CN106011244B - Detect the application of the region 7q21.13 SNP reagent - Google Patents
Detect the application of the region 7q21.13 SNP reagent Download PDFInfo
- Publication number
- CN106011244B CN106011244B CN201610373409.7A CN201610373409A CN106011244B CN 106011244 B CN106011244 B CN 106011244B CN 201610373409 A CN201610373409 A CN 201610373409A CN 106011244 B CN106011244 B CN 106011244B
- Authority
- CN
- China
- Prior art keywords
- snp
- crowd
- liver cancer
- case
- guangxi
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to the applications of the reagent of the detection region 7q21.13 SNP, specifically, detect purposes of the reagent of the region 7q21.13 SNP in reagent preparation box, the kit is used to prepare the product of liver cancer patient screening, and the SNP is rs10272859.It as a result, can be effective for liver cancer patient screening using the reagent of the detection SNP.
Description
Technical field
The present invention relates to field of biotechnology, and in particular to the application of the detection region 7q21.13 SNP reagent.
Background technique
Primary hepatocyte hepatocarcinoma (Hepatocellular Cancer, HCC, hereinafter referred to as liver cancer) is common pernicious
One of tumour, annual morbidity occupy the 5th in malignant tumour.China is liver Cancer country, annual new cases about 500,000,
Account for more than half of global liver cancer new cases.Epidemiology and experimental study show that liver cancer belongs to multifactor complex disease,
It is viral factor, environmental factor and the coefficient result of inherent cause.In China, hepatitis B (Hepatitis B
Virus, HBV) infection be liver cancer occur most important factor, it is about related to 80% liver cancer.But HBV chronic infection
In person, the only final suffering from hepatic cancer of small part individual, meanwhile, there is Familial aggregation to be inclined to for the generation of liver cancer, prompt inherent cause
It plays a significant role in the generating process of liver cancer.Traditional case-control association study based on candidate gene and in recent years
Genome-wide association study (Genome-wide association study, GWAS) to rise have found successively it is several with
The significant relevant single nucleotide polymorphism (Single nucleotide polymorphism, SNP) of HBV associated hepatocellular carcinoma, into one
Step confirms that HBV associated hepatocellular carcinoma has inherited pathogenic factor, that is, there is the tumor susceptibility gene of HBV associated hepatocellular carcinoma.Tumor susceptibility gene exists
It plays an important role in the generation of HBV associated hepatocellular carcinoma, development.The identification of HBV associated hepatocellular carcinoma tumor susceptibility gene and the gene
The parsing of relevant molecule mechanism will provide theoretical foundation for the prevention of liver cancer high risk population and clinical diagnosis and treatment, and then be expected to realize
To the early prevention and individualized treatment of liver cancer, achieve the purpose that improve liver cancer treatment effect.
Genome-wide association study is proved to can unbiased, effective excavation disease or the relevant SNP of phenotype.So far,
It has more than 2000 genome-wide association studies to be reported, wherein more than half is the research for tumour.Although based on disease
The research strategy statistics efficiency of example-control is higher, but due to mixing there are crowd or the factors such as population stratification, the research strategy
It is easy to produce false positive results.Genome-wide association study is the false positive results for avoiding full-length genome level excessive, is generally needed
Choose that correlation degree is strongest several or dozens of site is further verified in verifying crowd, thus may omit can
It can relevant site.In addition, the significant association site that the genome-wide association study based on case-control is finally reported have passed through
The repeated authentication of multiple independent crowds, can not still exclude these sites completely may be false positive knot caused by population stratification
Fruit.
Currently, the detection technique of the liver cancer patient screening based on SNP still has much room for improvement.
Summary of the invention
The present invention is to be made based on inventor to the discovery of following facts and problem and understanding:
In order to further excavate new HBV associated hepatocellular carcinoma tumor susceptibility gene, inventor has carried out the HBV associated hepatocellular carcinoma of a new round
Genome-wide association study.Research strategy based on family is not influenced by population stratification phenomenon, and it is right sufficiently to compensate for case-
According to the deficiency of research strategy.Inventor uses based on family and is based on case-control strategy as a result, can efficiently and accurately send out
Existing disease related locus.In the stage of excavation, inventor is comprehensive to be used based on family and based on the strategy of case-control, with abundant
Play two kinds of respective advantages of strategy.In Qualify Phase, inventor completes two stage people using the strategy based on case-control
Group's verifying.Finally, successfully located 7q21.13 is the new susceptibility regions of liver cancer.Further, inventor has carried out more the region
Careful analysis.
The present invention is directed to solve at least some of the technical problems in related technologies.
According to the first aspect of the invention, the present invention proposes purposes of the reagent of detection SNP in reagent preparation box,
In, the kit is used for liver cancer patient screening, and the SNP is rs10272859, which is located at No. 7 chromosome of the mankind
90,318,474 positions (are based on the 19th version of human genome).Inventor is comprehensive using based on family and based on case-control
Strategy, to give full play to two kinds of respective advantages of strategy.In Qualify Phase, two are completed using the strategy based on case-control
The crowd in stage verifies, and final verifying rs10272859 is significant related to liver cancer, as a result, can using the reagent of the detection SNP
Effectively to carry out liver cancer patient screening.
According to some embodiments of the present invention, the reagent includes primer and/or probe.
According to some embodiments of the present invention, the rs10272859 is the finger that the genotype of GC or GG is liver cancer high risk
Show.By analyzing the life cycle of rs10272859 genotype and hepatocarcinoma patient, inventors have found that carrying rs10272859 risk etc.
Liver cancer patient (the GG or GC) life cycle of position G equipotential does not carry risk equipotential patient considerably shorter than.Thus, it is possible to pass through detection
The genotype of rs10272859 effectively to carry out liver cancer patient screening.
According to the second aspect of the invention, the present invention proposes a kind of kit for liver cancer patient screening, the reagent
Box contains the reagent of detection SNP, and the SNP is rs10272859.Inventor is comprehensive using based on family and based on case-control
Strategy, to give full play to two kinds of respective advantages of strategy.In Qualify Phase, two are completed using the strategy based on case-control
The crowd in stage verifies, and the final rs10272859 that verifies is significant related to liver cancer, can effectively be examined using the kit as a result,
Survey liver cancer.
According to some embodiments of the present invention, the reagent includes primer and/or probe.The application method packet of the reagent
It includes but is not limited to TaqMan parting and Sequenom parting etc..
According to some embodiments of the present invention, the primer is GTCTCTTTCCACCTCTTCAACCA (SEQ ID NO:1)
With AGTCAGCAGGCAGTTAGAATACAGTATC (SEQ ID NO:2).Wherein, before GTCTCTTTCCACCTCTTCAACCA is
To primer, AGTCAGCAGGCAGTTAGAATACAGTATC be after to primer, using it is preceding can be effective to primer and backward primer
Detect SNP site of the present invention in ground.
According to some embodiments of the present invention, the probe is (FAM) TCAGCCATATCTGCTTATTCTTGAGCACC
(SEQ ID NO:3) and/or (HEX) TTCAGCCATATCTGGTTATTCTTGAGCACC (SEQ ID NO:4).Utilize the spy
SNP site of the present invention can be effectively detected in needle.
According to some embodiments of the present invention, the rs10272859 is the finger that the genotype of GC or GG is liver cancer high risk
Show.By analyzing the life cycle of rs10272859 genotype and hepatocarcinoma patient, inventors have found that carrying rs10272859 risk etc.
Liver cancer patient (the GG or GC) life cycle of position G equipotential does not carry risk equipotential patient considerably shorter than.Thus, it is possible to by utilizing institute
Kit is stated to detect the genotype of rs10272859 effectively to detect liver cancer.
According to the third aspect of the invention we, the present invention proposes a kind of equipment for liver cancer patient screening, comprising:
Sequencing device, the sequencing device is for being sequenced at least one of the full-length genome of patient, to obtain
Sequencing result；Wherein, at least one of described full-length genome is the region for including rs10272859.
Comparison device, the comparison device are connected with the sequencing device, and for being based on the sequencing result, determine
The gene type of rs10272859；
Analytical equipment, the analytical equipment are connected with the comparison device, and for determining liver cancer based on the SNP type
Risk.Inventor is comprehensive to be used based on family and based on the strategy of case-control, respective excellent to give full play to two kinds of strategies
Gesture.In Qualify Phase, two stage crowd is completed using the strategy based on case-control and is verified, rs10272859 is finally verified
It is significant related to liver cancer, liver cancer can be effectively detected using the equipment as a result,.
According to a particular embodiment of the invention, the sequencing device is for carrying out presumptive area in the full-length genome of patient
Sequencing, to obtain sequencing result；Wherein, the presumptive area is the upstream rs10272859 1kb, downstream 1kb.Thus, it is possible to
More efficiently it is sequenced.
Detailed description of the invention
Fig. 1 is the quantile plot of Guangxi family crowd's association results of embodiment according to the present invention 1.
Fig. 2 is family crowd's association results Manhattan, Guangxi figure of embodiment according to the present invention 1.
Fig. 3 is the quantile plot of Guangxi case-control crowd's association results of embodiment according to the present invention 1.
Fig. 4 is case-control crowd's association results Manhattan, Guangxi figure of embodiment according to the present invention 1.
Fig. 5 is each stage meta-analysis forest map of rs10272859 of embodiment according to the present invention 1.
Fig. 6 is that the rs10272859 risk equipotential G of embodiment according to the present invention 2 and liver cancer patient relationship with prognosis are illustrated
Figure.
Fig. 7 is the rs10272859 genotype and CDK14 gene expression figure of embodiment according to the present invention 3.
Specific embodiment
The embodiment of the present invention is described below in detail, examples of the embodiments are shown in the accompanying drawings.Below with reference to
The embodiment of attached drawing description is exemplary, it is intended to is used to explain the present invention, and is not considered as limiting the invention.
Embodiment
The genome-wide association study of 1 HBV associated hepatocellular carcinoma of embodiment
2. materials and methods
2.1 research object
2.1.1 genome-wide association study sample
This item genome-wide association study is divided into three conceptual phases: excavating stage, Qualify Phase I and Qualify Phase II.
All research objects are Chinese adult individual, are recruited from Eastern China, south, western part and the north.All case-control individuals
Be HBV persistent infection person, inclusion criteria be serum hepatitis B surface antigen (hepatitis B surface antigen,
) and hepatitis B core antibody (anti-HBc immunoglobulin G, the IgG anti-HBc) at least six that the is positive moon HBsAg.
The inclusion criteria of liver cancer patient is to be diagnosed as primary carcinoma of liver, does not receive Radiotherapy chemotherapy, and pass through proved by pathology.Case-control people
Affiliation is not present in group's individual.All equal signed informed consent forms of patient, and this research is ground through radiating with radiation medicine
Jiu Suo Ethics Committee approves to execute.
The excavation stage includes that (205 liver cancer core families, each family include one to Guangxi Hepatocellular core families crowd
HBV associated hepatocellular carcinoma patient and its healthy parents, totally 205 × 3=615 people) and Guangxi case-control crowd (355 cases with
360 controls, case are HBV associated hepatocellular carcinoma patient, are compareed as Chronic HBV carriers, similarly hereinafter).Guangxi core families crowd by
It recruits Guangxi tumour hospital in June, 2005 in July, 2010 from Guangxi, after full-length genome SNP data quality control, retains
189 HBV associated hepatocellular carcinoma core families are used for subsequent analysis.Wherein, the average age 35.7 ± 6.9 of core families propositus,
Male to female ratio 9.5.Guangxi case-control crowd is recruited for 2002 to 2008 by Guangxi tumour hospital, the crowd, that is, inventor
The excavation stage crowd of the international first term liver cancer genome-wide association study of development.By full-length genome SNP data quality control
Afterwards, it can be used for case 348 of subsequent analysis, compare 359.Case crowd average age 45.8 ± 10.6, male to female ratio
6.7；Control crowd average age 41.6 ± 12.1, male to female ratio 6.3.The excavation stage, full-length genome SNP (including
Rs10272859 it) is detected by full-length genome chip.
Qualify Phase I includes Shaanxi case-control crowd (1,095 cases and 394 controls).Case individual is by the 4th
Xijing hospital, army medical university and Tang Dou hospital in June, 2011 in July, 2013 recruit from Shaanxi, case crowd average age 51.0
± 10.5, male to female ratio 8.1.Control crowd is by recruiting the Tibet Institute for Nationalities's in December, 2011 in July, 2012 from Shaanxi, control
Crowd's average age 40.9 ± 14.1, male to female ratio 1.6.
Qualify Phase II includes Guangdong case-control crowd (574 cases and 580 controls), Beijing case-control people
Group's (276 cases and 266 controls), Jiangsu case-control crowd (50 cases and 141 controls) and Guangxi case-are right
According to crowd (285 cases and 623 controls).Wherein case-control crowd in Guangdong is by The Third Affiliated Hospital of Zhongshan University 2011
October in November, 2014 in year recruits from Guangdong, case crowd average age 49.4 ± 11.9, male to female ratio 9.6, compares crowd
Average age 48.1 ± 12.4, male to female ratio 8.4.Beijing case-control crowd is by Cancer Hospital of Chinese Academy of Medical Sciences 2003
It was recruited to 2 months 2009 March in year from Beijing, case crowd average age 55.9 ± 9.1, male to female ratio 6.1, control crowd is average
Age 55.50 ± 12.2, male to female ratio 5.5.Jiangsu case-control uses full-length genome typing data, part control number
According to the genome-wide association study that (91 controls) has been delivered from Nanjing Medical University, remaining case-control data carrys out runback
Attached Zhong Shan hospital, denier university does not deliver data, case crowd average age 52.4 ± 7.8, and all male individuals compare people
Group mean age 56.7 ± 9.6, male to female ratio 7.3.Guangxi case-control crowd's case crowd was by Guangxi tumour hospital 2004
January in October, 2012 recruits from Guangxi.Case crowd average age 47.8 ± 11.3, male to female ratio 8.2；Control crowd comes from
The perspective queue sample of Guangxi Yulin area liver cancer high risk population (2 months in October, 2012 in 2011) that inventor recruits is put down
Equal age 41.0 ± 10.4, male to female ratio 2.9.Crowd's information for genome-wide association study sample can be found in table 1.
Qualify Phase, rs10272859 are detected by TaqMan, detection primer:
Forward direction primer: GTCTCTTTCCACCTCTTCAACCA (SEQ ID NO:1)；
Backward primer: AGTCAGCAGGCAGTTAGAATACAGTATC (SEQ ID NO:2)；
Probe 1:(FAM) TCAGCCATATCTGcTTATTCTTGAGCACC (SEQ ID NO:3)；
Probe 2:(HEX) TTCAGCCATATCTGgTTATTCTTGAGCACC (SEQ ID NO:4).
2.2 association study
The association study of Guangxi case-control crowd is returned using the logistic (Logistic) based on additive model to be divided
Analysis method.Whether whether logistic regression correction gender the age, smoke, drink and whether have family history.Use PLINK
1.07 version of software calculates.
The association study of Guangxi family crowd examines (Transmission/Disequilibrium using transmission disequilibrium
Test, TDT) analysis.Whether TDT analysis is high by the probability for examining some SNP to pass to illness offspring from the parent of heterozygote
In desired value, judge whether the SNP may be related to the disease.It is calculated using 1.07 version of PLINK software.
It is Inspection Research with the presence or absence of systematic bias caused by the factors such as population stratification, we use quantile plot
(quantile-quantile plot, Q-Q plot) and the coefficient of expansion (genomic inflation factor) are sentenced
Not.The coefficient of expansion measures existing difference between the association P value actually obtained and expected P value.Quantile plot and the coefficient of expansion are equal
It is calculated using R software.
2.3 statistical test
Meta-analysis is carried out using METAL software, the odds ratio to obtain each stage association analysis and 95% confidence
Section merges.Cochran Q is examined and statistic I2To assess each stage with the presence or absence of heterogeneity, assembled with judgement
Analysis uses random-effect model or fixed-effect model.The gender and age interactive analysis of candidate SNP locus and individual
It is analyzed using logistic regression.Crowd's attribution score calculates according to the following formula: PAF%=100 × (x -1)/x, wherein x=
(1–p)2+2p(1–p)OR1+p2OR2, p represents group's allelic frequency, OR here1And OR2Represent heterozygote and homozygous risk
Than.
3. result
3.1 full-length genome SNP data quality control results
Guangxi case-control crowd is divided using 5.0 chip (Affymetrix 5.0) of Affymetrix company SNP
Type.It is controlled by quality, 348 cases and 359 controls, 288,424 autosome SNP enter subsequent analysis.All samples
This recall rate that is averaged reaches 99.03%.Guangxi family crowd uses China, illumina company chip (illumina
HumanOmniZhongHua-8BeadChip parting) is carried out.It is controlled by Quality Control, 189 core families, 694,794 SNP
Into subsequent analysis (table 2).All sample mean recall rates reach 99.69%.
2 Guangxi family crowd's quality control process of table
(a) unqualified family is removed using PLINK software
| Remove family number | |
| Verification and measurement ratio is low | 13 |
| Gender mispairing | 0 |
| Mendel's mistake | 3 |
Note: to be considered verification and measurement ratio low lower than 90% for verification and measurement ratio；Mendel's mistake exceeds 5% and is identified it is not biological significance
On
Family.
(b) SNP quality control process
3.3 association analysis results
Guangxi family crowd uses the research strategy based on family.Inventor closes Guangxi family crowd using TDT
Connection analysis.In the case where only a small amount of true association site is submerged in a large amount of false positive sites, TDT analysis is considered especially having
Effect, TDT analysis can be used to confirm or refuse the significant association results of report as a result,.Accordingly, it is reason to believe that, pass through TDT points
Analysis, can filter out really site relevant to liver cancer.TDT is the results show that in the family crowd of Guangxi, the expansion of association results
Coefficient is 1.04, and the numerical value is less than 1.05.Meanwhile quantile plot is deviated without obvious, as shown in Figure 1, wherein P value is by wide in Fig. 1
Western family crowd TDT analysis obtains, and black line is the fitting to 90% observation Distribution value.Illustrate the pass of Guangxi family crowd as a result,
It is coupled fruit and systematic bias is not present.It is worth noting that, right compared with case-to Genotyping errors based on the research strategy of family
More sensitive according to strategy, Genotyping errors caused by SNP is calculated often largely influence the accuracy of result.Inventor pays attention to
It arrives, calculates that SNP association results are not much different with the practical parting SNP association results coefficient of expansion, prompt calculates to a certain extent
As a result obvious deviation is not present.
Further, it is analyzed, is found numerous to the significant relevant site of liver cancer by TDT.Association results Manhattan figure is such as
Shown in Fig. 2, wherein abscissa is chromosome location in Fig. 2, and ordinate is-log10(P).Wherein comprising passing through full-length genome in the past
The SNP site positioned at KIF1B, HLA-DQA1/DRB1, HLA-DQ and BACH2 gene region of association study discovery.Prompt is based on
The TDT analysis of family can effectively find liver cancer related locus.
For the statistics efficiency for increasing the excavation stage, it is based on Guangxi case-control crowd, carries out the logic based on additive model
This base of a fruit regression analysis.The coefficient of expansion of association results be 1.01, as shown in figure 3, wherein in Fig. 3 P value by Guangxi case-control people
Group's logistic regression analysis obtains, and black line is the fitting to 90% observation Distribution value.Association results Manhattan figure such as Fig. 4 institute
Show, wherein abscissa is chromosome location in Fig. 4, and ordinate is-log10 (P).
3.4 crowd's verification results
Crowd's verifying is divided into two stages: Qualify Phase I is to 14 candidate SNP locus in the case-control crowd of Shaanxi
Carry out parting.Logistic regression analysis method based on additive model obtain 2 SNP sites (rs11163360 and
Rs10272859 it) is still significantly associated with and relating heading is consistent with the stage of excavation.Qualify Phase II is to this 2 SNP sites into one
Step is analyzed in Guangdong, Beijing, Jiangsu and Guangxi case-control crowd.Logistic regression based on additive model point
Analysis method finds that rs10272859 is still significantly associated with and relating heading is consistent (table 3).
Further check that the site rs10272859 in the parting situation in each stage, finds the site in Guangxi family crowd
In be to obtain (be practical parting obtain) by inferring in the case-control of Guangxi.To exclude mistake caused by SNP infers,
TaqMan parting further has been carried out in the family crowd of Guangxi to rs10272859.Choose wherein 524 samples, success parting
495, success rate 94.5%.TaqMan genotyping result and the result concordance rate that SNP is calculated are higher, reach 98.4% (table 4).Though
So the two concordance rate is higher, but generates certain influence to TDT inspection result.Using TaqMan as a result, being updated to TDT inspection
Afterwards, rs10272859 still significant association, P=0.023 in the family crowd of Guangxi.
Meta-analysis discovery, merges all groups' as a result, the P value of rs10272859 reaches 2.62 × 10-8(table 3) surpasses
The 5 × 10 of genome-wide association study requirement are crossed-8Threshold value, prompt rs10272859 it is significant related to liver cancer.Meta-analysis
Forest map it is as shown in Figure 5, wherein four blue lines represent GWAS stage family crowd, GWAS in this research from top to bottom in Fig. 5
The Hazard ratio of stage case-control crowd, conceptual phase I and II.Diamond shape represents the Hazard ratio after merging.Meta-analysis uses
METAL software.
Further rs10272859 is analyzed with the gender of individual and age with the presence or absence of reciprocation.Do not send out
Existing significant difference (Pheterogeneity=0.79 and 0.39, table 5).
2 rs10272859 of embodiment is related to prognosis of patients with feminine
The progress of reported studies have shown that part SNP and tumour is closely related.Such as it is located at that SLC39A6 gene 5 ' is non-turns over
The rs7242481 translated on area (5 ' UTR) is significant related to the overall survival phase of esophageal squamous cell carcinoma patient, and CCL20 gene is attached
The breast cancer patients overall survival phase of close rs4458204 and estrogen receptor (Estrogen receptor, ER) feminine gender are significant
It is related.It is interesting that finding that closely related SNP site rs17401966 occurs with liver cancer before inventor, it is proved to recently
It is significant related to the prognosis of hepatocarcinoma patient.So, whether rs10272859 genotype is significant related to prognosis of patients with feminine.Verifying
In stage II, part sample has more comprehensive clinical information (n=104) in the case-control crowd of Guangxi, and inventor defines the sample
This collection is sample set 1 (Sample set 1).By analyzing the life cycle of rs10272859 genotype and hepatocarcinoma patient, inventor
It was found that liver cancer patient (the GG or GC) life cycle for carrying rs10272859 risk equipotential G equipotential does not carry risk etc. considerably shorter than
Position (P=9.0 × 10 patient (CC)-3, HR=2.33, Fig. 6 (A), Hazard ratio by Cox proportional hazard model correction gender, the age and
TNM stage is calculated and is obtained).Inventor has more comprehensive clinical information in the hepatocarcinoma patient that Nanjing Aug. 1st hospital Oncological Surgery is collected
(n=88), and the sample set is defined as sample set 2 (Sample set 2).Using TaqMan technology to these samples
Rs10272859 carries out parting.By calculating inventors have found that carrying the liver cancer patient of rs10272859 risk equipotential G equipotential
(GG or GC) life cycle is also considerably shorter than and does not carry (P=8.6 × 10 risk equipotential patient (CC)-3, HR=2.46, Fig. 6 (B), wind
Danger is obtained than being calculated by Cox proportional hazard model correction gender, age and TNM stage).Further pass through the comprehensive number of gene expression
This discovery is verified according to the data set (GSE38323, sample set 3) in library.The sample set includes 286 liver cancer patients altogether.The sample
This collection sample does not carry out parting, but the SNP site rs6976601 (r with its strong linkage disequilibrium to rs102728592=0.98)
The practical parting in the sample set.Inventor had found by analysis, carry rs6976601 risk equipotential A hepatocarcinoma patient (AA or
AG) life cycle, which is significantly shorter than, does not carry risk equipotential patient (GG) (P=0.14, HR=1.30, Fig. 6 C).Although the P value does not arrive
Up to significant, inventors have found that carrying the hepatocarcinoma patient of rs6976601 risk equipotential A, five year survival rate does not carry wind substantially less than
Dangerous equipotential patient (59.1% to 71.3%；P=0.031).To sum up, it was demonstrated that the life of rs10272859 genotype and liver cancer patient
Deposit phase significant correlation.
3 tumor susceptibility gene positioning analysis of embodiment and pathogenic sites Exploring Analysis
Rs10272859 is located at the region 7q21.13, linkage disequilibrium module about 110-kb where the site, the interior packet of module
Gene containing CDK14.In the module, rs1859023 (site and rs10272859 strong linkage disequilibrium, r in Chinese population2
=0.78) it is reported in significant related to the generation of coronary heart disease in non-descendants' American population.
For the candidate tumor susceptibility gene for further proving the region CDK14, inventor is to rs10272859 base in liver samples
Because type and CDK14 gene expression correlation are analyzed.First to totally 88 liver cancer of " sample set 2 " for survival analysis
Sample carries out CDK14 quantitative gene expression.Wherein 24 sample mRNA quantitatively fail, and final 64 samples enter analysis.Invention
People's discovery carries the sample (GG and GC) of rs10272859 risk equipotential G, and CDK14 expression, which is significantly higher than, does not carry risk equipotential
Sample (CC) (P=0.0052, Fig. 7 (A)).Further utilize 82 hepatocarcinoma patients of cancer gene group map in the works
SNP and gene expression data, having obtained similar conclusion, (P=0.011, Fig. 7 (B), P value use both-end non-paired t test meter
It calculates).
To sum up, the new discovery susceptibility regions 7q21.13 of one HBV associated hepatocellular carcinoma is studied.The susceptible base of candidate in the region
Because may be CDK14.Of the invention has found that it is likely that the high-risk individuals for helping preferably to screen HBV associated hepatocellular carcinoma.
In addition, term " first ", " second " are used for descriptive purposes only and cannot be understood as indicating or suggesting relative importance
Or implicitly indicate the quantity of indicated technical characteristic.Define " first " as a result, the feature of " second " can be expressed or
Implicitly include at least one this feature.In the description of the present invention, the meaning of " plurality " is at least two, such as two, three
It is a etc., unless otherwise specifically defined.
In the description of this specification, reference term " one embodiment ", " some embodiments ", " example ", " specifically show
The description of example " or " some examples " etc. means specific features, structure, material or spy described in conjunction with this embodiment or example
Point is included at least one embodiment or example of the invention.In the present specification, schematic expression of the above terms are not
It must be directed to identical embodiment or example.Moreover, particular features, structures, materials, or characteristics described can be in office
It can be combined in any suitable manner in one or more embodiment or examples.In addition, without conflicting with each other, the skill of this field
Art personnel can tie the feature of different embodiments or examples described in this specification and different embodiments or examples
It closes and combines.
Although the embodiments of the present invention has been shown and described above, it is to be understood that above-described embodiment is example
Property, it is not considered as limiting the invention, those skilled in the art within the scope of the invention can be to above-mentioned
Embodiment is changed, modifies, replacement and variant.
Claims (5)
1. detecting purposes of the reagent of SNP in reagent preparation box, the kit is used for liver cancer patient screening, and the SNP is
rs10272859。
2. purposes according to claim 1, which is characterized in that the reagent includes primer and/or probe.
3. purposes according to claim 2, which is characterized in that the primer be GTCTCTTTCCACCTCTTCAACCA and
AGTCAGCAGGCAGTTAGAATACAGTATC。
4. purposes according to claim 2, which is characterized in that the probe is
TCAGCCATATCTGcTTATTCTTGAGCACC and/or TTCAGCCATATCTGgTTATTCTTGAGCACC.
5. purposes according to claim 1, which is characterized in that the rs10272859 is that the genotype of GC or GG is liver cancer
The instruction of high risk.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610373409.7A CN106011244B (en) | 2016-05-31 | 2016-05-31 | Detect the application of the region 7q21.13 SNP reagent |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610373409.7A CN106011244B (en) | 2016-05-31 | 2016-05-31 | Detect the application of the region 7q21.13 SNP reagent |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106011244A CN106011244A (en) | 2016-10-12 |
| CN106011244B true CN106011244B (en) | 2019-07-16 |
Family
ID=57091582
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610373409.7A Expired - Fee Related CN106011244B (en) | 2016-05-31 | 2016-05-31 | Detect the application of the region 7q21.13 SNP reagent |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106011244B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112458160B (en) * | 2020-08-27 | 2022-05-31 | 中国人民解放军军事科学院军事医学研究院 | Method and kit for detecting polymorphism of 11q14.2 region related to severe coronavirus pneumonia, and application of method and kit |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103060312A (en) * | 2011-10-24 | 2013-04-24 | 上海市肿瘤研究所 | Gene marker of predicting primary hepatic carcinoma metastatic potential |
| WO2014075228A1 (en) * | 2012-11-13 | 2014-05-22 | 深圳华大基因医学有限公司 | Method, system and computer readable medium for determining whether chromosome number variation exists in biological sample |
| CN104053789A (en) * | 2012-05-14 | 2014-09-17 | 深圳华大基因医学有限公司 | Method, System And Computer Readable Medium For Determining Base Information In Predetermined Area Of Fetus Genome |
-
2016
- 2016-05-31 CN CN201610373409.7A patent/CN106011244B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103060312A (en) * | 2011-10-24 | 2013-04-24 | 上海市肿瘤研究所 | Gene marker of predicting primary hepatic carcinoma metastatic potential |
| CN104053789A (en) * | 2012-05-14 | 2014-09-17 | 深圳华大基因医学有限公司 | Method, System And Computer Readable Medium For Determining Base Information In Predetermined Area Of Fetus Genome |
| WO2014075228A1 (en) * | 2012-11-13 | 2014-05-22 | 深圳华大基因医学有限公司 | Method, system and computer readable medium for determining whether chromosome number variation exists in biological sample |
Non-Patent Citations (1)
| Title |
|---|
| Submitted SNP（ss）Details: ss18025108570;hsieh_4121501;《dbSNP》;20150715;第1页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106011244A (en) | 2016-10-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Dai et al. | Identification of risk loci and a polygenic risk score for lung cancer: a large-scale prospective cohort study in Chinese populations | |
| Long et al. | DNA methylation-driven genes for constructing diagnostic, prognostic, and recurrence models for hepatocellular carcinoma | |
| Trépo et al. | Common genetic variation in alcohol-related hepatocellular carcinoma: a case-control genome-wide association study | |
| Shen et al. | Biomarker MicroRNAs for diagnosis, prognosis and treatment of hepatocellular carcinoma: a functional survey and comparison | |
| CN105243295B (en) | With the relevant heredity of cancer or the detection of molecular distortion | |
| Bagnoli et al. | Identification of a chrXq27. 3 microRNA cluster associated with early relapse in advanced stage ovarian cancer patients | |
| Liu et al. | Genetic polymorphisms and lung cancer risk: Evidence from meta-analyses and genome-wide association studies | |
| Wang et al. | Development and experimental verification of a prognosis model for cuproptosis-related subtypes in HCC | |
| Liu et al. | rs11614913 polymorphism in miRNA-196a2 and cancer risk: an updated meta-analysis | |
| Yu et al. | Overexpression of PARPBP correlates with tumor progression and poor prognosis in hepatocellular carcinoma | |
| Yan et al. | Identification of hub genes associated with progression and prognosis in patients with bladder cancer | |
| Xiao et al. | A ferroptosis-related lncRNAs signature predicts prognosis and therapeutic response of gastric cancer | |
| Zhang et al. | A large-scale genome-wide gene-gene interaction study of lung cancer susceptibility in Europeans with a trans-ethnic validation in Asians | |
| Wang et al. | Identification of a six-gene signature associated with tumor mutation burden for predicting prognosis in patients with invasive breast carcinoma | |
| Xu et al. | Prognostic immunophenotyping clusters of clear cell renal cell carcinoma defined by the unique tumor immune microenvironment | |
| Wei et al. | Genome-wide association study identifies a genetic prediction model for postoperative survival in patients with hepatocellular carcinoma | |
| Ren et al. | Association of specific genotypes in metastatic suppressor HTPAP with tumor metastasis and clinical prognosis in hepatocellular carcinoma | |
| Lou et al. | Patient-level DNA damage repair pathway profiles and anti-tumor immunity for gastric cancer | |
| CN106011244B (en) | Detect the application of the region 7q21.13 SNP reagent | |
| Peng et al. | Identification of a novel prognostic signature of genome instability-related LncRNAs in early stage lung adenocarcinoma | |
| Yin et al. | Head and neck squamous cell carcinoma subtypes based on immunologic and hallmark gene sets in tumor and non-tumor tissues | |
| Takeda et al. | Oncogenic transcriptomic profile is sustained in the liver after the eradication of the hepatitis C virus | |
| Wang et al. | Characteristics and clinical significance of T-cell receptor repertoire in hepatocellular carcinoma | |
| Zhang et al. | MiRNA polymorphisms and hepatocellular carcinoma susceptibility: a systematic review and network meta-analysis | |
| Gumilas et al. | Potential relative quantities of miR-122 and miR-150 to differentiate hepatocellular carcinoma from liver cirrhosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190716 Termination date: 20210531 |