CN106008256B - A kind of derivative compound and its preparation method and application of desferrioxamining with bone affinity - Google Patents
A kind of derivative compound and its preparation method and application of desferrioxamining with bone affinity Download PDFInfo
- Publication number
- CN106008256B CN106008256B CN201610380476.1A CN201610380476A CN106008256B CN 106008256 B CN106008256 B CN 106008256B CN 201610380476 A CN201610380476 A CN 201610380476A CN 106008256 B CN106008256 B CN 106008256B
- Authority
- CN
- China
- Prior art keywords
- acid
- catalyst
- compound
- formula
- unsubstituted
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 0 C*C(C)(C(C(C)(CN)C(C)(CC*C1O*1C)**)N)N Chemical compound C*C(C)(C(C(C)(CN)C(C)(CC*C1O*1C)**)N)N 0.000 description 5
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C239/00—Compounds containing nitrogen-to-halogen bonds; Hydroxylamino compounds or ethers or esters thereof
- C07C239/08—Hydroxylamino compounds or their ethers or esters
- C07C239/16—Hydroxylamino compounds or their ethers or esters having nitrogen atoms of hydroxylamino groups further bound to carbon atoms of hydrocarbon radicals substituted by nitrogen atoms not being part of nitro or nitroso groups
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C243/00—Compounds containing chains of nitrogen atoms singly-bound to each other, e.g. hydrazines, triazanes
- C07C243/24—Hydrazines having nitrogen atoms of hydrazine groups acylated by carboxylic acids
- C07C243/26—Hydrazines having nitrogen atoms of hydrazine groups acylated by carboxylic acids with acylating carboxyl groups bound to hydrogen atoms or to acyclic carbon atoms
- C07C243/28—Hydrazines having nitrogen atoms of hydrazine groups acylated by carboxylic acids with acylating carboxyl groups bound to hydrogen atoms or to acyclic carbon atoms to hydrogen atoms or to carbon atoms of a saturated carbon skeleton
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention develops a kind of derivative and its preparation method and application of desferrioxamining with bone affinity.More specifically, the present invention provides a kind of compounds and its pharmaceutically acceptable salt, ester, amide, carboxylic acid halides, hydrate or solvate of the structure with formula (1).The present invention also provides the preparation method of the compound of the formula (1) and its preparing the application for treating osteoporosis, osteonecrosis, delayed fracture more or in the drug of disunion and bone defect.
Description
Technical field
It desferrioxamines derivative compound the present invention relates to one kind, it is structurally-modified by being carried out to the compound so that the chemical combination
Object has excellent iron complexing power and bone affinity simultaneously.The present invention also provides the preparation sides of the derivative compound of desferrioxamining
Method and its prepare for treat osteoporosis, osteonecrosis, delayed fracture healing or the drug of disunion and bone defect in
Using.
Background technology
Osteoporosis (osteoporosis, OP) is increased with the reduction of bone amount progressive, bone micro-structure destruction, bone brittleness
For the bone metabolic disease of major pathologic features, easily hair fracture is one of most serious consequence caused by osteoporosis.Osteoporosis
It is not only to endanger the elderly's especially postmenopausal women's health and influences the medical problem of its quality of life, and have become current
The serious problem of society today of aging society, for this purpose, a large amount of human and material resources are all poured into countries in the world, to illustrate its generation machine
On the basis of reason, reasonable, potent control strategy is proposed.
The drug therapy of osteoporosis further includes estrogen in addition to except application calcium preparation and the basis of calcium uptake being promoted to intervene
Class, selective estrogen receptor modulators, calcitonin class, diphosphonic acid salt, parathormone, strontium salt etc..Currently, turning for bone
During changing, the factor " is coupled " between osteoblastic bon e formation and osteoclastic bone resorption function, developing or into
Row clinical test RANKL albumen and osteosclerosis albumen soluble antibody etc. treat the biological agent of osteoporosis.
Ischemic osteonecrosis especially ischemic femoral head necrosis (Osteonecrosis of the femoral head,
ONFH), it is divided to traumatic and two class of atraumatic, all using bone necrosis progrediens, bone information as major pathologic features.In joint part
(such as ONFH) because of subchondral osteonecrosis, absorbs, articular cartilage can be caused to collapse, and disability rate is high.Senile osteoporosis hip
Fracture, is the Etiological of traumatic ONFH.So far, the pathogenesis in relation to ischemic osteonecrosis is unclear, effective to treat
Drug lacks, and the current tentative validity using drug therapies such as low molecular weight heparin, diphosphonate, Pravastatins has to be determined
Or it is difficult to gather effect.
Although the relevance between osteoporosis and osteonecrosis waits to illustrate, more and more studies have shown that osteoporosis
Occurrence and development overloaded with internal iron and bone tissue blood supply insufficiency is closely related (especially in the elderly), and have been considered as
The independent factor of the occurrence and development of osteoporosis；Bone tissue blood supply obstacle caused by unknown cause is osteonecrosis occurrence and development
Initiating agent, the also viewpoint to know together now.Therefore, improve and restore bone tissue blood supply, not only there is protection bone tissue to construct,
The effect of preventing osteoporosis and osteonecrosis, and because of the reduction of osteoporotic fracture, the incidence of osteonecrosis will be made to lower.
It desferrioxamines also known as Deferoxamine (deferoxamine, DFO) can be with 1 with structure shown in formula (3):1 ratio
With Fe3+In conjunction with.
DFO starts to be applied to clinic in the 1970's as iron ion complexing agent, is mainly used for treating hemochromatosis
With thalassemia, sickle cell anemia etc. due to the disease of transfusional chronic iron overloading.Applicant in recent years
The study found that the characteristic of DFO chelated iron ions, can activate osteoblast cells hypoxemia/hypoxia inducible factor (HIF)-α accesses,
And bone tissue angiogenesis is stimulated, and then promoting bone growing and Bone Defect Repari, DFO activate hypoxemia/HIF- α accesses can promoting bone growing
Beneficial effect, guiding the research and development of medicinal hypoxia-mimicking compound and the prevention of osteopathy damage, and in hot research content
Development trend.Therefore, DFO can overload the two of iron ion and indirect induced bone tissue blood vessel at least through being directly complexed in bone tissue
Kind approach, and play bone protective effect.Although DFO uses comparatively safe, half-life short, slowly subcutaneous or venoclysis is needed,
And because of the relatively low feature of the water-soluble features of DFO and Blood flow, metabolism, keep distributive laws of the DFO in bone tissue relatively low；
DFO dosage and administration time are increased, the adverse reactions such as hearing or vision disorder, growth retardation, textured bone can be caused, from
And the bone function and effect of DFO are limited, it is also difficult to treat suitable for the systemic drug of progressive bone loss diseases at present.
In order to solve problem above, it was found by the inventors of the present invention that it is special structurally-modified by being carried out to DFO, it can be with
Make it that the feature affinity to bone tissue be presented, while not influencing the activity of DFO chelated iron ions, thus obtains having
The DFO derivative compounds of bone can be realized using the compound and import DFO and be concentrated in bone tissue, to specificity
Ground increases concentration of the DFO in bone tissue, improves it and prevents the bone metabolic diseases drug effects such as osteoporosis, osteonecrosis, reduces medicine
Object systematicness ill-effect.
Invention content
The first aspect of the invention provide a kind of formula (1) compound represented and its pharmaceutically acceptable salt,
Ester, amide, carboxylic acid halides, hydrate or solvate：
Wherein R1Selected from following group：Substituted or unsubstituted C1-C10Alkyl, substituted or unsubstituted C1-C10Alkenyl takes
Generation or unsubstituted C1-C10Alkoxy, substituted or unsubstituted C1-C10Alkenyloxy group, fluorine, chlorine, bromine and iodine；
R2-R4It is each independently selected from following group each independently：Hydroxyl, substituted or unsubstituted C1-C10Alkyl takes
Generation or unsubstituted C1-C10Alkenyl, substituted or unsubstituted C1-C10Alkoxy, substituted or unsubstituted C1-C10Alkenyloxy group, fluorine,
Chlorine, bromine and iodine；
R5-R7It is each independently selected from following group：Hydrogen, hydroxyl, substituted or unsubstituted C1-C10Alkyl, substitution do not take
The C in generation1-C10Alkenyl, substituted or unsubstituted C1-C10Alkoxy, substituted or unsubstituted C1-C10Alkenyloxy group, fluorine, chlorine, bromine and
Iodine；
R8-R45It is each independently selected from following group：Hydrogen, hydroxyl, substituted or unsubstituted C1-C10Alkyl, substitution or not
Substituted C1-C10Alkenyl, substituted or unsubstituted C1-C10Alkoxy, substituted or unsubstituted C1-C10Alkenyloxy group, fluorine, chlorine, bromine
And iodine；
M is integer selected from the following：1,2,3,4,5,6,7,8,9,10,11 and 12；
A is derived from the group of the organic multicomponent acid comprising 1-8 nitrogen-atoms and 2-6 carboxyl, passes through one of nitrogen
Atom is connected with the other parts of compound shown in formula (1).
According to embodiment of the present invention, the A groups are groups selected from the following, pass through the list of shown nitrogen-atoms
Key is connected with the other parts of compound shown in formula (1)：
In the above group, n is integer selected from the following：1,2,3,4,5 and 6.
A preferred embodiment according to the present invention, in formula (1) compound represented, R1Selected from following group：
Substituted or unsubstituted C1-C4Alkyl, substituted or unsubstituted C1-C4Alkenyl, substituted or unsubstituted C1-C4Alkoxy, substitution
Or unsubstituted C1-C4Alkenyloxy group, fluorine, chlorine, bromine and iodine；
R2-R4It is each independently selected from following group：Hydroxyl, substituted or unsubstituted C1-C4Alkyl, substitution or unsubstituted
C1-C4Alkenyl, substituted or unsubstituted C1-C4Alkoxy, substituted or unsubstituted C1-C4Alkenyloxy group, fluorine, chlorine, bromine and iodine；
R5-R7It is each independently selected from following group：Hydrogen, hydroxyl, substituted or unsubstituted C1-C4Alkyl, substitution do not take
The C in generation1-C4Alkenyl, substituted or unsubstituted C1- C4 alkoxies, substituted or unsubstituted C1-C4Alkenyloxy group, fluorine, chlorine, bromine and iodine；
R8-R45It is each independently selected from following group：Hydrogen, hydroxyl, substituted or unsubstituted C1-C4Alkyl, substitution do not take
The C in generation1-C4Alkenyl, substituted or unsubstituted C1-C4Alkoxy, substituted or unsubstituted C1-C4Alkenyloxy group, fluorine, chlorine, bromine and iodine.
The second aspect of the invention provides a kind of method for the compound being used for preparing the formula (1), this method packet
Include following steps：
(i) so that the organic multicomponent acid comprising 1-8 nitrogen-atoms and 2-6 carboxyl is reacted with alcohol, with to described organic more
All carboxyls of first acid are protected；
(ii) so that carboxyl made from step (i) receives the organic multicomponent acid and C of protection3-C14The anhydride reaction of diacid；
(iii) so that the product of step (ii) and the derivatives reaction of desferrioxamining or desferrioxamine with formula (2)；
(iv) carboxyl of product made from step (iii) being protected is deprotected, obtains the chemical combination of formula (1)
Object:
Wherein in the structure shown in formula (2), R1Selected from following group：Substituted or unsubstituted C1-C10Alkyl, substitution or
Unsubstituted C1-C10Alkenyl, substituted or unsubstituted C1-C10Alkoxy, substituted or unsubstituted C1-C10Alkenyloxy group, fluorine, chlorine,
Bromine and iodine；It is preferred that substituted or unsubstituted C1-C4Alkyl, substituted or unsubstituted C1-C4Alkenyl, substituted or unsubstituted C1-C4
Alkoxy, substituted or unsubstituted C1-C4Alkenyloxy group, fluorine, chlorine, bromine and iodine；
R2-R4It is each independently selected from following group：Hydroxyl, substituted or unsubstituted C1-C10Alkyl, substitution or unsubstituted
C1-C10Alkenyl, substituted or unsubstituted C1-C10Alkoxy, substituted or unsubstituted C1-C10Alkenyloxy group, fluorine, chlorine, bromine and iodine；
It is preferred that hydroxyl, substituted or unsubstituted C1-C4Alkyl, substituted or unsubstituted C1-C4Alkenyl, substituted or unsubstituted C1-C4Alkane
Oxygroup, substituted or unsubstituted C1-C4Alkenyloxy group, fluorine, chlorine, bromine and iodine；
R5-R7It is each independently selected from following group：Hydrogen, hydroxyl, substituted or unsubstituted C1-C10Alkyl, substitution do not take
The C in generation1-C10Alkenyl, substituted or unsubstituted C1-C10Alkoxy, substituted or unsubstituted C1-C10Alkenyloxy group, fluorine, chlorine, bromine and
Iodine；It is preferred that hydrogen, hydroxyl, substituted or unsubstituted C1-C4Alkyl, substituted or unsubstituted C1-C4It is alkenyl, substituted or unsubstituted
C1- C4 alkoxies, substituted or unsubstituted C1-C4Alkenyloxy group, fluorine, chlorine, bromine and iodine；
R8-R45It is each independently selected from following group：Hydrogen, hydroxyl, substituted or unsubstituted C1-C10Alkyl, substitution or not
Substituted C1-C10Alkenyl, substituted or unsubstituted C1-C10Alkoxy, substituted or unsubstituted C1-C10Alkenyloxy group, fluorine, chlorine, bromine
And iodine；Hydrogen, hydroxyl, substituted or unsubstituted C1-C4Alkyl, substituted or unsubstituted C1-C4Alkenyl, substituted or unsubstituted C1-
C4Alkoxy, substituted or unsubstituted C1-C4Alkenyloxy group, fluorine, chlorine, bromine and iodine.
According to embodiment of the present invention, in the method for the compound of formula (1), described includes 1-8
Nitrogenous organic multicomponent shown in one or more in following structural formula of the organic multicomponent acid of a nitrogen-atoms and 2-6 carboxyl
Acid：
According to embodiment of the present invention, the reaction of the step (i) in a solvent, there are catalyst the case where
Lower progress,
The alcohol is selected from：C1-C10Alkylol and C7-C16Aryl alcohol；Preferably benzyl alcohol；
The solvent is selected from：Benzene, toluene, hexamethylene, acetone, ether, dimethyl ether, dipropyl ether and they in it is arbitrary
The mixture of two or more；
The catalyst is acid catalyst selected from the following：Sulfuric acid, hydrochloric acid, phosphoric acid, nitric acid, C1-C6Alkyl sulfonic acid, benzene sulphur
Acid, toluenesulfonic acid；Preferably p-methyl benzenesulfonic acid.
According to another implementation of the invention, the step (ii) carries out in solvent selected from the following：Including one
The liquid alkane of a or multiple halogen atoms, the halogen atom are selected from fluorine, chlorine, bromine, iodine；Preferably, the solvent that step (ii) uses
Selected from monochloro methane, dichloromethane, chloroform, carbon tetrachloride and its any mixture.
According to another implementation of the invention, the step (iii) in a solvent, using catalyst under conditions of
Carried out,
The solvent is selected from：Benzene, toluene, hexamethylene, acetone, ether, dimethyl ether, dipropyl ether, N,N-dimethylformamide
And the arbitrary mixture of two or more in them；
The catalyst is selected from：Hexafluorophosphoric acid benzotriazole -1- bases-oxygroup tripyrrole alkyl phosphorus (PyBOP), 1H- benzos
(dimethylamino) the phosphorus hexafluorophosphate of triazol-1-yl oxo three (BOP), 1- hydroxy benzo triazoles (HOBT) and N, N'- bis-
Carbodicyclo hexylimide (DCC), preferably hexafluorophosphoric acid benzotriazole -1- bases-oxygroup tripyrrole alkyl phosphorus (PyBOP).
According to another implementation of the invention, the carboxyl deprotection reaction of the step (iv) is existed in catalyst
In the case of by hydrogenation carry out,
The catalyst is selected from loaded noble metal catalyst, preferably load type palladium, platinum, rhodium catalyst, more preferably
Palladium carbon.
A preferred embodiment according to the present invention, the substituent R in formula described above (1) and formula (2)1To R45It is
When substituted group, indicate any one or more hydrogen atoms on these groups by one or more bases selected from the following
Group's substitution：C1-C10Alkyl, C1-C4Alkyl, C1-C10Alkenyl, C1-C4Alkenyl, C1-C10Alkoxy, C1-C4Alkoxy, cyano, fluorine,
Chlorine, bromine, iodine, hydroxyl, ester group, ether, amide groups, sub- amide groups.
The third aspect of the invention provides a kind of pharmaceutical composition, which includes：
The compound and its pharmaceutically acceptable salt of formula (1) described above, ester, amide, carboxylic acid halides, hydrate or solvent close
Object；
(ii) one or more in pharmaceutically acceptable optional excipient, filler, carrier and diluent；And
(iii) the optional pharmaceutical active different from component (i), the pharmaceutical active are selected from：Alendronic acid
Sodium piece, zolendronate sodium, Pamidronate Disodium, vitamin D, risedronate sodium, Teriparatide, Strontium Ranelate, Raloxifene, drop
Calcium element, estrogen, Nilestriol, female pregnant sharp, the precious particle of tamoxifen, Ipriflavone, clodronate disodium piece, bone pine, times U.S.
Power, Tibolone Tablets, solid Su An, disodium etidronate piece, Bang Telin, Tridin, calcium gluconate tablet, calcium-zinc gluconate are oral
Solution, Premelle Cycle, ribavirin tablet, elcatonin, Yi Weite, Bei Bang, Calcitonin Salmon, kidney osteocomma, oyster shell calcium, the strange carbonic acid of calcium that
Calcium D3 pieces, vitamin D 2 and calcium colloid injection, Gai Ruining, clodronate disodium capsule, Alfacalcidol, injection bone peptide, deer melon are more
Peptide injection, DANHONG ZHUSHEYE, Sofflower injection, Cefradine, clindamycin, vancomycin, D-40 amino
Acid, hydroxyethyl starch injection liquid, low molecular weight heparin sodium injection, sodium lactate ringer's injection, Mannitol sodium chloride injection.
The fourth aspect of the invention provides the compound and its pharmaceutically acceptable salt, ester, acyl of shown formula (1)
Amine, carboxylic acid halides, hydrate or solvate are being prepared for treating osteoporosis, osteonecrosis, delayed fracture healing or disunion
With the application in the drug of bone defect.
Description of the drawings
The principle of the present invention and embodiment are described in conjunction with attached drawing in the present invention.
Fig. 1 is the flow chart of the method for the compound of synthesis formula (1) according to one embodiment of the present invention；
Fig. 2 be according to one embodiment of the present invention compound to the characterization result of ferric ion complexing power；
Fig. 3 shows that the stimulation osteoblast of compound according to one embodiment of the present invention expresses the table of HIF-1 α albumen
Levy result；
Fig. 4 shows the stimulation osteoblast of compound according to one embodiment of the present invention VEGF expression, HO-1mRNA
Characterization result (real-time-PCR)；
Fig. 5 shows the characterization result of compound parent's bone performance according to one embodiment of the present invention.
Specific implementation mode
The present invention will be further described in detail in the following contents.It should be noted however that below
Specific implementation mode only provides the concrete operations example of the present invention in an exemplary fashion, but protection scope of the present invention is not
It is only limitted to this.Protection scope of the present invention is only limited only by the claims that follow.Those skilled in the art can be apparently
Expect, can claims of the present invention limit protection domain within to embodiment of the present invention carry out it is various its
Its improvement and replacement, and remain able to realize identical technique effect, reach the ultimate technical purpose of the present invention.
In the present invention, unless indicated to the contrary, all ratios are weight ratio, and all percentage is weight
Percentage, the unit of temperature are DEG C that the unit of pressure is pa.Room temperature refers to environment temperature conventional in laboratory, with season and position
Variation is set, usually 25 DEG C.In addition, all numberical ranges for describing of the present invention include end value and may include will be disclosed
The new numberical range that the upper and lower bound of range arbitrarily combines mutually.For example, if disclosing the weight of certain component
Percentage composition is 10~30 weight %, and preferably 15~25 weight %, more preferable 20~23 weight % is then equivalent to and also discloses
Numberical range below：10~15 weight %, 10~25 weight %, 10~20 weight %, 10~23 weight %, 15~30 weights
Measure %, 15~20 weight %, 15~23 weight %, 20~25 weight %, 23~25 weight %.
The present invention formula (1) compound be by desferrioxamine (DFO) shown in formula (3) or formula (2) shown in de-iron
Quick derivative compound carries out prepared by further structurally-modified.It can be seen that de-iron sensing structure actually wraps shown in formula (3)
Within the scope of including the structure shown in formula (2).It desferrioxamines shown in the formula (2) that uses in the synthesis step of the present invention derivatization
Close to desferrioxamine shown in object and formula (3) and belong to commercial product well known in the art, be purchased from Sigma, Chinese medicines group and
Aladdin company.It is specifically used in the experiment of the present invention desferrioxamine, the derivative compound a that desferrioxamines, derivative compounds of desferrioxamining
Object b, the derivative compound c that desferrioxamines are purchased from Sigma companies.In addition, those skilled in the art can also be according to required final
The structure of product is arbitrarily replaced and is modified on the molecule desferrioxamined.
In order to prepare formula (1) compound represented, inventor's use includes 3-14 carbon, preferably 3-8 carbon, more
It is preferred that end nitrogen-atoms of the diacyl linkages of 3-6 carbon by modified group A and in desferrioxamining is covalently attached.According to this hair
A bright embodiment, the group A are by the organic polycarboxylic acid comprising at least one nitrogen-atoms and at least two carboxyls
It sloughs obtained from a hydrogen atom on its nitrogen-atoms.By such structurally-modified so that the compound totality upper table of formula (1)
Reveal splendid bone affinity, while iron complexing power is essentially unaffected.
Fig. 1, which is shown, to be desferrioxamined shown in the formula (3), describes the present invention's for succinic anhydride and iminodiacetic acid
The synthesis course of bone affinity compound (DFO-SF).It should be noted however that protection scope of the present invention is not limited to that,
Raw materials used type, reaction condition and operating procedure can be adjusted according to the concrete structure of target product.
As shown in Figure 1, the structure of the iminodiacetic acid used is as follows：
In first step shown in Fig. 1, using benzyl alcohol as protective agent, under the catalytic action of p-methyl benzenesulfonic acid
It reacts so that two carboxyls of iminodiacetic acid occur esterification with benzyl alcohol and protected.
In second step shown in Fig. 1 so that the product of first step is with succinic acid acid anhydrides in chloroform solvent
Reaction, to generate amide structure.
In third step shown in Fig. 1 so that the product of second step desferrioxamines (DFO) in solvent N, N- diformazans
It in base formamide, is reacted under conditions of there are PyBOP catalyst, the iminodiacetic acid to be esterified passes through fourth two
Acyl group is connected with the nitrogen-atoms for end of desferrioxamining.
In the 4th step shown in Fig. 1, de- benzyl (remove-insurance is carried out to the product of third step using palladium-carbon catalyst
Shield reaction), final target compound is made.
The compound of the present invention can be used for pharmaceutical composition, which includes the present inventionization of therapeutically effective amount
Close object and pharmaceutical excipient.
The content that " therapeutically effective amount " refers to the compounds of this invention should be enough to provide required bone for its lower limit
Sick therapeutic effect, meanwhile, still it is unlikely to cause serious adverse side effect for its upper limit, i.e., is widely recognized as in this field
Within the scope of effective hazard ratio.The effective quantity depends on many factors, such as, but not limited to：The indication treated, severity, together
Phase treats, the course for the treatment of and patient age, health status, public's factor such as medical history.Based on selected osteopathy drug, that is, above-mentioned because
Element, those skilled in the art are not difficult to determine or take the surely described effective quantity by routine test.
The dosage form of pharmaceutical composition of the present invention at least can be solid formulation, such as tablet；Or liquid agent, such as injection, mainly
It is the i.e. systemic medication of whole body.For example, can take orally, inject, including intramuscular injection and intravenous injection administration etc..
The pharmaceutical excipient is known in the art.According to active constituent, dosage form, required formulation properties, not
Under the premise of influencing the compounds of this invention curative effect, those skilled in the art are not difficult to make suitable choosing directly or by routine test
It selects.The excipient is such as, but not limited to：Diluent, filler, disintegrant, adhesive, thickener, corrigent are antimicrobial
Agent, antioxidant, lubricant etc..
The present invention also provides the compounds of this invention in the drug for preparing treatment osteoporosis, osteonecrosis and its relevant disease
In purposes.
Technical scheme of the present invention is specifically described below in conjunction with embodiment.
Embodiment
Desferrioxamine used in following synthetic example 1-4, the derivative compound a that desferrioxamines, the derivative compound b that desferrioxamines,
The derivative compound c that desferrioxamines is purchased from Sigma companies；Iminodiacetic acid and 2,2'- hydrazine -1,2- diyl oxalic acid, 2,2'- is sub-
Methyl-allophanamide diyl oxalic acid, 2,2'- propyl -1,3- allophanamide diyl oxalic acid are purchased from Aladdin company；Succinic anhydride and oneself
Dicarboxylic anhydride is purchased from Chinese medicines group and Aladdin company respectively；PyBOP is purchased from Sigma companies；Pd/C is purchased from Sigma companies, Pd
Doping is 10%；Remaining chemical reagent is the analytical grade reagent purchased from Sigma companies；Used water is that deionization is double
Distilled water.Reaction carries out under normal temperature and pressure conditions.Melting point compound is measured with Fisher-John melting point apparatus.Nuclear magnetic resoance spectrum
It is measured with Bruker AM-400 type spectrometers.Mass spectrum is measured with VG-707E mass spectrographs.Elemental analysis Carlo Erba1106
Type elemental analyser measures.
Synthetic example 1
Synthesis has obtained DFO-SF compounds shown in formula (4) in the present embodiment, i.e., according to reaction mechanism mechanism of reaction institute shown in FIG. 1
The final compound shown.
1. the preparation of compound (a)
60ml toluene, 95ml benzyl alcohols, 6g iminodiacetic acids and 10.3g are added into the three-neck flask of a 250ml
Toluene-4-sulfonic acid, reaction mixture react 18h at 80 DEG C, and solution is become clarifying from milky turbidity, enable and white is but precipitated afterwards
White solid is dissolved in 100ml chloroforms by solid after filtering, and triethylamine is added dropwise thereto under agitation until solution is clear
Clearly, which washed once using 500mL saturated sodium bicarbonate aqueous solutions, is dried using anhydrous magnesium sulfate, and vacuum is spin-dried for
Water white transparency oily object 13.6g, yield 96wt% are obtained afterwards.
2. the preparation of compound (b)
A 50ml round-bottomed flask is taken, 6.28g above compounds (a) are added, adds 30ml chloroforms, stirs to get
2.2g succinic anhydrides are added after clear solution thereto, 3h is reacted at 50 DEG C, vacuum is spin-dried for, and obtains water white transparency oily object
8.41g obtains 7.19g products, yield 86wt% after crossing column (silica gel column chromatography).
3. the preparation of compound (c)
A 50ml round-bottomed flask is taken, 0.7g compounds (b), 5ml DMF and 0.45g PyBOP is added, in condition of ice bath
Lower stirring 10min continues to stir after adding 3g NMM.A 15ml test tubes are taken, 0.5g is weighed and desferrioxamines, 5ml DMF, drop is added
Add 5M KOH aqueous solutions that above-mentioned round-bottomed flask is added in the clear solution to after clarifying, 96h, white solid analysis are reacted under room temperature
Go out, filter out the white precipitate, washed using 30mLDMF secondary, is washed once using 30mLTHF, vacuum is spin-dried for obtaining white solid
0.38g, yield 58wt%.
4. the preparation of compound (d)
A 25ml round-bottomed flask is taken, the reaction product (i.e. compound (c)) of 0.38g previous steps is added, is added thereto
15ml DMF, 0.04g Pd/C, which is placed in hydriding reactor, in the condition that pressure is 1.1MPa, temperature is 50 DEG C
Lower reaction 3h, vacuum is spin-dried for DMF after filtering, and 20 milliliters of ethyl alcohol are added, and is filtered after stirring 1h, vacuum is spin-dried for obtaining white solid
0.31g, the fusing point for measuring the product are 141.8-147.7 DEG C, yield 99wt%.Elemental analysis C33H57N7O14, theoretical value
(%)：C 51.09, H 7.41, N 12.64；Actual value (%)：C 51.05, H 7.44, N 12.69.1H-NMR(d-DMSO)δ
ppm：9.55 (m, 2H, ES：-CH2COO-), 6.69-7.71 (m, 3H, ES：- NH-), 3.95-4.15 (m, 4H, ES：-CH2),
3.44-3.47 (m, 6H, ES：-CH2), 2.98-3.03 (m, 6H, ES：-CH2), 2.51-2.59 (m, 4H, ES：-CH2), 2.5
(m, 2H, ES：-CH2), 2.45-2.49 (m, 4H, ES：-CH2), 1.97 (m, 2H, ES：-CH2), 1.49-1.54 (m, 3H,
ES：- OH), 1.47 (m, 3H, ES：-CH2<), 1.35-1.42 (m, 12H, ES：-CH2), 1.2-1.26 (m, 6H, ES：-CH2-)。
MS(EI)m/z：776.4.
Synthetic example 2
The step of repeating above example 1 completely in this embodiment, difference lies in shown in following structural formula a
Desferrioxamine derivative a, and the molecular formula of the derivative a that desferrioxamines is C26H50N6O9, molecular weight 590.71, the linker used
Group is glutaric anhydride, and the sub- diamino dicarboxylic acid used is 2,2'- hydrazine -1,2- diyl oxalic acid.The mass spectral characteristi of products therefrom
As a result as follows：MS(ESI)m/z：As a result 836.2 (theoretical values 834.91), molecular formula C35H62N8O15 prove the product
With structure shown in following formula (5)：
Synthetic example 3
The step of repeating above example 1 completely in this embodiment, difference lies in using having following structure formula b institutes
Show the derivative b that desferrioxamines of structure, molecular formula C27H52N6O9, molecular weight 604.74, the linking group used is for oneself
Dicarboxylic anhydride, the iminodicarboxylic acid used are 2,2'- methylene-allophanamide diyl oxalic acid.The Theoretical molecular formula of products therefrom is
C38H68N8O15, mass spectral characteristi result are as follows：MS(ESI)m/z：878.2 (theoretical values 876.99), it was demonstrated that being made has formula
(6) product of structure shown in.
Synthetic example 4
The step of repeating above example 1 completely in this embodiment, difference lies in using having following structure formula c institutes
Show the derivative c that desferrioxamines of structure, molecular formula C28H54N6O9, molecular weight 618.76, the linking group used is pungent
Dicarboxylic anhydride, the iminodicarboxylic acid used are 2,2'- propyl -1,3- allophanamide diyl oxalic acid.The Theoretical molecular formula of products therefrom
For C43H78N8O15, mass spectral characteristi result is as follows：MS(ESI)m/z：948.2 (theoretical values 947.12), as a result prove the implementation
Product made from example has structure shown in following formula (7).
5 iron ion complex performance of embodiment is tested
Compound obtained is characterized in above example in the present embodiment to the complexing power of ferric ion.Specifically
For, it regard Ferric Ammonium Citrate (ferric ammoniumcitrate, FAC) as ferric ion donor, is dissolved in distilled water
Solution is formed, the compound of the above synthetic example 1-4 preparations of same molar is added thereto respectively and does not carry out this
Desferrioxamining for the substituting modification is invented, free iron in solution is detected using Beckman DXC600 automatic clinical chemistry analyzers
Content, to understand whether the compound of the present invention has the characteristic of good chelated iron ion.Fig. 2 shows prepared by embodiment 1
DFO-SF and unsubstituted DFO to the complexing situation of iron ion, the control in Fig. 2 is that distilled water is used only without adding FAC
In the case of the iron ion content that measures.Compound made from 2-4 of the embodiment of the present invention has also obtained the compound with embodiment 1
Essentially identical effect.
The experiment in vitro shows that after substituting modification, satisfactory iron still may be implemented in the compound of the present invention
Ion complexation performance.
Embodiment 6 stimulates the performance of cell expression hypoxia inducible factor (HIF)-α and its downstream target gene
Have studied in this embodiment the compound of the present invention stimulation cell express hypoxia inducible factor (HIF)-α and its under
Swim the performance of target gene.Specifically, 48 hours mouse craniums, are cut into 1 × 1 × 1mm after taking-up is raw3Fritter, tryptose
Enzyme and Type I collagen enzymic digestion, separation, purifying newborn mice cranium osteoblast；With 2 × 104/cm2Cell density be seeded to
6 well culture plates；Cell uses the compound of 1-4 of the embodiment of the present invention respectively in culture plate bottom adherent growth to 80% mixing
The conditioned medium of 200 μM a concentration of (DFO net concentrations) cultivates above-described newborn mice cranium osteoblast,
It is tested as a contrast using a concentration of 200 μM of conditioned mediums of the DFO of unsubstituted modification.Culture solution intervenes cultured osteoblast-like cells in vitro
After 48 hours, harvest cell, according to the following specifically describes the step of detect respectively HIF-1 α protein expressions situations and HIF-1 α and
Target gene mRNA expresses situation downstream, and whether the performance to understand DFO changes because being modified by SF.
The detection (Westernblot methods) of 1.HIF-1 α protein expression situations
(1) extract total protein of cell cell culture plate in be added 100 μ l protein lysates RIPA (Beyotime,
China) and 1 μ l protease inhibitors PMSF (Beyotime, China), it is positioned on ice；With the careful scraping cells of cell scraper,
Cell is transferred in 0.5ml centrifuge tubes, is placed 30 minutes on ice；4 DEG C, 12000g is centrifuged 15 minutes, and supernatant is carefully shifted
Into sterile centrifugation tube, -80 DEG C save backup, this is total protein of cell.(2) protein quantification kit (Beyotime is used
China) albumen concentration is measured to mainly comprise the following steps：It takes 1.2ml protein standards to prepare liquid to be added in 30mg BSA standard proteins, fully
The protein standard solution (can be used immediately after preparation, can also -20 DEG C of long-term preservations) of 25mg/ml is configured to after dissolving；It takes suitable
25mg/ml protein standards are measured, final concentration of 0.5mg/ml is diluted to；According to sample size, add 1 volume by 50 volume BCA reagent As
BCA reagents B (50:1) appropriate BCA working solutions are prepared, are mixed well；Standard items are added to 96 by 0,1,2,4,8,12,16,20 μ l
In the standard sample wells of orifice plate, standard dilutions is added to supply to 20 μ l；Add in proper volume sample to the sample well of 96 orifice plates, adds
Standard dilutions are to 20 μ l；200 μ l BCA working solutions are added in each hole, and 37 DEG C are placed 30 minutes；Measure A562,540-595nm
Between wavelength be also subjected to；The albumen concentration of sample is calculated according to standard curve.(3) protein electrophoresis (electrophoresis apparatus, Bio-
Rad, USA) glass plate, encapsulating are installed, in order, it is 30 μ g that protein content is added per well；It is added in the loading hole not being loaded
30 μ l sample-loading buffers balance；Electrophoresis about 75-90min under 120V voltage conditions, bromophenol blue stop electrophoresis when reaching glue bottom.
(4) cut glue, transferring film cuts required purpose band by the albumen Marker (Thermo, USA) of pre-dyed, by glue immersion be ready in advance
Transferring film buffer solution in；Clip pvdf membrane (Millipore, Germany), and make marks in right corner, it is infiltrated and is activated with methanol,
It immerses in transferring film buffer solution.Installation transfer device " sandwich structure " is followed successively by filter paper → film → glue → filter paper from top to bottom, often
Layer is both needed to ensure bubble-free；Transferring film box (Bio-Rad, USA) is covered with ice, 200mA constant current transferring films, or so transferring film time about 2h
(the molecular weight small albumen transferring film time can suitably shorten).(5) immune response will film immerse 5% skimmed milk power in, set shaking table in
Room temperature is shaken 1 hour；It takes out film and is separately packed into a moderate polybag, be added and press 1 with 2%BSA:500 diluted HIF-1 α are anti-
Body (Novus, USA) (primary antibody) after envelope, is placed in shaking table, shaken over night under the conditions of 4 DEG C；Primary antibody is abandoned, washes film 3 times；Film is separately filled
Enter a moderate polybag, is added and presses 1 with 2%BSA:5000 diluted anti-mouse secondary antibodies (Abbkine, USA) are incubated at room temperature 1-
2h；Secondary antibody is abandoned, washes film 3 times.(6) development, developer solution in Image Quant LAS 4000mini machines are developed in
(Millipore Germany) is Millipore A, B liquid presses 1:1 ratio is prepared；Preserve band image.
The detection of 2.HIF-1 α and its downstream target gene mRNA expression situations
Cell total rna is extracted by " one-step method " that kit (Sigma, USA) illustrates, is mainly comprised the following steps：Every milliliter
In Trizol liquid plus 0.2ml chloroforms, high vibration 15 seconds stand 3 minutes at room temperature；In 4 DEG C, 12000g is centrifuged 15 minutes, is taken
The colourless liquid phase in upper layer, move into new sterilizing without RNA enzyme test tube；By the amount of initial Trizol liquid, every milliliter of addition 0.5ml isopropyl
Alcohol precipitates RNA, sets 10 minutes at room temperature；4 DEG C, 12000g is centrifuged 10 minutes, at test tube bottom and side wall visible white glue sample droplet；
By the amount of initial Trizol liquid, the 75% ethyl alcohol washing of equivalent is added；It gently vibrates, 4 DEG C, 7500g is centrifuged 5 minutes；Dry RNA
(being sure not to dry completely, generally dry in the air 5min at room temperature), RNA is dissolved in DEPC water；56~60 DEG C, it is incubated 10min；It is divided light
Degree counts detection rna content and concentration, and RNA is identified and just quantified.Using PCR Reverse Transcriptase kits (Takara, Japan), RNA is anti-
Transcription obtains cDNA, mainly comprises the following steps：Take 1 μ g total serum IgEs, 1 μ l of random primer add the distilled water of DEPC processing to 12 μ l, 70 DEG C
It is incubated 5 minutes；It is subsequently placed on ice, sequentially adds 5x reaction buffers 4 μ l, 10nM dNTP2 μ l, 0.5 μ l of RNase inhibitor,
Add the distilled water that DEPC is handled to 19 μ l, 25 DEG C are incubated addition reverse transcriptase (M-MLV) 1 μ l after five minutes, and it is 20 μ to make total volume
l；According to 25 DEG C 10 minutes, 42 DEG C 60 minutes, 70 DEG C are incubated for 10 minutes on PCR couveuses, completion be placed on ice terminate reaction；
The cDNA Direct PCRs of reverse transcription or -20 DEG C of preservations.Separately design and synthesize -1 α of hypoxia inducible factor (HIF) and downstream target
Gene order primer (the HIF-1 α primer sequences of gene-vascular endothelial growth factor (VEGF) and Heme oxygenase (HO) -1
Row：Upstream-GGTATTATTCAGCACGAC, downstream-GAGGGAAACATTACATC；VEGF primer sequences：Upstream-
AGTCCCATGAAGTGATCAAGTTCA, downstream-ATCCGCATGATCTGCATGG；HO-1 primer sequences：Upstream-
AAGCCGAGAATGCTGAGTTCA, downstream-GCCGTGTAGATATGGTACAAGGA)；By PCR fluorescence quantitative kits
(Takara, Japan) illustrates, formation reaction system (Green, 10 μ l；ROX Reference Dye II, 0.4 μ l；
Upstream and downstream primer, each 0.8 μ l；CDNA, 2.0 μ l；Distilled water complements to 20 μ l.)；Real-time PCR instrument (AB Applied
Biosystems, 7500Real Time PCR System) quantitatively detection and comparative analysis SF-DFO stimulate cell expression HIF-1
(reaction condition is as follows for the situation of α and its downstream target gene (VEGF, HO-1)：94 DEG C 5 minutes, 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C
30s, after so recycling 35 times, 72 DEG C reaction was completed within 5 minutes).
The result that DFO-SF made from the embodiment of the present invention 1 and the DFO of unsubstituted modification are measured is shown in Fig. 3 and Fig. 4.From figure
The result of 3 and Fig. 4 can see, and compared with the DFO of unsubstituted modification, DFO-SF made from the embodiment of the present invention 1 has similar
Stimulation osteoblast expression HIF-1 α and its target gene-vascular endothelial growth factor (VEGF), oxygenase (HO) -1 property
Energy.Compound prepared by 2-4 of the embodiment of the present invention also shows effect identical with the compound of embodiment 1.
Embodiment 7 drives bone characteristic present
In this embodiment, using isotope14DFO or DFO in the compound of C flag embodiment of the present invention 1-4 derive
After compound structure, which is configured to aqueous solution, intraperitoneal injection or tail vein injection are carried out to mouse, when different
Phase eye socket is put to death after taking blood, kidney, femur, spleen, lung, liver and musculature is collected, using liquid scintillation counter
(WALLAC companies, Trilux 1450Micro Beta) measures radioactive intensity in each internal organs, and the cpm/mg measured is organized
It is converted into dpm/mg tissues.Fig. 5 shows the characterization result of the DFO-SF compounds of the embodiment of the present invention 1, shows the compound
Structural behaviour is stablized in Mice Body, and substituting modification through the invention can drive DFO concentrations in bone tissue.The present invention
Compound prepared by embodiment 2-4 also shows effect mutually same with embodiment 1.
In conclusion the compound that 1-4 of the embodiment of the present invention is synthesized has no adverse effects to bone, and to bone metabolism
There is higher activity, the formation of bone matrix can be promoted, (DFO) targeting that can be used for desferrioxamining imports and dense gathers in bone tissue
In, and then play the effect for preventing osteoclasia of chelated iron ion, stimulation bone tissue angiogenesis.The bone affinity chemical combination of the present invention
Object can specifically increase concentration of the drug in bone tissue, and improving it improves osteoporosis osteoblast and osteoclast work(
It can, maintain the useful effect of cells characteristic phenotype.Simultaneously as after modified group and combination of desferrioxamining, to respectively active
Influence is smaller, has no toxic side effect to body, it is possible to improve osteopathy drug and meet the stability of compound, and reduce drug
Systemic ill-effect.
Claims (13)
1. a kind of formula (1) compound represented and its pharmaceutically acceptable salt：
Formula (1)
Wherein R1Selected from following group：Substituted or unsubstituted C1-C4Alkyl；
R2-R4It is each independently selected from following group：Hydroxyl；
R5-R7It is each independently selected from following group：Hydrogen；
R8-R45It is each independently selected from following group：Hydrogen, substituted or unsubstituted C1-C10Alkoxy；
M is integer selected from the following：1,2,3,4,5 and 6；
A is group selected from the following, and the other parts of compound shown in singly-bound and the formula (1) by shown nitrogen-atoms are connected：
,,,
,,
In the above group, n is integer selected from the following：1,2,3,4,5 and 6.
2. a kind of method for preparing compound as described in claim 1, this approach includes the following steps：
(i) so that the organic multicomponent acid comprising 1-8 nitrogen-atoms and 2-6 carboxyl is reacted with alcohol, with to organic multicomponent acid
All carboxyls are protected, and the organic multicomponent acid comprising 1-8 nitrogen-atoms and 2-6 carboxyl is in following compound
It is one or more：
,,,,；
(ii) so that carboxyl is protected made from step (i) organic multicomponent acid and C3-C14The anhydride reaction of diacid；
(iii) so that the product of step (ii) and the derivatives reaction of desferrioxamining or desferrioxamine with formula (2)；
(iv) carboxyl of product made from step (iii) being protected is deprotected, obtains the compound of formula (1):
Formula (2)
Wherein R1Selected from following group：Substituted or unsubstituted C1-C4Alkyl；
R2-R4It is each independently selected from following group：Hydroxyl；
R5-R7It is each independently selected from following group：Hydrogen；
R8-R45It is each independently selected from following group：Hydrogen, substituted or unsubstituted C1-C10Alkoxy.
3. method as claimed in claim 2, which is characterized in that the reaction of the step (i) in a solvent, there are catalyst
In the case of carry out,
The alcohol is selected from：C1-C10Alkylol and C7-C16Aryl alcohol；
The solvent is selected from：Benzene, toluene, hexamethylene, acetone, ether, dimethyl ether, dipropyl ether and they in arbitrary two kinds
Or more mixture；
The catalyst is acid catalyst selected from the following：Sulfuric acid, hydrochloric acid, phosphoric acid, nitric acid, C1-C6Alkyl sulfonic acid, benzene sulfonic acid, first
Benzene sulfonic acid.
4. method as claimed in claim 3, which is characterized in that the reaction of the step (i) in a solvent, there are catalyst
In the case of carry out,
The alcohol is benzyl alcohol；
The catalyst is p-methyl benzenesulfonic acid.
5. method as claimed in claim 2, which is characterized in that the step (ii) carries out in solvent selected from the following：Packet
Liquid alkane containing one or more halogen atoms, the halogen atom are selected from fluorine, chlorine, bromine, iodine.
6. method as claimed in claim 5, which is characterized in that the step (ii) carries out in solvent selected from the following：One
Chloromethanes, dichloromethane, chloroform, carbon tetrachloride and its any mixture.
7. method as claimed in claim 2, which is characterized in that the step (iii) in a solvent, using catalyst item
It is carried out under part,
The solvent is selected from：Benzene, toluene, hexamethylene, acetone, ether, dimethyl ether, dipropyl ether, N,N-dimethylformamide and
The arbitrary mixture of two or more in them；
The catalyst is selected from：Hexafluorophosphoric acid benzotriazole -1- bases-oxygroup tripyrrole alkyl phosphorus, 1H- benzotriazole -1- base oxygen
Three (dimethylamino) phosphorus hexafluorophosphates of generation, 1- hydroxy benzo triazoles and N, N'- dicyclohexylcarbodiimide.
8. the method for claim 7, which is characterized in that the step (iii) in a solvent, using catalyst item
It is carried out under part,
The solvent is selected from：Benzene, toluene, hexamethylene, acetone, ether, dimethyl ether, dipropyl ether, N,N-dimethylformamide and
The arbitrary mixture of two or more in them；
The catalyst is hexafluorophosphoric acid benzotriazole -1- bases-oxygroup tripyrrole alkyl phosphorus.
9. method as claimed in claim 2, which is characterized in that the carboxyl deprotection reaction of the step (iv) is in catalyst
In the presence of by hydrogenation carry out,
The catalyst is selected from loaded noble metal catalyst.
10. method as claimed in claim 9, which is characterized in that the carboxyl deprotection reaction of the step (iv) is to be catalyzed
It is carried out by hydrogenation in the presence of agent,
The catalyst is selected from load type palladium, platinum, rhodium catalyst.
11. method as claimed in claim 9, which is characterized in that the carboxyl deprotection reaction of the step (iv) is to be catalyzed
It is carried out by hydrogenation in the presence of agent,
The catalyst is palladium carbon.
12. a kind of pharmaceutical composition, the pharmaceutical composition include：
(i) compound and its pharmaceutically acceptable salt of formula (1) described in claim 1；
(ii) one or more in pharmaceutically acceptable optional excipient, filler, carrier and diluent；
(iii) the optional pharmaceutical active different from component (i), the pharmaceutical active are selected from：Alendronate sodium piece,
Zolendronate sodium, Pamidronate Disodium, vitamin D, risedronate sodium, Teriparatide, Strontium Ranelate, Raloxifene, drop calcium
Element, estrogen, Nilestriol, it is female it is pregnant swash, the precious particle of tamoxifen, Ipriflavone, clodronate disodium piece, bone pine, premarin,
Tibolone Tablets, solid Su An, disodium etidronate piece, Bang Telin, Tridin, calcium gluconate tablet, calcium-zinc gluconate take orally molten
Liquid, Premelle Cycle, ribavirin tablet, elcatonin, Yi Weite, Bei Bang, Calcitonin Salmon, kidney osteocomma, oyster shell calcium, the strange calcium carbonate of calcium that
D3 pieces, vitamin D 2 and calcium colloid injection, Gai Ruining, clodronate disodium capsule, Alfacalcidol, injection bone peptide, cervus and cucumis polypeptide
Injection, DANHONG ZHUSHEYE, Sofflower injection, Cefradine, clindamycin, vancomycin, D-40 amino acid,
Hydroxyethyl starch injection liquid, low molecular weight heparin sodium injection, sodium lactate ringer's injection, Mannitol sodium chloride injection.
13. the compound and its pharmaceutically acceptable salt of formula (1) described in claim 1 are dredged in preparation for treating sclerotin
Application in pine, osteonecrosis, delayed fracture healing or the drug of disunion and bone defect.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610380476.1A CN106008256B (en) | 2016-06-01 | 2016-06-01 | A kind of derivative compound and its preparation method and application of desferrioxamining with bone affinity |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610380476.1A CN106008256B (en) | 2016-06-01 | 2016-06-01 | A kind of derivative compound and its preparation method and application of desferrioxamining with bone affinity |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106008256A CN106008256A (en) | 2016-10-12 |
| CN106008256B true CN106008256B (en) | 2018-11-09 |
Family
ID=57093136
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610380476.1A Active CN106008256B (en) | 2016-06-01 | 2016-06-01 | A kind of derivative compound and its preparation method and application of desferrioxamining with bone affinity |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106008256B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110124053B (en) * | 2019-06-13 | 2022-12-02 | 扬州大学 | Synthetic method of heparin alen sodium phosphate conjugate and drug thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103736090A (en) * | 2014-01-27 | 2014-04-23 | 中国医学科学院医学生物学研究所 | Methanesulfonic acid deferoxamine adjuvant and vaccine comprising methanesulfonic acid deferoxamine adjuvant |
| CN104703962A (en) * | 2012-08-23 | 2015-06-10 | 艾米斯菲尔科技公司 | Phenoxy alkyl diethanolamine and diisopropanolamine compounds for delivering active agents |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2215052B1 (en) * | 2007-11-01 | 2013-07-24 | Rachel Codd | Desferrioxamine conjugates, derivatives and analogues |
| PT3131585T (en) * | 2014-03-19 | 2020-10-23 | Univ Zuerich | Multidentate bifunctional chelating agents for radionuclide complexation in diagnostics and therapy |
-
2016
- 2016-06-01 CN CN201610380476.1A patent/CN106008256B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104703962A (en) * | 2012-08-23 | 2015-06-10 | 艾米斯菲尔科技公司 | Phenoxy alkyl diethanolamine and diisopropanolamine compounds for delivering active agents |
| CN103736090A (en) * | 2014-01-27 | 2014-04-23 | 中国医学科学院医学生物学研究所 | Methanesulfonic acid deferoxamine adjuvant and vaccine comprising methanesulfonic acid deferoxamine adjuvant |
Non-Patent Citations (4)
| Title |
|---|
| Cell Penetrating Peptide (CPP)-Conjugated Desferrioxamine for Enhanced Neuroprotection: Synthesis and in Vitro Evaluation;Dibakar Goswami等;《Bioconjugate Chem.》;20141009;第25卷;第2067页摘要，第2069页图示2 * |
| Multiple signaling pathways involved in stimulation of osteoblast differentiation by N-methyl-D-aspartate receptors activation in vitro;Jie-li LI等;《Acta Pharmacologica Sinica》;20110620;第32卷;第895-903页 * |
| 去铁敏在兔桡骨临街骨缺损修复中的促进成骨作用;李国松，邓廉夫;《第十六届全国中西医结合骨伤科学术研讨会》;20101231;第136页 * |
| 趋骨性雌二醇/煅烧骨复合物对兔桡骨临界性缺损的修复效果;赵强 等;《中国矫形外科杂志》;20090331;第17卷(第5期);第388页第1段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106008256A (en) | 2016-10-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2520142C (en) | Oestrogen derivatives as inhibitors of steroid sulphatase | |
| CN113185421B (en) | Lipid compounds and compositions thereof | |
| Dahllöf et al. | Estramustine depolymerizes microtubules by binding to tubulin | |
| KR101764991B1 (en) | Tamoxifen derivatives for treatment of neoplastic diseases, especially with high her2 protein level | |
| WO2015169121A1 (en) | Use of quercetin-o-glycoside derivatives in treating lipid metabolism disorders | |
| TW201702246A (en) | Tenofovir monobenzyl ester phosphamide prodrug, preparation method and use thereof | |
| CN114853810B (en) | Curcumin derivative and preparation method and application thereof | |
| CN106366075B (en) | Pyrrolidines, salt, nuclear-magnetism probe and medicinal application, reagent, drug | |
| Jiang et al. | Strontium alleviates endoplasmic reticulum stress in a nonalcoholic fatty liver disease model | |
| CN106008256B (en) | A kind of derivative compound and its preparation method and application of desferrioxamining with bone affinity | |
| CN110642937B (en) | Polypeptide derivative, nanofiber and application thereof | |
| CN104592091B (en) | A kind of compound and its application containing heteroauxin core texture | |
| JP2023550193A (en) | Preparation method and application of star-shaped bifunctional compounds and their salts to resist respiratory infections caused by viruses that target the spike protein | |
| CN116063372B (en) | Mitochondria-targeted antitumor compound, and preparation method and application thereof | |
| CN110759897A (en) | Triazole-containing hydrophobic adamantane type selective androgen receptor degradation agent and preparation method thereof | |
| CN103539764B (en) | 12-p-methyl benzene acyloxy-14-deoxidized andrographolide photoaffinity labeling molecular probe, and preparation method and pharmaceutical composition thereof | |
| JPH04316557A (en) | 6-aryl-cycloanthranilic acid derivative | |
| CN103087009A (en) | Carboxylic acid derivative compound and preparation method and application thereof | |
| TW460461B (en) | Substituted phenylamidines for use in fighting or preventing diseases in which smaller or larger cell aggregations occur or cell-matrix interactions are involved, pharmaceutical compositions containing these compounds and processes for preparing them | |
| CN107213153B (en) | Application of zoledronic acid compound in preparation of medicine for treating cancer | |
| CN104327057B (en) | Poly-substituted indole statin lactone dehydrated compound and use thereof | |
| CN110483547A (en) | Simple phenols conjugate, synthetic method and the application of dihydroartemisinine | |
| CN115710248B (en) | Novel selective estrogen receptor down-regulator compound, preparation method and application | |
| JPS61293993A (en) | Novel fluorescent substance, production thereof and pharmaceutical | |
| CN108440520A (en) | Benzo isothiazole compound and preparation method thereof and the purposes in terms for the treatment of depression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |