CN106046170A - Novel TRAIL fusion protein - Google Patents

Abstract

The invention provides a novel TRAIL fusion protein, which belongs to the field of biotechnology. The novel TRAIL fusion protein contains a third loop sequence of TGF-alpha and has strong specific tumor killing effect. The invention also discloses a coding gene of the TRAIL fusion protein and an expression pathway thereof, a production method for the fusion protein and application of the fusion protein in treatment of diseases like tumors.

Description

A kind of novel TRAIL fusion protein

Technical field

The invention belongs to biological technical field, relate to novel TRAIL fusion protein, and utilize technique for gene engineering to produce this to melt The method of hop protein and it is as the application of Drug therapy tumor He other relevant disease.

Background technology

TRAIL (TNF-related apoptosis-inducing ligand, tumor necrosin relative death inducing ligand) is also referred to as Apo2L (Apo-2ligand, Apoptosis 2 ligand), is a member [1] of tumor necrosis factor superfamily, and it is officially named swollen Tumor necrosis factor superfamily member 10 (Tumor necrosis factor ligand superfamily member 10).TRAIL molecule by 281 amino acid residue compositions, are typical II type transmembrane proteins, and 18-38 amino acid residue is formed has helical structure Single pass transmembrane district, aminoterminal is positioned at endochylema, and the 39-281 amino acid residue of carboxyl section is positioned at extracellular.TRAIL born of the same parents' outer portion Can be cut by protease, discharge in interstitial fluid and blood, form the molecular forms (sTRAIL) [2] of solubility.Restructuring Some the source sTRAIL fragment expressed, such as the TRAIL sequence corresponding to born of the same parents outer 95-281,104-281 or 114-281, All there is the activity of inducing cell apoptosis；Amgen and TRAIL (114-281) recombiant protein of Roche Holding Ag's cooperative development, claim For Du Laleming (Dulanermin), have been enter into clinical research [3].

TRAIL acts on the endogenic receptor of at least five [4].Only membrane receptor TRAIL-R1 and TRAIL-R2 contains intracellular Death domain and can be to intracellular delivery dead signal, therefore, TRAIL can only by activate the two death receptor (also distinguish It is referred to as DR4 and DR5) inducing cell apoptosis.TRAIL only forms homotrimer, just has receptor activation activity.Application The agonistic monoclonal antibodies of death receptor TRAIL-R1 and TRAIL-R2, also can produce the same biological effect [5,6]. TRAIL-R3, TRAIL-R4 and soluble recepter OPG are possibly as the activity of Antagonism regulation TRAIL.

Death receptor agonists has the physiologically active of suppression tumor, and has inborn tumour-specific and selectivity, they poles It is likely to become more efficient anti-tumor medicine.In a large amount of preclinical studies, many sTRAIL and TRAIL-R1 and The agonistic monoclonal antibodies of TRAIL-R2, presents good antitumous effect, but these TRAIL receptor stimulating agents is facing In bed experiment, although toxicity is relatively low, there is the highest safety, have lasting antitumor action individuals patients, there is no The clinical efficacy [7-9] determined.

Conventional restructuring sTRAIL clinical efficacy is the best, may expose owing to dosage limited in its pharmacokinetics, as Du draws The happy bright half-life is less than 1h at human body.Lack curative effect to be also likely to be due to wide at many normal cells and tissue of TRAIL receptor General expression, during whole body therapeutic, most of sTRAIL are attached on the TRAIL receptor of relative surplus in normal structure, sTRAIL The adsorbance of tumor cell is declined, thus activity reduces [10].Additionally, due to Antagonism receptor TRAIL-R3 and TRAIL-R4 Wide expression in tumor, the combination of tumor cell agonist death receptor is limited by sTRAIL further, and therapeutic effect is subject to To serious infringement.The agonistic monoclonal antibodies of TRAIL-R1 and TRAIL-R2, has good Pharmacokinetic Characteristics, right TRAIL receptor be combined with the highest type specificity, but the most also there is no more preferable curative effect [11].

By some method, improve the activity of TRAIL, be the developing goal strengthening its Clinical efficacy.As by with albumin Merge, the plasma half-life [12] of TRAIL can be significantly improved；Type specificity TRAIL mainly for DR4 and DR5 dashes forward Variant [13,14], it is possible to increase its lethal effect to different tumor cells；TRAIL can be with the antibody for tumor markers Or its segment composition [15,16], this fusion protein passes through antigen target tropism, promotes it to predetermined cell surface target antigen knot Close, cause selectivity tumor cell to be assembled, and by bystander effect, i.e. utilize the surface-crosslinked cell pair having trail protein Lack the lethal effect of the neighbouring tumor cell of antigen, produce the pharmacologically active [17] strengthened.But the molecule of the targeting/effector domain merged The structure that may interfere with TRAIL is formed and biological activity [18].

EGFR (epidermal growth factor receptor, EGF-R ELISA) is receptor tyrosine kinase ErbB family A type (ErbB1) in race, participates in regulating cell and grows, breeds, breaks up and the multiple important biological event such as migration, Overexpression in kinds of tumor cells.EGFR combines with respective ligand EGF, TGF-α etc., can be with inducing receptor self dimer Change, activated by its intracellular tyrosine kinase domain generation autophosphorylation simultaneously, activate a series of cascade in downstream enzymatic signal Conductive process, is transferred to growth signals in core.EGFR is one the drug target [19] determining meaning；The list of anti-EGFR Clonal antibody, and the micromolecular inhibitor such as gefitinib (gefitinib) of selectively targeted EGFR tyrosine kinase activity and angstrom Sieve replaces Buddhist nun (erlotinib), can effectively treat the patient of some EGFR positive tumors.Anti-EGFR Drug inhibition EGFR believes Number path, by increasing capacitance it is possible to increase the tumor cell sensitivity [20] to TRAIL.The restructuring that anti-egfr antibodies is formed with sTRAIL is melted Hop protein, targeting EGFR positive tumor cell, can rapid inactivation EGFR mediation mitosis signal, again can be effectively Activate TRAIL receptor, mediating apoptosis signal transduction, there is the strongest anti-tumor activity [21,22].

Native ligand EGF, TGF-α of EGFR etc. or its effective binding fragment, and the artificial peptide sheet of design synthesis, with potent Cytotoxin recombinated by fusion or associative reaction, it is possible to generate the cytotoxin of targeting EGFR positive tumor cell or immunity Toxin [23-26].These connection/fusions enter intracellular after being combined with EGFR, inducing cell death, or by immunoreation, Killing tumor cell.Compared to Antibody Fusion, ligand fused or bind molecule, there is less molecular mass and volume, it is easy to Infiltration in tumor tissues, may obtain more stable curative effect, also be more conducive to produce preparation.

As the small-molecular-weight peptide T GF-α of the native ligand of EGFR, there are similar molecular structure and function to EGF；They All exist 3 to disulfide bond inside peptide chain, the peptide chain of about 50 amino acid lengths is folded into tricyclic structure.TGF-α the 3rd ring region (TGF3L) in conjunction with EGFR, but can not there is rush cell division proliferation activity [27] of TGF-α and EGF.People TGF3L and TNF α Merge the fusion protein formed, Mus tumor L929 cell is had the toxic action identical with TNF α, and to two kinds of human tumor cells Cytotoxicity apparently higher than prototype TNF α [28].People TGF3L merges with N-end or the C-end of superantigen, all can increase its immunity Therapeutic activity [24].

[1].Wiley SR,Schooley K,Smolak PJ et al:Identification and characterization of a new member of the TNF family that induces apoptosis.Immunity 1995,3(6):673-682.

[2].Tecchio C,Huber V,Scapini P et al:IFNalpha-stimulated neutrophils and monocytes release a soluble form of TNF-related apoptosis-inducing ligand(TRAIL/Apo-2ligand)displaying apoptotic activity on leukemic cells.Blood 2004,103(10):3837-3844.

[3].Holland PM:Targeting Apo2L/TRAIL receptors by soluble Apo2L/TRAIL.Cancer Lett 2013, 332(2):156-162.

[4].den Hollander MW,Gietema JA,de Jong S et al:Translating TRAIL-receptor targeting agents to the clinic.Cancer Lett 2013,332(2):194-201.

[5].Micheau O,Shirley S,Dufour F:Death receptors as targets in cancer.Br J Pharmacol 2013, 169(8):1723-1744.

[6].Sessler T,Healy S,Samali A et al:Structural determinants of DISC function:new insights into death receptor-mediated apoptosis signalling.Pharmacol Ther 2013,140(2):186-199.

[7].Ashkenazi A,Pai RC,Fong S et al:Safety and antitumor activity of recombinant soluble Apo2 ligand.J Clin Invest 1999,104(2):155-162.

[8].Walczak H,Miller RE,Ariail K et al:Tumoricidal activity of tumor necrosis factor-related apoptosis-inducing ligand in vivo.Nat Med 1999,5(2):157-163.

[9].Sun S,Li Z,Sun L et al:Results on efficacy and safety of cancer treatment with or without tumor necrosis factor-related apoptosis-inducing ligand-related agents:A meta-analysis.Mol Clin Oncol 2014,2(3):440-448.

[10].Lemke J,von Karstedt S,Zinngrebe J et al:Getting TRAIL back on track for cancer therapy. Cell Death Differ 2014,21(9):1350-1364.

[11].Stuckey DW,Shah K:TRAIL on trial:preclinical advances in cancer therapy.Trends Mol Med 2013,19(11):685-694.

[12].Muller N,Schneider B,Pfizenmaier K et al:Superior serum half life of albumin tagged TNF ligands.Biochem Biophys Res Commun 2010,396(4):793-799.

[13].MacFarlane M,Kohlhaas SL,Sutcliffe MJ et al:TRAIL receptor-selective mutants signal to apoptosis via TRAIL-R1 in primary lymphoid malignancies.Cancer Res 2005, 65(24):11265-11270.

[14].Badran A,Asano R,Nakayama M et al:Target cell-restricted apoptosis induction by 528scFv-TRAIL fusion protein specific for human EGFR and expressed in Escherichia coli.Int J Oncol 2010,36(5):1229-1234.

[15].Bremer E,Samplonius D,Peipp M et al:Target cell-restricted apoptosis induction of acute leukemic T cells by a recombinant tumor necrosis factor-related apoptosis-inducing ligand fusion protein with specificity for human CD7.Cancer Res 2005,65(8):3380-3388.

[16].Bremer E,Kuijlen J,Samplonius D et al:Target cell-restricted and-enhanced apoptosis induction by a scFv:sTRAIL fusion protein with specificity for the pancarcinoma-associated antigen EGP2.Int J Cancer 2004,109(2):281-290.

[17].Bremer E,Samplonius D,Kroesen BJ et al:Exceptionally potent anti-tumor bystander activity of an scFv:sTRAIL fusion protein with specificity for EGP2 toward target antigen-negative tumor cells.Neoplasia 2004,6(5):636-645.

[18].Spitzer D,McDunn JE,Plambeck-Suess S et al:A genetically encoded multifunctional TRAIL trimer facilitates cell-specific targeting and tumor cell killing.Mol Cancer Ther 2010, 9(7):2142-2151.

[19].Arteaga CL,Engelman JA:ERBB receptors:from oncogene discovery to basic science to mechanism-based cancer therapeutics.Cancer Cell 2014,25(3):282-303.

[20].Xu L,Hu X,Qu X et al:Cetuximab enhances TRAIL-induced gastric cancer cell apoptosis by promoting DISC formation in lipid rafts.Biochem Biophys Res Commun 2013,439(2):285-290.

[21].Bremer E,Samplonius DF,van Genne L et al:Simultaneous inhibition of epidermal growth factor receptor(EGFR)signaling and enhanced activation of tumor necrosis factor-related apoptosis-inducing ligand(TRAIL)receptor-mediated apoptosis induction by an scFv:sTRAIL fusion protein with specificity for human EGFR.J Biol Chem 2005,280(11):10025-10033.

[22].Bremer E,de Bruyn M,Samplonius DF et al:Targeted delivery of a designed sTRAIL mutant results in superior apoptotic activity towards EGFR-positive tumor cells.J Mol Med(Berl) 2008,86(8):909-924.

[23].Guo XF,Zhu XF,Shang Y et al:A bispecific enediyne-energized fusion protein containing ligand-based and antibody-based oligopeptides against epidermal growth factor receptor and human epidermal growth factor receptor 2shows potent antitumor activity.Clin Cancer Res 2010,16(7):2085-2094.

[24].Xu Q,Zhang X,Yue J et al:Human TGFalpha-derived peptide TGFalphaL3fused with superantigen for immunotherapy of EGFR-expressing tumours.BMC Biotechnol 2010,10:91.

[25].Schaffert D,Kiss M,Rodl W et al:Poly(I:C)-mediated tumor growth suppression in EGF-receptor overexpressing tumors using EGF-polyethylene glycol-linear polyethylenimine as carrier.Pharm Res 2011,28(4):731-741.

[26].Ongarora BG,Fontenot KR,Hu X et al:Phthalocyanine-peptide conjugates for epidermal growth factor receptor targeting.J Med Chem 2012,55(8):3725-3738.

[27].Nestor J,Newman S,DeLustro B et al:A synthetic fragment of rat transforming growth factor alpha with receptor binding and antigenic properties.Biochem Biophys Res Commun 1985, 129(1):226-232.

[28]. Chen Jianjun, the gene constructed and expression of Sun Miao, Lu Fang, Chen Changqing, Wang De treasured .hTNF α-hTGF3 fusion protein. biological Chemistry and Acta Biophysica Sinica .1999,31 (5): 513-518.

Summary of the invention

Present invention solves the technical problem that, on the one hand be to provide a kind of comprise TRAIL new fusion protein, encoding fusion protein Gene order, expression vector containing this gene order and/or host cell, and a kind of method expressing this fusion protein is provided； On the other hand, it is provided that a kind of TRAIL fusion protein is as the application of high efficiency anti-tumor medicine.

Technical scheme, first aspect there is provided a kind of fusion protein, it is characterised in that described fusion protein is Comprising the first domain and the fusion protein of the second domain, wherein said first domain is the polypeptide in TGF-α source, and described Second domain is the polypeptide combining TRAIL receptor.

Above-mentioned fusion protein, it is characterised in that described fusion protein is substantially made up of the first domain and the second domain, Wherein said first domain is at least some of of TGF-α, described second domain be the extracellular domain of trail protein at least A part.

Above-mentioned fusion protein, it is characterised in that wherein said first domain is people TGF-α (SEQ.ID.NO.1), and described Two domains are human TNF related apoptosis-inducing ligand (SEQ.ID.NO.2).

Above-mentioned fusion protein, it is characterised in that described fusion protein, wherein said first domain is TGF-α the 3rd ring region SEQ.ID.NO.3, described second domain is at least some of of the extracellular domain of trail protein.

Above-mentioned fusion protein, it is characterised in that described fusion protein is SEQ.ID.NO.8, or has at least with SEQ.ID.NO.8 The fusion protein of 95% sequence iden.

Technical scheme, second aspect there is provided a kind of nucleic acid molecules, expression vector or host cell.

Above-mentioned nucleic acid molecules, it is characterised in that described nucleic acid molecules contains the base of fusion protein described in coding first aspect present invention Because of sequence, the gene order shown in preferably SEQ ID No:7.

Above-mentioned expression vector, it is characterised in that described expression vector comprises the nucleic acid molecules described in present aspect, is connected to carrier Promoter is for the expression of nucleic acid molecule encoding albumen.

Above-mentioned host cell, it is characterised in that described host cell contains the nucleic acid molecules described in present aspect or expression vector.

Technical scheme, the third aspect there is provided and a kind of uses following steps to produce destination protein or the method for polypeptide: (1) Expand suitable host cell；(2) inducing host cell expressed fusion protein；(3) fusion protein is prepared in separation；And/or (4) are right Fusion protein carries out renaturation in vitro, to obtain biological activity protein；It is characterized in that, the host cell in this step (1) is this Host cell described in bright second aspect.

Technical scheme, fourth aspect there is provided a kind of method preparing antitumor drug, it is characterised in that preparation Antitumor drug comprise fusion protein described in first aspect present invention.

Technical scheme, the 5th aspect there is provided a kind of method preparing antitumor drug, it is characterised in that preparation Antitumor drug comprise nucleic acid molecules described in second aspect present invention, expression vector or host cell.

Technical solution of the present invention, it is relevant with treatment tumor-related illness, TRAIL in prevention that the 6th aspect provides new fusion protein Application in disease.

Detailed Description Of The Invention:

It is an object of the invention to provide a kind of novel TRAIL fusion protein, it is provided that one prepare novel TRAIL fusion protein and Encoding gene, the method for expression vector, it is provided that described fusion protein encoding gene and the expression step of expression vector, and provide A kind of using method of novel TRAIL fusion protein.

It is a discovery of the invention that trail protein is connected with TGF-α the 3rd ring region (TGF3L), form new fusion protein, there is ratio The tumor cytotoxicity effect that trail protein is higher；This potentiation is mainly reflected in the tumor cell sensitive to TRAIL, And the normal cell that TRAIL toxicity is insensitive is not still had activity.To many human tumor cells sensitive for TRAIL, this fusion The specific tumour lethal effect of albumen can improve Radix Achyranthis Bidentatae, even thousand times；To Mus tumor L929 cell, swelling of this fusion protein Tumor lethal effect still can improve more than Radix Achyranthis Bidentatae.The most highly active TRAIL fusion protein, it is possible to overcome current TRAIL and with The class medicine shortcoming that the uncertain therapeutic efficacy of appearance is fixed in clinical research is applied, plays its due high efficiency anti-tumor effect.

The activity of new TRAIL fusion protein, may be mediated by the combination of TGF3L Yu EGFR.But the present invention not Its concrete active mechanism is as the basis invented or qualifications.

New TRAIL fusion protein of the present invention, containing the Functional domains of TRAIL, and TGF-α the 3rd ring region Or domain (TGF3L).The Functional domains of TRAIL refers to can be in conjunction with the domain of TRAIL receptor.By known crystal structure Understand, the Functional domains of TRAIL, be positioned at its born of the same parents' external structure district, originate in about about 120 amino acids residues, to carboxylic Cardinal extremity last 281 amino acids residues eventually；For recombinant expressed, the TRAIL fragment containing Functional domains, common have 114-281, 104-281,95-281 or the TRAIL molecule fragment containing more amino terminal sequences, mainly its born of the same parents' external structure district.TGF-α the 3rd Ring region (TGF3L), the fragment become by 10 residue arrays contained for its two ends cysteine residues, during amalgamation and expression, often Use the extension sequence at two ends, the molecule of residue number 15-20 length.When the two merges, its sequence can be made to be directly connected to, it is possible to To be indirectly connected with by an intervening sequence.The order of connection of the two is variable, i.e. TGF3L can be located at the amino of TRAIL domain End or c-terminus.In fusion protein, two kinds of domains can be single copy number, it is also possible to comprises more copy number respectively.TGF3L The amino acid residue that can carry out as required being suitable for replaces, lacks or add；TRAIL domain can also be its amino acid residue The variant replace, lacking or adding, the even TRAIL containing TRAIL domain are cyclized Isoforms (Chinese patent application 2011800680194), therefore obtain the different affinitys to each receptor subtype, or obtain other feature needed, as long as these become Body provides the pharmacological activity of level similar with wild-type protein, is all included in the present invention.

The fusion protein of the present invention may further include and contributes to protein purification, the expression increasing recombiant protein or increase Deliquescent one or more other polypeptide domain of recombiant protein.This purification/express/promote deliquescent domain, bag Include but be not limited to metal chelating peptide, as histidine-tagged.Can comprise between purification domain and TGF3L/TRAIL and can cut Intervening sequence, such as TEV, factor Xa or enterokinase recognition sequence, can be beneficial to the removal of label after purification.

Prepare novel TRAIL fusion protein, need first to obtain the gene clone of coding TRAIL domain and TGF3L.Logical Often, design PCR primer according to known gene order, with the RNA extracted from respective organization or cell, carry out reverse transcription PCR can directly obtain cDNA clone；Simpler, can be with the synthetic gene order identical with natural DNA sequences encoding； Known method for designing can also be used according to its aminoacid sequence, according to the gene preference of host, the different codon preference of synthesis Gene order；Also easily it is either commercially available required gene clone from other.The encoding gene of said two devices can be according to needs Carry out encoding mutant, to obtain different variants.

The expression vector encoding fusion protein of the present invention can be built by known method.Learn to do with conventional molecular biosciences Section, is first directly total to code by the gene of coding TRAIL domain and TGF3L and connects.Their order of connection can be as required It is adjusted.Said gene fragment can also be connected by the genetic fragment containing encoded interval sequence.The fusion egg of above-mentioned acquisition White encoding gene, inserts suitable expression vector by known method, obtains expressing the recombinant vector of above-mentioned fusion protein.Also may be used With by the genetic fragment of needs by being suitably sequentially connected with on expression vector.Above-mentioned expression vector includes but not limited to protokaryon Expression vector and various carrier for expression of eukaryon.The expression vector of optional extensive stock, such as expression vector pQE series, pET Series etc., it is possible to use self reliant rebuilding or the expression vector of structure.

By known method, recombinant vector proceeding to host cell, described host cell includes but not limited to escherichia coli, other is former Nucleus, various eukaryotic cells.Carrying out abduction delivering under suitable conditions, the host cell of expression cracks through broken, Collect fusion protein product.The TRAIL fusion protein of bacterial expression generally exists with inclusion bodies, can obtain through renaturation in vitro Obtain activated product.Expression product can be by known method purification.

TRAIL fusion protein can the synthesis of polypeptide and processing in or be processed further in step being chemically modified.Pass through body In or external chemiluminescent polypeptide derive, form such as acetylation, phosphorylation, carboxylated or glycosylation modified.These are modified the most not Change the primary structure of albumen, and its anti-Proteolytic enzyme performance or other physicochemical property can be improved.It addition, with D-aminoacid, Alpha-non-natural amino acid or non-amino acid analog substitute or add, it is thus achieved that the fusion protein of modification, are also included in the scope of the present invention.

The TRAIL fusion protein of the present invention, has the tumor-killing frequency spectrum similar with trail protein, but due to its extremely strong work Property, can be used for the treatment of clinical tumor patient.This fusion protein also be likely used for the treatment of disease relevant for other TRAIL.

The TRAIL fusion protein of the present invention is as the typical method of medicament administration, for parenteral approach, by intravenous, skin Under, intramuscular or peritoneal injection, or by infusion or other acceptable systemic delivery method any.Pass through venoclysis Application process be preferred version.Additionally, it is known that the therapeutic delivery method that multiple proteins is oral, it is also possible to it is applied to this Bright Therapeutic fusion proteins.

Fusion protein can be formulated in nontoxic, inert and pharmaceutically acceptable aqueous carrier medium, or with other suitable medicine Acceptable carrier combination on.This kind of pharmaceutical composition contain the protein of therapeutically effective amount and pharmaceutically acceptable carrier or Additive.This kind of carrier includes but not limited to: saline, buffer, glucose, water, glycerol and combinations thereof.Zinc ion is permissible Stablize the trimeric molecules of TRAIL, be a kind of suitably additive；Some reproducibility molecule such as mercaptoethanols, can keep TRAIL intramolecular sulfydryl is exempted from oxidized, to maintain its biological activity, is also a suitable additive of class.Pharmaceutical dosage form should with give Prescription formula matches.The TRAIL fusion protein of the present invention can also be made into injection form, with such as normal saline or containing Portugal Grape sugar and the aqueous solution of other adjuvant, be prepared by conventional method.The pharmaceutical composition of other form, it is possible to by routine Method is prepared.Pharmaceutical composition such as injection, solution etc. preferably aseptically manufacture.The pharmaceutical composition prepared is permissible It is administered by aforementioned approach.The dosage of active component is therapeutically effective amount, such as about 1 microgram every day/kg body weight-about 5 Mg/kg body weight, concrete dosage is it is also contemplated that the factor such as route of administration, patient health situation, and these are all skilled practitioners technical ability Within the scope of.Additionally, the TRAIL fusion protein of the present invention also can be used together with other therapeutic agents.

The present invention also contemplates for using fusion protein by gene therapy method, such as, uses the nucleic acid of encoding fusion protein.This Invent the nucleic acid sequence encoding full disclosure of described fusion protein, obtained and transform the side of this nucleic acid by recombinant DNA method Method is completely within the ability of those skilled in the art.In order to obtain the maximization of yield of recombinant proteins at specific cells, carry out Codon optimized, the most completely within the ability of those skilled in the art.Gene therapy method is the most also to know 's

Advantageous Effects:

It is an advantage of the current invention that the fusion protein formed relative to TRAIL and antibody and albumin and TGF-α whole protein, This novel TRAIL fusion protein molecule amount is little, penetrates readily through tumor tissues, may obtain more effective therapeutic effect.And relatively Little molecular weight is easier to use prokaryotic expression system to produce, and effectively reduces its production cost.

It is a further advantage of the invention that this novel TRAIL fusion protein is relative to restructuring sTRAIL, it should also there is EGFR The feature of targeting, has double target function, has high biological activity.

Accompanying drawing illustrates:

Fig. 1. the prokaryotic expression of people's rsTRAIL.

RsTRAIL is expressed in E.coli TG1, collect do not induce full bacterium sample (-), IPTG induce full bacterium sample (+), Induction bacterium soluble upper sample (S) and insoluble inclusion body sample (I), be separated by electrophoresis in 13%SDS-PAGE gel Detection.Induction rear fusion protein is effectively accumulated in Host Strains with inclusion bodies.M is protein electrophoresis marker and molecular weight thereof (kD)；Arrow indication is expression product TRAIL pillar location.

The expression of Fig. 2 .TGF3L-TRAIL fusion protein.

Fusion protein expresses sample in E.coli TG1: collect do not induce full bacterium sample (-), through IPTG induce full bacterium sample (+), Induction Supernatant samples (S), induction inclusion body sample (I), carry out electrophoresis detection in 13%SDS-PAGE gel.Fusion protein with Inclusion bodies height efficient expression.M is protein electrophoresis marker and molecular weight (kD)；Arrow indication is fusion protein pillar location.

Fig. 3. recombinant soluble TRAIL and novel TGF3L-TRAIL fusion protein act on human embryonic lung fibroblast HELF, The comparison of respective cell killing activity amount effect curve.

Fig. 4. recombinant soluble TRAIL and novel TGF3L-TRAIL fusion protein act on people epidermal carcinoma cell A431, respectively From the comparison of cell killing activity amount effect curve.

Fig. 5. recombinant soluble TRAIL and novel TGF3L-TRAIL fusion protein act on human cervical carcinoma cell Hela, each The comparison of cell killing activity amount effect curve.

Fig. 6. recombinant soluble TRAIL and novel TGF3L-TRAIL fusion protein act on Human hepatoma cell line Bel-7402, respectively From the comparison of cell killing activity amount effect curve.

Sequence involved in embodiment, claim and narration is as follows:

1. people TGF-alpha amino acid sequence (SEQ.ID.NO.1)

2. human TNF related apoptosis-inducing ligand aminoacid sequence (SEQ.ID.NO.2)

3.TGF-α the 3rd ring region aminoacid sequence (SEQ.ID.NO.3)

4. human TNF related apoptosis-inducing ligand 114-281 nucleic acid sequence encoding (SEQ.ID.NO.4) in expression vector

5. human TNF related apoptosis-inducing ligand 114-281 expression product aminoacid sequence (SEQ.ID.NO.5)

6. the sequence (SEQ.ID.NO.6) of people TGF-α the 3rd ring region and downstream coding gene thereof

7. fusion protein TGF3L-TRAIL gene coded sequence (SEQ.ID.NO.7)

8. fusion protein TGF3L-TRAIL aminoacid sequence (SEQ.ID.NO.8)

Embodiment:

It is further elucidated with present disclosure below by specific embodiment, but these embodiments are not limiting as the protection model of the present invention Enclose.Conventional plasmid build involved by PCR, enzyme action, the experiment such as connection, and conversion involved by protein expression, antibacterial The Foundation is experiment area research personnel such as cultivation are familiar with, so particularly relevant experimental detail is the most dated, specifically can refer to " point Sub-cloning experimentation guide " (T. Manny A Disi writes for J. Pehanorm Brooker, E.F. not Ritchie) described conventional laboratory conditions.

Embodiment 1: protein expression vector builds

With the plasmid pMD-TRAIL (Sino Biological Inc.) containing human TNF related apoptosis-inducing ligand cDNA sequence as mould Plate, with primer TL5 ataggatccGTGAGAGAAAGAGGTCCTC and TL3 The 114-281 fragment of atactcgagTTAGCCAACTAAAAAGGCCC amplification coding human TNF related apoptosis-inducing ligand.Through BamHI and XhoI Double digestion, inserts BamHI and the SalI restriction enzyme site of pQE30, is built into pQE30-TRAIL expression vector, and translation is read The frame (SEQ.ID.NO.4) the His-Tag coding containing carrier.

The primer TGFL5 ataggatccGTTTGCCACTCTGGTTACGTTGG, TGFL of design synthesis CCACTCTGGTTACGTTGGTGCTCGTTGCGAACACGCTGACCTGCTG and TGFL3 The blended PCR of ataagatctACCACCCAGCAGGTCAGCGTGTTC expands, it is thus achieved that containing coding TGF-α the 3rd The gene (SEQ.ID.NO.6) of ring region and downstream sequence thereof；Genetic fragment is through BglII enzyme action, with the TRAIL of BamHI enzyme action 114-281 connects；Again through TGFL5 and TL3 primer amplification, coding TGF-α the 3rd ring region of acquisition and TRAIL 114-281 Fusion gene (SEQ.ID.NO.7) BamHI and XhoI double digestion, inserts BamHI and the SalI restriction enzyme site of pQE80L, It is built into pQE80L-TGL3-TRAIL expression vector.In fusion protein (SEQ.ID.NO.8), TGF sequence and TRAIL structure The short intervening sequence that territory is made up of tetra-amino acid residues of GGRS connects；Expression product contains the His-Tag of vector encoded.

Embodiment 2: fusion protein prokaryotic expression

By relevant recombinant plasmid transformed to E.coli TG1 competence, obtain purpose engineered strain.Specific embodiment all uses experiment Room shaking flask on a small scale is expressed.In the LB fluid medium containing ampicillin, under the conditions of 37 DEG C, vibration activation is overnight, afterwards will Overnight culture is forwarded in the new LB culture medium (500mL) containing ampicillin by 1:100, and 37 DEG C of shaken cultivation are to properly Exponential phase, through 1mM IPTG abduction delivering about 4 hours.

Bacterium solution is under the conditions of 4 DEG C, and 7000rpm abandons supernatant after being centrifuged 5min, collects thalline, with the PBS weight of 10mL volume After Xuan, add Triton X-100 make its final concentration of 1%, mixing, multigelation crack, carrying out ultrasonic bacteria breaking 20min.Lysate In 4 DEG C, 12000rpm abandons supernatant after being centrifuged 5min, obtains inclusion body ,-20 DEG C of preservations.

Embodiment 3: the washing of inclusion body and dissolving

By inclusion body precipitation with inclusion body washing liquid A (50mM Tris-HCl, pH 7.6,3%Triton X-100 and 20mM EDTA) Resuspended, in 4 DEG C, 12000rpm is centrifuged 5min, repeated washing twice；Again with inclusion body cleaning mixture B (containing 50mM Tris-HCl, PH 7.6,0.5%Triton X-100,1M NaCl, 2M carbamide) repeated washing twice.With solubilization of inclusion bodies liquid A (50mM Tris-HCl, 100mM NaCl, 10M carbamide, 10mM beta-mercaptoethanol, pH 9.0) dissolve inclusion body, it is centrifuged and collects Clearly, being diluted to rapidly urea concentration with the buffer containing 50mM Tris-HCl, 100mM NaCl, pH 9.0 is 3M, with Treat next step purification.

Embodiment 4: protein purification and renaturation

Use immobilization Ni²⁺Chelating chromatography purification Denatured protein.The chromatographic column combination buffer (50 of 10 times of column volumes MM Tris-HCl, 100mM NaCl, 3M carbamide, pH 9.0) balance, the sample combination containing 50-500mM imidazoles Buffer carries out gradient elution.

In elution samples, addition ammonium sulfate is to 70% saturation, and in 4 DEG C, 12000rpm is centrifuged 15min, and precipitation is with dissolving buffering Liquid B (50mM Tris-HCl, 100mM NaCl, 5M guanidine hydrochloride, 30mM DTT, pH 8.0) dissolves again.Clarification Solution divides 6 renaturation solutions being slowly added into about its 4 times of volumes, and (50mM Tris-HCl, 500mM NaCl, 0.5M urinate Element, 0.4M L-Arg, 2mM DTT, 1mM ZnSO4, pH 9.7) in, it is spaced 1 hour between twice.At 200 times The dialysis renaturation liquid (50mM Tris-HCl, 100mM NaCl, 2mM DTT, pH 8.0) of volume is dialysed, changes liquid 3-4 time, it is spaced 4-10 hour.In 4 DEG C, 12000rpm is centrifuged 15min, obtains recombinant protein supernatant.

Embodiment 5: protein electrophoresis is with quantitative

PAGE gel is prepared according to a conventional method.Recombinant protein solution 40 μ l, adds 5 × SDS sample-loading buffer of 10 μ l (300mM Tris-HCl (pH 6.8), 20% beta-mercaptoethanol, 20%SDS, 25% glycerol, 0.05% bromophenol blue), boiling water Bath 5min, has prepared and has been placed on-20 DEG C of preservations.

Protein sample loading, as standard substance, carries out 13% with bovine serum albumin (bovine serum albumin, BSA) SDS-PAGE.Coomassie brilliant blue R_250 dyes, and the gel protein band QuantiScan software after decolouring is carried out gray scale and sweeps Retouch, calculate fusion protein content according to standard curve quantitative for BSA.

Embodiment 6: cell is cultivated and active testing

Each cell strain containing 10% hyclone (Hangzhou biological engineering material company limited), 100U/mL penicillin and Cultivating in the RPMI-1640 culture medium (Gibico company of the U.S.) of 100 μ g/mL streptomycins, temperature is 37 DEG C, carbon dioxide Concentration is 5%.

Testing protein culture medium proportional diluted is become a series of concentration.

After cell dissociation is become individual cells, add 96 well culture plates (100 μ L/ hole) by finite concentration, be placed in 37 DEG C, 5% The incubator of CO2 is cultivated 24 hours.Adding variable concentrations testing protein, discard culture fluid after acting on 72 hours, every hole adds 100 The μ L RPMI-1640 culture medium containing 0.5mg/ml MTT.Being placed in 37 DEG C, the incubator of 5%CO2 is cultivated 4 hours, discards training Nutrient solution, every hole adds DMSO 150 μ L, shakes 10min under room temperature, makes blue crystallization be completely dissolved, uses Bio-Rad450 type Microplate reader measures every hole absorbance, detects wavelength 570nm, reference wavelength 655nm.

The inhibition percentage in each hole is calculated by formula, and the often average of parallel hole inhibition percentage in group dosage and standard deviation:

Not adding the non-dosing of cell is background, is 100% suppression；Only add cell do not add medicine for negative control, be 0% and press down System.

Product to be tested suppression ratio %=(negative control OD testing compound OD)/(negative control OD background OD) × 100%

If TRAIL (114-281) experimental group, and fusion protein experimental group.

Table 1. recombinant soluble TRAIL and anti tumor activity in vitro (3-5 the parallel laboratory test of TGF3L-TRAIL fusion protein The meansigma methods of IC50 and standard deviation, nM), and intensification factor (each parallel laboratory test enhancing of fusion protein activity TRAIL relatively The meansigma methods of multiple).

Claims (14)

1. comprising the first domain and the fusion protein of the second domain, wherein said first domain is the polypeptide in TGF-α source, And described second domain is the polypeptide combining TRAIL receptor.

2. the fusion protein described in claim 1, is substantially made up of the first domain and the second domain, wherein said first knot Structure territory is at least some of of TGF-α, and described second domain is at least some of of the extracellular domain of trail protein.

3. the fusion protein described in claim 1, wherein said first domain is people TGF-α, and described second domain is people TRAIL。

4. the fusion protein described in claim 1, wherein said first domain is TGF-α the 3rd ring region, has SEQ.ID.NO.3 Shown aminoacid sequence, described second domain is at least some of of the extracellular domain of trail protein.

5. the fusion protein described in claim 1, wherein said fusion protein is the aminoacid sequence shown in SEQ.ID.NO.8.

6. the fusion protein described in claim 1, wherein said fusion protein and SEQ.ID.NO.8 have at least 95% sequence homology Property.

7. a nucleic acid molecules, it is characterised in that described nucleic acid molecules contains the core of the fusion protein described in coding claim 1 Nucleotide sequence.

8. an expression vector, it is characterised in that described expression vector contains the nucleotide sequence described in claim 7.

9. a host cell, it is characterised in that described host cell comprises the nucleic acid molecules described in claim 7.

10. a production method.Described production method comprises the following steps:

A. the gene order of fusion protein described in coding claim 1 is obtained

B. by during the sequence of gained is inserted into suitable carrier in step A, corresponding nucleic acid construct is obtained

C. the nucleic acid construct of step B gained is transfected into suitable host cell

D. under suitable condition of culture, the host cell in incubation step C, and therefrom isolate the new fusion protein of expression.

11. pharmaceutical compositions, it comprises the fusion protein described in claim 1.

Fusion protein described in 12. claim 1 is as prevention and the application for the treatment of tumor-related illness medicine.

Tumor described in 13. claim 12 be breast carcinoma, colon cancer, pulmonary carcinoma, ovarian cancer, hepatocarcinoma, gastric cancer, oral cancer, cervical cancer, One of cancer of pancreas, skin carcinoma, renal carcinoma etc..

The encoding gene of fusion protein described in 14. coding claim 1, as the using method of tumor.