'ggctacaccattcgaaatgtc 3'
5'tctagcatgcccagaacttc 3'。
Detailed description of the invention four: present embodiment is unlike detailed description of the invention one: Real-time PCR identifies
PCR system is as follows:
PCR amplification condition: 95 DEG C of denaturations 3min；95 DEG C of degeneration 30s, 60 DEG C of annealing 30s, 72 DEG C extend 30s, and 44 are followed
Ring.
Other is identical with detailed description of the invention one.
Primer used by present embodiment is as follows:
5'gcaagccattaccaggcagagtc 3'
5'cacttgcattctcggctattgttgt 3。
Detailed description of the invention five: the application of a kind of histone deacetylases gene of present embodiment, it is used for improving
The salt tolerance of willow, described histone deacetylases gene is to adopt to obtain with the aforedescribed process, and described histone goes
Acetylase gene sequence is as shown in sequence table Seq ID No:1.
Detailed description of the invention six: present embodiment is unlike detailed description of the invention five: described willow is 84K poplar.
Other is identical with detailed description of the invention five.
Present invention is not limited only to the content of the respective embodiments described above, one of them or the group of several detailed description of the invention
Contract sample can also realize the purpose of invention.
By following example checking beneficial effects of the present invention:
Embodiment 1
The present embodiment is carried out as follows:
The first step: obtaining comospore poplar histone deacetylases gene by PCR method, its coding region total length is
Primer used by 1506bp, PCR reaction is:
5'gctctagaatggacactggtggcaactc 3'
5’ggggtacctcatgacttggagaacatct 3'
Second step: comospore poplar histone deacetylases gene is cloned in the multiple clone site of pROK2 carrier, and uses
This plant expression vector is transformed in Agrobacterium tumefaciems EHA105 by freeze-thaw method；
3rd step: use agrobacterium-mediated transformation by this histone deacetylases gene genetic transformation to willow 84K poplar.
Method is to carry Agrobacterium EHA105 and poplar leaf (1.5cm × 1.5cm) training altogether of this histone deacetylases gene
Support 2 days, be then transferred into the enterprising row filter of MS culture medium containing 250mg/L cephamycin and 30mg/L kanamycin, every 10
It changes a subculture, it is thus achieved that the adventitious bud of regeneration；Adventitious bud is containing 200mg/L cephamycin and 40mg/L kanamycin
Regenerate root in 1/2MS culture medium, so far obtain complete transfer-gen plant.
4th step: transfer-gen plant is carried out PCR and real-time PCR and identifies: (1) extracts transgenic poplar blade
DNA carries out PCR qualification, and result shows that transgenic is own through being incorporated in willow genome；(2) transgenic poplar blade RNA is extracted
Carrying out Real-time PCR qualification, result shows transgenic normal transcription in willow.Primer used by PCR reaction is:
5'ggctacaccattcgaaatgtc 3'
5'tctagcatgcccagaacttc 3'
Primer used by Real-time PCR is:
5'gcaagccattaccaggcagagtc 3'
5'cacttgcattctcggctattgttgt 3
5th step: histone deacetylases gene converts willow application in willow salt tolerance.The method is utilized to obtain
To transgenic poplar salt tolerance significantly improve, it is characterised in that Salt Tolerance Analysis in detail below, result is as shown in Fig. 4 to Fig. 9:
Use 300mM NaCI that the transgenic poplar seedling of 4 week old carries out salt treatment, analysis transfer-gen plant and non-turn
Gene plant (comparison) is blade salting stain distribution situation when salt treatment 5 days, and transfer-gen plant and nontransgenic plants are at salt
Fresh weight when processing 10 days and survival rate.
When 300mM NaCl salt treatment 5 days, transgenic line Tr-1 and Tr-2 well-grown, the salting stain that blade occurs was bright
Aobvious less than nontransgenic plants.When salt treatment 10 days, transgenic line Tr-1 and Tr-2 well-grown, and nontransgenic plants
Blade almost all is withered；Salt stress inhibits the growth of willow, the fresh weight of transgenic line Tr-1 and Tr-2 to decrease respectively
12.42% and 34.15%, and nontransgenic plants fresh weight decreases 73.45%.When salt stress processes 10 days, transgenic line
It is that the survival rate of Tr-1 and Tr-2 is respectively 77.78% and 88.89%, rather than the survival rate of transgenic poplar is only 11.11%.
These results of study show, comospore poplar histone deacetylases gene converts willow can significantly improve the salt tolerance of willow.
Claims (6)
1. a histone deacetylases gene converts the method that willow improves its salt tolerance, it is characterised in that it be according to
Lower step is carried out:
Step one: obtain comospore poplar histone deacetylases gene, wherein, the primer used by PCR reaction by PCR method
For:
Primer 1:5'gctctagaatggacactggtggcaactc 3'；
Primer 2: 5 ' ggggtacctcatgacttggagaacatct 3'；
Step 2: comospore poplar histone deacetylases gene step one obtained is inserted in plasmid pROK2, constructs and plants
Thing expression vector, is transformed into the plant expression vector of structure in Agrobacterium tumefaciems EHA105；
Step 3: use agrobacterium-mediated transformation by this histone deacetylases gene genetic transformation to willow, and obtain
Transgenic poplar strain；
Step 4: the transgenic poplar blade obtaining step 3 carries out DNA extraction and PCR identifies, and transgenic poplar leaf
Sheet RNA extracts and Real-time PCR identifies, qualified after, i.e. complete described histone deacetylases gene and convert
Willow improves the method for its salt tolerance.
A kind of histone deacetylases gene the most according to claim 1 converts the method that willow improves its salt tolerance,
It is characterized in that in step one, the PCR system of PCR reaction is as follows:
PCR amplification condition: 94 DEG C of denaturations 5min；94 DEG C of degeneration 30s, 58 DEG C of annealing 30s, 72 DEG C extend 2min, 30 circulations；
Last 72 DEG C extend 10min.
A kind of histone deacetylases gene the most according to claim 1 converts the method that willow improves its salt tolerance,
It is characterized in that the PCR system that in step 4, PCR identifies is as follows:
PCR amplification condition: 94 DEG C of denaturations 5min；94 DEG C of degeneration 30s, 58 DEG C of annealing 30s, 72 DEG C extend 60s, 35 circulations；
Last 72 DEG C extend 10min.
A kind of histone deacetylases gene the most according to claim 1 converts the method that willow improves its salt tolerance,
It is characterized in that the PCR system that Real-time PCR identifies is as follows:
PCR amplification condition: 95 DEG C of denaturations 3min；95 DEG C of degeneration 30s, 60 DEG C of annealing 30s, 72 DEG C extend 30s, 44 circulations.
5. the application of a histone deacetylases gene, it is characterised in that it is for improving the salt tolerance of willow, described
Histone deacetylases gene is that the method using claim 1 obtains, described histone deacetylases gene base
Because sequence is as shown in sequence table Seq ID No:1.
The application of a kind of histone deacetylases gene the most according to claim 5, it is characterised in that described willow
For 84K poplar.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610716123.4A CN106086066A (en) | 2016-08-23 | 2016-08-23 | A kind of histone deacetylases gene converts willow and improves the method for its salt tolerance and the application of this gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610716123.4A CN106086066A (en) | 2016-08-23 | 2016-08-23 | A kind of histone deacetylases gene converts willow and improves the method for its salt tolerance and the application of this gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106086066A true CN106086066A (en) | 2016-11-09 |
Family
ID=57225605
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610716123.4A Pending CN106086066A (en) | 2016-08-23 | 2016-08-23 | A kind of histone deacetylases gene converts willow and improves the method for its salt tolerance and the application of this gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106086066A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110885813A (en) * | 2019-12-17 | 2020-03-17 | 中国农业大学 | Application of rice histone deacetylase gene HDA710 in delaying leaf senescence |
| CN112931213A (en) * | 2021-03-29 | 2021-06-11 | 东北林业大学 | Poplar explant detoxification reagent, detoxification method and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015122546A1 (en) * | 2014-02-17 | 2015-08-20 | 独立行政法人国際農林水産業研究センター | SALT-TOLERANCE-CONTROLLING GENE qNaCl3 ON SOYBEAN CHROMOSOME 3, AND USE THEREOF |
-
2016
- 2016-08-23 CN CN201610716123.4A patent/CN106086066A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015122546A1 (en) * | 2014-02-17 | 2015-08-20 | 独立行政法人国際農林水産業研究センター | SALT-TOLERANCE-CONTROLLING GENE qNaCl3 ON SOYBEAN CHROMOSOME 3, AND USE THEREOF |
Non-Patent Citations (2)
| Title |
|---|
| 刘超等: "毛果杨HDA902基因的克隆、序列分析和亚细胞定位", 《分子植物育种》 * |
| 吕世博等: "毛果杨HDA901基因的克隆和表达分析", 《西北植物学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110885813A (en) * | 2019-12-17 | 2020-03-17 | 中国农业大学 | Application of rice histone deacetylase gene HDA710 in delaying leaf senescence |
| CN112931213A (en) * | 2021-03-29 | 2021-06-11 | 东北林业大学 | Poplar explant detoxification reagent, detoxification method and application |
| CN112931213B (en) * | 2021-03-29 | 2022-05-27 | 东北林业大学 | Poplar explant detoxification reagent, detoxification method and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107326042A (en) | The fixed point of paddy rice TMS10 genes knocks out system and its application | |
| CN101006768B (en) | Agrobacterium-mediated Sophora japonica transgene and tissue-culturing rapid propagation method | |
| CN107118264A (en) | A kind of Rise's boot period cold resistance GAP-associated protein GAP CTB4a and encoding gene and application | |
| CN110128514A (en) | Rise's boot period cold resistance GAP-associated protein GAP CTB4b and encoding gene and application | |
| CN107840872A (en) | Albumen and the application of wax plum CpWOX13 genes and its coding | |
| CN104480124A (en) | Indicator gene used in TRV-mediated gene silencing system as well as construction method and application of carrier thereof | |
| CN103966235A (en) | Eggplant anthocyanin synthesis-related gene SmMYB1 as well as recombinant expression vector thereof and application of gene SmMYB1 in purple tomato culture | |
| Raharjo et al. | Recovery of avocado (Persea americana Mill.) plants transformed with the antifungal plant defensin gene PDF1. 2 | |
| CN103525828B (en) | Tomato S1EBI gene as well as RNAi (ribonucleic acid interference) expression vector and applications thereof | |
| CN106086066A (en) | A kind of histone deacetylases gene converts willow and improves the method for its salt tolerance and the application of this gene | |
| CN103571842B (en) | Rice Os PAR1 albumen and the application of encoding gene in regulating plant paraquat resistance thereof | |
| Kumar et al. | Interaction between COCHLEATA and UNIFOLIATA genes enables normal flower morphogenesis in the garden pea, Pisum sativum | |
| CN114907465B (en) | OsLEA9 protein related to cold tolerance of rice in booting stage, related biological material and application thereof | |
| CN105420273A (en) | Method for cultivating transgenic plants with blooming ahead of time | |
| Du et al. | Overexpression of the MhTGA2 gene from crab apple (Malus hupehensis) confers increased tolerance to salt stress in transgenic apple (Malus domestica) | |
| CN113862281A (en) | Application of wheat TaLCT1 gene silencing in regulation and control of wheat cadmium stress tolerance | |
| CN103789322B (en) | Application in regulation and control plant setting percentage and raising Genes For Plant Tolerance high temperature capabilities for the plant transcription factor dst | |
| CN109371039B (en) | Corn stain-resistant gene ZmWST1 | |
| CN105695479A (en) | Symmetry gene CmCYC2c of chrysanthemum morifolium and application of symmetry gene CmCYC2c | |
| CN104498512A (en) | Application of arabidopsis calcium ion-dependent protein kinase gene AtGPK1 in regulation and control of stomatal movement and plant drought resistance | |
| CN105087597A (en) | Gene capable of increasing plant biomass production and method for utilizing the same | |
| CN103451193B (en) | Populus deltoidesx populus nigra PdHSP70 gene and application thereof | |
| CN113151294B (en) | Application of WRKY53 gene in enhancing aluminum resistance of plants | |
| CN108165553A (en) | A kind of rubber tree floral organ characterization factor gene and its coded product and application | |
| CN115094072B (en) | Populus tomentosa PtYABBY7 gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161109 |