CN105999271A - New target for regulating and controlling tumor cell metastasis and application thereof - Google Patents
New target for regulating and controlling tumor cell metastasis and application thereof Download PDFInfo
- Publication number
- CN105999271A CN105999271A CN201610389396.2A CN201610389396A CN105999271A CN 105999271 A CN105999271 A CN 105999271A CN 201610389396 A CN201610389396 A CN 201610389396A CN 105999271 A CN105999271 A CN 105999271A
- Authority
- CN
- China
- Prior art keywords
- dcr3
- tumor
- application
- cadherin
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K49/00—Preparations for testing in vivo
- A61K49/0004—Screening or testing of compounds for diagnosis of disorders, assessment of conditions, e.g. renal clearance, gastric emptying, testing for diabetes, allergy, rheuma, pancreas functions
- A61K49/0008—Screening agents using (non-human) animal models or transgenic animal models or chimeric hosts, e.g. Alzheimer disease animal model, transgenic model for heart failure
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Animal Behavior & Ethology (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- Urology & Nephrology (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Medicinal Chemistry (AREA)
- Zoology (AREA)
- Veterinary Medicine (AREA)
- Microbiology (AREA)
- Hematology (AREA)
- Organic Chemistry (AREA)
- Pathology (AREA)
- Physics & Mathematics (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Cell Biology (AREA)
- Pharmacology & Pharmacy (AREA)
- Oncology (AREA)
- Endocrinology (AREA)
- Food Science & Technology (AREA)
- Hospice & Palliative Care (AREA)
- Toxicology (AREA)
- Rheumatology (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Plant Pathology (AREA)
- Analytical Chemistry (AREA)
- Diabetes (AREA)
- General Physics & Mathematics (AREA)
Abstract
The invention provides a new target for regulating and controlling tumor cell metastasis and an application thereof; the application is an application of a DcR3 inhibitor in preparation of medicines for reducing or eliminating tumor cell metastasis. The invention discloses a new mechanism of the DcR3 in regulation and control of tumor metastasis, and the DcR3 is clear and definite to be used as an anti-tumor migration target; through studies, the DcR3 is indicated to be capable of regulating and controlling expression of crucial molecule E-cadherins in an EMT generation process, promote tumor cytoskeleton remodeling, and then promote the migration of tumor cells. In general, the application can reduce or alleviate malignant tumor metastasis, thereby playing a role in improving the effect of tumor therapy.
Description
Technical field
The invention belongs to molecular biology and treatment and prevention of tumour field, more particularly it relates to predict, diagnose and control
Treat Nasopharyngeal neoplasms field.
Background technology
Malignant tumor be harm human health a class disease, chemotherapy be treat at present malignant tumor Main Means it
One.But, Malignant tumor of bonal metastasis often leads to chemotherapy of tumors failure.Therefore, to the research of Malignant tumor of bonal metastasis mechanism and
The medicine finding exploitation reduction or elimination Malignant tumor of bonal metastasis is emphasis and the difficult point in current cancer study on prevention field.
The transfer of tumor cell is an extremely complex process, such as, include degraded and the cell of extracellular matrix (EMC)
Mobile, the infiltration of cancerous cell and transfer process can run into a series of tissue and spout barrier, the ECM of these barriers by basement membrane and
Interstitial matrix is formed, and its main component includes: each Collagen Type VI, laminin (laminin, Ln), fibronectin
(fibronectin, Fn), elastin (elastin) and Dan Baiduotang proteoglycan PG (proteoglycans) etc., tumor cell passes through it
Surface receptor and ECM composition activate after adhering to and disengage various protein resolvase and degrade (degradation) matrix components, for
The mobile formation passage of tumor cell.It addition, multiple different stimulus object can be reacted and move, including tumor by tumor cell
The factor (autocrine shifter factor), the factor (paracrine shifter factor) of host cell secretes and the ECM's that this status of cell is secret
Composition etc..Additionally, epithelial cell plays important to Interstitial cell transfer (EMT) process in constitutional infiltration and Secondary cases are shifted
Effect, thus, the research generation of EMT and regulatory mechanism, for finding prevention, diagnosing and treat malignant tumor particularly tumor
The transfer of cell is significant.
DcR3 is a kind of Decoy receptor, is also a kind of special apoptosis inhibitor, can surpass house with tumor necrosis factor
Race's member's FasL, LIGHT and TL1A combine, and the apoptosis of they mediations is played negative regulation effect, below figure 1 institute
Showing, DcR3 can combine with FasL, LIGHT and TL1A, suppresses the signal path that it is apoptosis-induced, in tumour immunity, certainly
Play an important role in body immunity, transplantation immunity and antiviral immunity (Lin WW, Hsieh SL.Decoy receptor
3:A pleiotropic immunomodulator and biomarker for inflammatory diseases,
Autoimmune diseases and cancer.Biochem Pharmacol, 2011,81:838-847.).Study table
Bright, DcR3 is high expressed in kinds of tumors tissue and autoimmune disease, the prior art principle to its suppression apoptosis of tumor cells
Deeply, result of study shows that DcR3, mainly by its respective ligand of " trick " function competition binding, suppresses swollen in the comparison of research
The normal apoptotic of oncocyte.But, the machine about DcR3 at cell adhesion and cell migration, in terms of especially it is with neoplasm metastasis
Make of knowing little.
In order to reduce or eliminate the transfer of tumor cell, improving chemotherapy effect, this area needs to study in several ways
The mechanism of Nasopharyngeal neoplasms, the key gene target spot of Nasopharyngeal neoplasms, and reduce according to the treatment of these shot designs or disappear
New drug except Nasopharyngeal neoplasms.
Summary of the invention
Present invention is primarily targeted at find neoplasm metastasis novel targets, study this target spot in terms of neoplasm metastasis
Machining function, preferably to improve the effect for the treatment of tumor.
Present invention is disclosed DcR3 is the transcellular novel targets of modulate tumor, and specifically, present invention research shows DcR3
The expression of a vital molecule E-cadherin (E cadherin) in EMT generating process can be regulated and controled, promote swollen
Oncocyte skeleton is reinvented, and then promotes the migration of tumor cell.
Inventor find under study for action the tumor cell of In vitro culture under conditions of DcR3 processes, cellular morphology and cell
Skeleton there occurs significantly change, the substantial amounts of synapse of Hemapoiesis.Finding that DcR3 process can affect cellular morphology and cell
Under the precondition of skeleton, inventor have detected the expression change of EMT marker molecule E-cadherin, experimental result table further
Bright, the process of DcR3 can substantially reduce E-cadherin mRNA and the expression of protein level in HepG2 cell；Additionally, invention
People further in cell the plasmid of transfection expression DcR3 detect, it is again seen that the expression of DcR3 can reduce intracellular E-
The expression of cadherin, the above results prompting DcR3 is the factor promoting tumor cell EMT to occur.
Additionally, the present invention have detected the expression of DcR3 in patient's liver organization by SABC, result shows same
Normal liver tissue is compared, and in the liver organization of liver cancer patient, the expression of DcR3 is significantly raised, and prompting DcR3 is tumor associated antigen.
Being implicitly present in contrary relation to verify that internal DcR3 with E-cadherin expresses, inventor have detected E-in the middle of liver organization
The expression of cadherin, result shows compared with normal liver tissue, in the middle of liver cancer tissue under the expression of E-cadherin substantially
Adjust.The above results further demonstrate that the feasibility that DcR3 regulation and control E-cadherin expresses.
Further, inventor explore DcR3 strike low in the case of the transfer ability of tumor cell, Wound healing
Test result indicate that, the process of DcR3 can be remarkably reinforced the transfer ability of HepG2 tumor cell；Transwell experiment simultaneously
Show that the reduction of DcR3 can substantially suppress the migration of HepG2 tumor cell.
Thus, on the one hand, the invention provides a kind of inhibitor for DcR3 and reduce in preparation or eliminate tumor cell
Application in the medicine of transfer.
As a detailed description of the invention, the described application of the present invention refers to that the inhibitor for DcR3 is being prepared by raising
E-cadherin (E cadherin) reduces or eliminates the application in the medicine of Nasopharyngeal neoplasms.
As a detailed description of the invention, the described application of the present invention refers to that the inhibitor for DcR3 is being prepared by raising
During EMT, E-cadherin (E cadherin) reduces or eliminates the application in the medicine of Nasopharyngeal neoplasms.
The heretofore described antagonist for DcR3 is any expression reducing DcR3 and/or antagonism DcR3 work
Reagent.The reagent with such function such as can include the antibody of the most anti-DcR3, for DcR3 coded sequence RNA do
Disturb molecule or antisense oligonucleotide, micromolecular inhibitor, siRNA.Such reagent to those skilled in the art can root
Obtain according to prior art, can be any expression reducing DcR3 well known in the prior art and/or antagonism DcR3 work
Antagonist itself, it is possible to be carry out modifying based on this molecular formula, change structure after still have reduce DcR3 expression and/or
The reagent of the function of antagonism DcR3 effect.In a specific embodiments of the present invention, the described antagonist for DcR3 is anti-
The antibody of DcR3, such as, (Human DcR3/TNFRSF6B Antibody, can business for this antibody behaviour DcR3/TNFRSF6B antibody
Enough from R&D systems)；The sequence of the positive-sense strand of described siRNA as shown in SEQ ID NO:5, the sequence of antisense strand such as SEQ
Shown in ID NO:6.
As a detailed description of the invention, state before this invention in application, described tumor selected from hepatocarcinoma, breast carcinoma, glioma,
Colon cancer, cervical cancer, pulmonary carcinoma, cancer of pancreas, gastric cancer or bladder cancer, preferably hepatocarcinoma.
On the other hand, the present invention provides a kind of siRNA reduced or eliminate Nasopharyngeal neoplasms, the justice of described siRNA
The sequence of chain is as shown in SEQ ID NO:5, and the sequence of antisense strand is as shown in SEQ ID NO:6.
On the other hand, the present invention provides a kind of pharmaceutical composition reduced or eliminate Nasopharyngeal neoplasms, wherein, this medicine
Compositions comprises the siRNA of the present invention of effective dose.
On the other hand, the present invention provides a kind of method suppressing tumor cell EMT, and described method includes regulating and controlling DcR3 target
Point, described regulation and control DcR3 target spot includes expression and/or the approach of antagonism DcR3 effect reducing DcR3.
On the other hand, the present invention provides the method for E-cadherin (E-cadherin) in tumor cell that raises, described
Method includes regulating and controlling DcR3 target spot, and described regulation and control DcR3 target spot includes expression and/or the antagonism DcR3 effect reducing DcR3
Approach.
On the other hand, the present invention also provides for a kind of method screened and reduce or eliminate Nasopharyngeal neoplasms medicine, described side
Method includes:
A () provides and expresses the tumor cell line of DcR3, tumor culture or lotus bearing animals；
B drug candidate is contacted by () with tumor cell line, tumor culture or the lotus bearing animals provided in step (a),
As administration group；
The expression of E-cadherin (E cadherin) in (c) detection administration group, and with do not give drug candidate
Control tumor cell line, tumor culture or lotus bearing animals in the expression of E-cadherin (E cadherin)
Compare；
If testing result shows, the expression of the E-cadherin (E cadherin) of administration group is higher than comparison
Group, then show that this candidate compound is the medicine reducing or eliminating tumor cell.
" being higher than " described in this typically refers to compared with matched group, and administration group experimental result has significant difference.
As the detailed description of the invention of screening technique of the present invention, described tumor is selected from hepatocarcinoma, breast carcinoma, glioma, colon
Cancer, cervical cancer, pulmonary carcinoma, cancer of pancreas, gastric cancer or bladder cancer.Preferably, described tumor is hepatocarcinoma.
Beneficial effects of the present invention:
(1) present invention discloses the new mechanism of DcR3 modulate tumor transfer, and then specify that DcR3 can migrate as antitumor
Target spot.Specifically, present invention research shows that DcR3 can regulate and control a vital molecule E-in EMT generating process
The expression of cadherin, promotes that tumor cell skeleton is reinvented, and then promotes the migration of tumor cell.
(2) provide by suppressing DcR3 and related signaling pathway thereof to reduce or alleviate the new of Malignant tumor of bonal metastasis
Method, thus serve the effect improving oncotherapy effect.
Accompanying drawing explanation
Fig. 1 be DcR3 combine with FasL, LIGHT and TL1A suppress its apoptosis-induced signal path signal
Figure.
Fig. 2 is that DcR3 suppresses HepG2 cell aggregation growth figure.
Fig. 3 is the variation diagram that DcR3 causes cytoskeleton.
Fig. 4 is that DcR3 promotes tumor cell HepG2 cytoskeleton variation diagram.
Fig. 5 is the expression experimental result picture stimulating reduction E-cadherin mRNA of DcR3.
Fig. 6 is the expression experimental result picture stimulating reduction E-cadherin protein level of DcR3.
Fig. 7 is the expression experimental result picture expressing reduction E-cadherin protein level of DcR3.
Fig. 8 is the expression comparison figure of DcR3 in normal structure and liver cancer tissue.
Fig. 9 is the expression comparison figure of E-cadherin in the middle of normal structure and liver cancer tissue.
Figure 10 DcR3 promotes migration (the wound healing assay) experimental result picture of tumor cell.
Figure 11 is the migration Transwell experimental result overall diagram reducing suppression tumor cell of DcR3.
Figure 12 is the impact experiment partial enlarged drawing sheet of Transwell experiment detection DcR3 cell migration.
Detailed description of the invention
In order to the technical characteristic of the present invention, purpose and beneficial effect are more clearly understood from, in conjunction with being embodied as
Technical scheme is carried out described further below by example and accompanying drawing, it should be understood that these examples be merely to illustrate the present invention and not
For limiting the scope of the present invention.In embodiment, each Starting reagents material is the most commercially available, the experiment of unreceipted actual conditions
Method is the conventional method known to art and normal condition, or according to the condition proposed by apparatus manufacturer.
Embodiment 1
(1) In vitro culture experiment
The present embodiment with DMEM in high glucose (gibico)+10%FBS (hyclone) as culture medium, in 6 orifice plates 37 DEG C, 5%
CO2Three groups of HepG2 tumor cell 72h of In vitro culture, wherein cell density is 1 × 105/ hole, one group does not processes, other two components
In culture medium, do not add IgG1 and DcR3-Fc of final concentration of 3 μ g/ml.Acquired results as in figure 2 it is shown, test result indicate that,
The tumor cell of In vitro culture is under conditions of DcR3 processes, and cellular morphology and cytoskeleton there occurs significantly change.Carefully
In the case of born of the same parents' density is diluter, through the cultivation of 72 hours, the combination that matched group (do not process group and add IgG1 group) cell is compact
Form clone together and assemble growth, but the cell of DcR3 (3 μ g/ml) process group substantially becomes loose, dispersion growth, simultaneously
There is significantly change, the substantial amounts of synapse of Hemapoiesis (protrusion) in cellular morphology and skeleton, as it is shown on figure 3, show in Fig. 3
Show that DcR3-Fc process group cell edges generates substantial amounts of synapse, the structure of filopodia.
Additionally, the tumor cell fibril framework after using phalloidin to cultivate 72h, concrete staining procedure is:
A. cell climbing sheet grows 24-48 hour；
The most pre-temperature PBS (37 DEG C) cleans cell 2 times, each 10 minutes；
C.4% paraformaldehyde room temperature fixes 5-10 minute, PBS cell 3 times；Note: also can be by the formalin of 3.7%
Fixing, but formaldehyde can not contain methanol, because methanol may destroy actin in fixation procedure.
D.0.1%Triton X-100/PBS room temperature rupture of membranes 3-5 minute, PBS cell 3 times；Note: this step can save
Slightly, because phalloidin (Phalloidin) molecular weight is the least, the hole that after paraformaldehyde is fixing, cell membrane produces is sufficient for
Phalloidin enters cell.And after Triton rupture of membranes, nucleus may be had non-specific by phalloidin (Phalloidin)
Property dyeing.
E.5 μ l rhodamine-phalloidin (Rhodamine-Phalloidin) stock solution is made into work in adding 150 μ l PBS
Liquid (5 μ g/ml) in order to contaminate cell, room temperature dyes 30-60 minute；Note: 1) rhodamine-phalloidin (Rhodamine-
Phalloidin) working concentration scope is 2-50 μ g/m, and generally using concentration is 5 μ g/ml；2) for reducing unspecific staining,
During preparation rhodamine-phalloidin (Rhodamine-Phalloidin) working solution, 1%BSA (Ox blood serum can be added in PBS
Albumin).Or it is front by the PBS liquid chamber temperature containing 1%BSA in dye rhodamine-phalloidin (Rhodamine-Phalloidin)
Closing cell 20-30 minute.3) for prevent the evaporation of liquid in dyeing course, preferably carry out in airtight wet box.
F.PBS cleans cell 3 times；
G. adding DAPI37 DEG C to dye 10 minutes, PBS washs 3 times
H. suck excessive moisture, add fluorescence mounting liquid (neutral or meta-alkalescence buffer add equivalent glycerol) mounting, fluorescence or
Observe under Laser Scanning Confocal Microscope.
Acquired results as shown in Figure 4, the Subfilament Structure of left side only red color visible phalloidin in Fig. 4, only may be used by centre
See the nuclear structures of blue DAPI dyeing, Subfilament Structure also visible blue DAPI of right side both red color visible phalloidin
The nuclear structures of dyeing.Experimental result confirms that matched group (do not process group and add IgG1 group) cell aggregation grows equally, and
DcR3-Fc process group cell then disperses growth.
(2) fluorescence real-time quantitative PCR, Western Blot experiment and plasmid transfection experiment
Under above-mentioned experiment finds the precondition that DcR3 process can affect cellular morphology and cytoskeleton, this experiment exists
On the basis of above-mentioned experiment, by fluorescence real-time quantitative PCR and Western Blot experiment, (DcR3 antibody is purchased from Abcam, article No.
Ab8405, two is anti-purchased from Zhong Shan Golden Bridge, article No. SP 9001) expression that have detected EMT marker molecule E-cadherin further becomes
Changing, E-cadherin protein expression reduces the generation meaning EMT.
Fluorescence real-time quantitative PCR specific experiment step is as described below:
The extraction of a.RNA
1. in the 6 every porocytes of orifice plate, add 1ml TRIZOL.
2. the sample of the TRIZOL reagent cracking of the every 1ml of two-phase laminated flow adds the chloroform of 0.2ml, covers tightly lid.Manually
Acutely vibration body is after 15 seconds, hatches 2 to 3 minutes for 15 to 30 DEG C.At 4 DEG C, 12000rpm is centrifuged 15 minutes.
3. aqueous top layer is transferred to one totally without in the centrifuge tube of RNase by RNA precipitate.Add equal-volume isopropanol mixing with
Precipitate RNA therein, after mixing 15 to 30 DEG C hatch 10 minutes after, at 4 DEG C, 12000rpm is centrifuged 10 minutes.
4. RNA cleans and removes supernatant, adds 75% ethanol of at least 1ml in the sample of every 1mlTRIZOL reagent cracking
(75% ethanol DEPCH2O prepares), cleans RNA precipitate.After mixing, at 4 DEG C, 7000rpm is centrifuged 5 minutes.
5. RNA is dried and carefully sucks major part ethanol solution, makes RNA precipitate be dried 5-10 minute in air at room temperature.
When 6. dissolving RNA precipitate dissolving RNA, it is initially charged the water 40 μ l rifle without RNase and repeatedly blows and beats several times so that it is completely
Dissolve, it is thus achieved that RNA solution be stored in-80 DEG C stand-by.
B. sample cDNA synthesis
1. reaction system
Reaction system is as shown in table 1 below:
Table 1
| Sequence number | Reactant | Dosage |
| 1 | RT Buffer | 2μl |
| 2 | Forward primer | 0.2μl |
| 3 | Downstream primer | 0.2μl |
| 4 | dNTP | 0.1μl |
| 5 | Reverse transcriptase MMLV | 0.5μl |
| 6 | DEPC water | 5μl |
| 7 | RNA template | 2μl |
| 8 | Cumulative volume | 10μl |
In table 1, upstream and downstream primer is purchased from Invitrogen, particularly as follows:
Forward primer: TGGAGGAATTCTTGCTTTGC (SEQ ID NO:1)；
Downstream primer: CGTACATGTCAGCCAGCTTC (SEQ ID NO:2).
Joining in pipe by the component in table 1, flick and mixed by solution at the bottom of pipe, 6000rpm is of short duration centrifugal.
2. mixed liquor first 70 DEG C of dry bath 3 minutes before adding reverse transcriptase MMLV, after taking-up, ice-water bath is interior to pipe immediately
Outer temperature is consistent, then adds reverse transcriptase 0.5 μ l, 37 DEG C of water-baths 60 minutes.
3. 95 DEG C of dry bath 3 minutes immediately after taking out, obtain reverse transcription solution at end and are cDNA solution, be stored in-80 DEG C and treat
With.
C. real-time PCR (Real time PCR) is with reference to TAKARA Premix Ex TaqTM (Perfect Real Time)
Description operation (article No.: DRR041A).
Fluorescence real-time quantitative PCR experimental result as it is shown in figure 5, as can be seen from Figure 5 with matched group (untreated fish group and adding
IgG1 group) to compare, in DcR3 process group, the mrna expression level of E-cadherin substantially reduces.
Western Blot specific experiment step is as described below:
A. protein sample is collected；Cracking attached cell with RIPA lysate, then 4 DEG C, 13,000g are centrifuged 15min. takes
Clear liquid is as sample.
B. electrophoresis: prepare running gel, carries out SDS-PAGE.
C. transferring film: adhesive tape is cut to suitable size after terminating by electrophoresis, balances with transferring film buffer, 5min × 3 time.
Transferring film condition: 300mA constant current；0.22um aperture pvdf membrane, transferring film time 75min.
Close: film is totally submerged room temperature jog 60min in confining liquid.
D. an anti-(DcR3 antibody (Abcam, ab8405)；E-cadherin antibody (proteintech, 20874-1-AP)；
Tubulin antibody (Abmart)).
Hatch: resist with TBST dilution one, incubated at room 10min, put 4 DEG C overnight.Within second day, take out film from 4 DEG C, in room temperature
Hatch 30min.
Wash film: TBST and wash film 5 times, each 10min.
E. two anti-hatch: anti-(according to an anti-kind selection goat anti-rabbit igg (H with 5% defatted milk powder-TBST dilution two
+ L) HRP or goat anti-mouse IgG (H+L) HRP), 1:5000, room temperature jog 40min.Wash film: TBST and wash film 6 times, every time
3min。
F. exposure: ECL (Thermo) reacts 2min after being added on film, and (time of exposure is with difference for exposure: 10s-5min
Light intensity and adjust), develop 2min, fixing.Dry in the air the subsequent analysis such as sheet, scanning.
Western Blot experimental result as shown in Figure 6, as can be seen from Figure 6 with matched group (untreated fish group and adding
IgG1 group) to compare, in DcR3 process group, the protein expression level of E-cadherin substantially reduces.
From above-mentioned fluorescence real-time quantitative PCR and Western Blot experimental result it can be seen that permissible through the process of DcR3
Substantially reduce E-cadherin mRNA and the expression of protein level in HepG2 cell.Further, transfection expression in cell
The plasmid (plvx-zs-green-DcR3) of DcR3 (is embodied as step to carry out with reference to lipo2000 (invitrogen) description
Transfection), detect after 24 hours, acquired results as it is shown in fig. 7, as can be seen from Figure 7 with compareing of having transfected empty carrier
Group is compared, and has transfected the expression of E-cadherin in the vehicle group cell carrying DcR3 gene and has substantially reduced.Result above carries
Show that DcR3 is the factor promoting tumor cell EMT to occur.
(3) SABC detection
This experiment have detected the expression of DcR3 in patient's liver organization by SABC, and concrete detecting step is such as
Lower described:
A. paraffin section de-waxing is to water: (should put 60 DEG C 1 hour before paraffin section dyeing).
1. dimethylbenzene, II (cut into slices dimethylbenzene twice), each 10 minutes.
2. graded ethanol: 100%, 2 minutes 95%, 2 minutes 80%, 2 minutes 70%2 minutes.
3. washing is distilled: 5 minutes, 2 times (being placed in shaking table).
B. endogenous peroxydase: 3%H closed by hydrogen peroxide2O2Room temperature 10 minutes (lucifuge).
C. washing is distilled: 5 minutes, 2 times (being placed in shaking table).
D. antigen retrieval: carry out antigen retrieval with antigen retrieval buffers (purchased from the green skies).
E.PBS:5 minute, 2 times (being placed in shaking table).
F. normal serum is closed: take out section from dye sheet cylinder, cleans around section back side moisture and section face weave
Moisture (keep tissue in moisture state) dropping normal goats or rabbit anteserum (with second antibody isogenic animal serum) process,
37 DEG C, 15 minutes.
G. drip first antibody (DcR3 antibody (Abcam, ab8405)): suck serum with filter paper, do not wash, directly drip
One antibody, 37 DEG C 2 hours.
H.PBS:5 minute, 2 times (being placed in shaking table).
I. drip biotinylated two and resist (Zhong Shan Golden Bridge, article No. SP 9001and SP9002), 37 DEG C, 40 minutes.
J.PBS:5 minute, 2 times (being placed in shaking table).
K. dropping three anti-(SAB complex), 37 DEG C, 40 minutes.
L.PBS:5 minute, 2 times (being placed in shaking table).
M.DAB develops the color, Microscopic observation, terminates (tap water punching terminates) in good time.
N. tap water (thin water) fully rinses.
O. haematoxylin is redyed, room temperature, 30 seconds, and tap water rinses.
P. tap water rinses and returns indigo plant, 15 minutes.
Q. gradient alcohol dehydration: 80%, 2 minutes 95%, 2 minutes 100%, 2 times, 5 minutes.
R. dimethylbenzene is transparent: each 5 minutes of I, II (dimethylbenzene)
S. mounting: canada balsam (or neutral gum) mounting.
SABC testing result such as Fig. 8 (wherein, it is thus achieved that the first antibody that Fig. 8 is used be DcR3 antibody (Abcam,
Ab8405), shown in, Fig. 8 shows that the expression of normal liver tissue cell DcR3 is the lowest, and in liver cancer tissue section, the table of DcR3
Reaching significantly raised (arrow locations in Fig. 8), prompting DcR3 is tumor associated antigen.
(4) detection of E-cadherin in liver organization
In order to verify that internal DcR3 with E-cadherin expresses the contrary relation that is implicitly present in, this experiment uses SABC
Experiment have detected the expression of E-cadherin in the middle of liver organization, and specifically step is the most above-mentioned, (the anti-E-wherein, used
Cadherin antibody is anti-purchased from Zhong Shan Golden Bridge, article No. SP9002 purchased from proteintech, article No. 20874-1-AP, two), gained
Experimental result is as it is shown in figure 9, Fig. 9 shows that normal liver tissue cell E-cadherin is present in cell contact structure, and hepatocarcinoma
In tissue slice, the expression of E-cadherin declines, and cell is irregular simultaneously, and cell contact structure lacks obvious E-
The expression of cadherin, this result further demonstrate that the feasibility that DcR3 regulation and control E-cadherin expresses.
(5) DcR3 strikes low experiment
Next the present invention use further Wound healing experimental exploring DcR3 strike low in the case of tumor cell
(HepG2) transfer ability.
A. (when conveniently taking pictures, location is same first to draw horizontal line labelling with marking pen at the 6 orifice plate back sides before culture plate inoculating cell
One visual field).
B. access 6 orifice plates after cell dissociation, to be paved with at the bottom of plate after adherent, quantity is advisable that (quantity can be cultivated a period of time time few
To being paved with at the bottom of plate).
C., after at the bottom of cell is paved with plate, it is perpendicular to orifice plate with 1ml rifle head and manufactures cell cut, ensure each scratch width as far as possible
Unanimously.
D. suck cell culture fluid, rinse orifice plate three times with PBS, wash away the cell debris that cut produces.
E. add complete medium, be divided into untreated fish group simultaneously, add IgG1 group and add DcR3-Fc group, make final concentration of 3 μ
G/ml, Taking Pictures recording.
F., culture plate being put into incubator cultivate, taking-up in 48 hours is taken pictures.
G. according to collecting pictures data analysis experimental result.
As shown in Figure 10, Figure 10 shows and untreated fish group and compared with adding IgG1 group acquired results, adds DcR3-Fc group 48 hours
Rear tumor cell (HepG2) migrates substantially to be accelerated, distance between cell after solid black lines is shown that migrating in figure.
Transwell tests (purchased from corning, 0.8 micron pore size)
By untreated fish group, transfection control siRNA (its positive-sense strand be SEQ ID NO:3, antisense strand be SEQ ID NO:4)
(negative control group) and the transfection special siRNA of DcR3 (its positive-sense strand is SEQ ID NO:5, and antisense strand is SEQ ID NO:6) group
HepG cell suspension be added to cell, lower room adds 5% serum, sucking-off culture medium after 24h, and PBS twice is put on the skin with cotton swab
Face, upper room cell, absolute methanol fixes 15min, and 10min is dried in cell upset, the violet staining 20min (crystal violet of 0.1%
Be made into the mother solution of 0.5% with absolute methanol, the used time is diluted to 0.1%), PBS twice, 24 orifice plates add PBS, will
Transwell cell is put and is taken pictures in 24 orifice plates.As shown in FIG. 11 and 12, Figure 11 is shown that Transwell and moves acquired results
Moving the overall picture of cell, Figure 12 is the partial enlargement picture of Figure 11.Figure 11 and Figure 12 shows at DcR3 special siRNA group ratio
The cell that reason group, Nc group migrate is few, i.e. shows that the reduction of DcR3 can substantially suppress the migration of tumor cell (HepG2).
Finally illustrate: above example is merely to illustrate implementation process and the feature of the present invention, and unrestricted is sent out
Bright technical scheme, although being described in detail the present invention with reference to above-described embodiment, those of ordinary skill in the art should
Work as understanding: still the present invention can be modified or equivalent, without departing from the spirit and scope of the present invention any
Amendment or local are replaced, and all should contain in the middle of protection scope of the present invention.
Claims (10)
1. the inhibitor for DcR3 is preparing the application reduced or in the medicine of elimination Nasopharyngeal neoplasms.
Application the most according to claim 1, wherein, described application is that the inhibitor for DcR3 is being prepared by raising E-
Cadherin reduces or eliminates the application in the medicine of Nasopharyngeal neoplasms.
Application the most according to claim 1, wherein, described application is that the inhibitor for DcR3 is being prepared by raising
During EMT, E-cadherin reduces or eliminates the application in the medicine of Nasopharyngeal neoplasms.
4. according to the application according to any one of claims 1 to 3, wherein, the described inhibitor for DcR3 is for reducing DcR3
Expression and/or the reagent of antagonism DcR3 effect；The antibody of the most anti-DcR3, RNA for DcR3 coded sequence disturb
Molecule or antisense oligonucleotide, micromolecular inhibitor, siRNA；The antibody of described anti-DcR3 for example, human decoy receptor 3/TNFRSF6B resists
Body；The sequence of the positive-sense strand of described siRNA is as shown in SEQ ID NO:5, and the sequence of antisense strand is as shown in SEQ ID NO:6.
5. according to the application according to any one of claims 1 to 3, wherein, described tumor selected from hepatocarcinoma, breast carcinoma, glioma,
Colon cancer, cervical cancer, pulmonary carcinoma, cancer of pancreas, gastric cancer or bladder cancer；Preferably hepatocarcinoma.
6. reduce or eliminate a siRNA for Nasopharyngeal neoplasms, wherein, the sequence of the positive-sense strand of described siRNA such as SEQ ID
Shown in NO:5, the sequence of antisense strand is as shown in SEQ ID NO:6.
7. reducing or eliminate a pharmaceutical composition for Nasopharyngeal neoplasms, wherein, this pharmaceutical composition comprises effective dose
SiRNA described in claim 6.
8. the method suppressing tumor cell EMT, described method includes regulating and controlling DcR3 target spot, and described regulation and control DcR3 target spot includes
Reduce expression and/or the approach of antagonism DcR3 effect of DcR3.
9. raising a method for E-cadherin in tumor cell, described method includes regulating and controlling DcR3 target spot, described regulation and control
DcR3 target spot includes expression and/or the approach of antagonism DcR3 effect reducing DcR3.
10. screening the method reducing or eliminating Nasopharyngeal neoplasms medicine, described method includes:
A () provides and expresses the tumor cell line of DcR3, tumor culture or lotus bearing animals；
B drug candidate is contacted by () with tumor cell line, tumor culture or the lotus bearing animals provided in step (a), as
Administration group；
The expression of E-cadherin in (c) detection administration group, and with do not give drug candidate control tumor cell line,
The expression of the E-cadherin in tumor culture or lotus bearing animals compares；
If testing result shows, the expression of the E-cadherin of administration group is higher than matched group, then show that this is candidates
Compound is for reducing or eliminating Nasopharyngeal neoplasms medicine；
Preferably, described tumor selected from hepatocarcinoma, breast carcinoma, glioma, colon cancer, cervical cancer, pulmonary carcinoma, cancer of pancreas, gastric cancer or
Bladder cancer；It is highly preferred that described tumor is hepatocarcinoma.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610389396.2A CN105999271A (en) | 2016-06-03 | 2016-06-03 | New target for regulating and controlling tumor cell metastasis and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610389396.2A CN105999271A (en) | 2016-06-03 | 2016-06-03 | New target for regulating and controlling tumor cell metastasis and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105999271A true CN105999271A (en) | 2016-10-12 |
Family
ID=57090543
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610389396.2A Pending CN105999271A (en) | 2016-06-03 | 2016-06-03 | New target for regulating and controlling tumor cell metastasis and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105999271A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108379583A (en) * | 2018-03-27 | 2018-08-10 | 北京大学 | A kind of target of tumor metastasis medicine treatment and its application |
| CN109030835A (en) * | 2018-09-06 | 2018-12-18 | 江苏省人民医院（南京医科大学第附属医院） | Method for analyzing effect of Rab8 on Klotho expression regulation in non-small cell lung cancer |
-
2016
- 2016-06-03 CN CN201610389396.2A patent/CN105999271A/en active Pending
Non-Patent Citations (2)
| Title |
|---|
| CHENG-HSUN HO ETAL: "Decoy receptor3, upregulated by Epstein-Bar virus latent membrane protein 1, enhances nasopharyngeal carcinoma cell migration and invasion", 《CARCINOGENESIS》 * |
| 苏传丽等: "小干扰RNA靶向抑制DcR3基因对肝癌细胞凋亡和迁移的影响", 《世界华人消化杂志》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108379583A (en) * | 2018-03-27 | 2018-08-10 | 北京大学 | A kind of target of tumor metastasis medicine treatment and its application |
| CN109030835A (en) * | 2018-09-06 | 2018-12-18 | 江苏省人民医院（南京医科大学第附属医院） | Method for analyzing effect of Rab8 on Klotho expression regulation in non-small cell lung cancer |
| CN109030835B (en) * | 2018-09-06 | 2021-06-22 | 江苏省人民医院（南京医科大学第一附属医院） | Method for analyzing effect of Rab8 on Klotho expression regulation in non-small cell lung cancer |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Cancer‐associated fibroblast‐derived Lumican promotes gastric cancer progression via the integrin β1‐FAK signaling pathway | |
| Johnston et al. | Pepsin promotes proliferation of laryngeal and pharyngeal epithelial cells | |
| Choe et al. | Tumor–stromal interactions with direct cell contacts enhance motility of non-small cell lung cancer cells through the hedgehog signaling pathway | |
| Choe et al. | Crosstalk with cancer-associated fibroblasts induces resistance of non-small cell lung cancer cells to epidermal growth factor receptor tyrosine kinase inhibition | |
| San Martin et al. | Tenascin-C and integrin α9 mediate interactions of prostate cancer with the bone microenvironment | |
| Malanchi et al. | Interactions between cancer stem cells and their niche govern metastatic colonization | |
| Clark et al. | A bioengineered microenvironment to quantitatively measure the tumorigenic properties of cancer-associated fibroblasts in human prostate cancer | |
| Sato et al. | EGFR inhibitors prevent induction of cancer stem-like cells in esophageal squamous cell carcinoma by suppressing epithelial-mesenchymal transition | |
| Buttler et al. | Mesenchymal cells with leukocyte and lymphendothelial characteristics in murine embryos | |
| Azkanaz et al. | Retrograde movements determine effective stem cell numbers in the intestine | |
| Ma et al. | The anthraquinone derivative Emodin inhibits angiogenesis and metastasis through downregulating Runx2 activity in breast cancer | |
| Aveic et al. | TP-0903 inhibits neuroblastoma cell growth and enhances the sensitivity to conventional chemotherapy | |
| Janebodin et al. | An in vitro culture system for long-term expansion of epithelial and mesenchymal salivary gland cells: Role of TGF-β1 in salivary gland epithelial and mesenchymal differentiation | |
| Hu et al. | Evidence of TGF-β 1 mediated epithelial-mesenchymal transition in immortalized benign prostatic hyperplasia cells | |
| Ye et al. | Nr5a2 promotes cancer stem cell properties and tumorigenesis in nonsmall cell lung cancer by regulating Nanog | |
| Fogg et al. | Ovarian cells have increased proliferation in response to heparin-binding epidermal growth factor as collagen density increases | |
| Song et al. | EFEMP2 suppresses the invasion of lung cancer cells by inhibiting epithelial-mesenchymal transition (EMT) and down-regulating MMPs | |
| Zong et al. | ZNF488 is an independent prognostic indicator in nasopharyngeal carcinoma and promotes cell adhesion and proliferation via collagen IV/FAK/AKT/Cyclin D1 pathway | |
| CN105999271A (en) | New target for regulating and controlling tumor cell metastasis and application thereof | |
| Fujii et al. | Survival of detached cancer cells is regulated by movement of intracellular Na+, K+-ATPase | |
| You et al. | MiR106a promotes the growth of transplanted breast cancer and decreases the sensitivity of transplanted tumors to cisplatin | |
| Son et al. | Knockdown of tight junction protein claudin-2 prevents bile canalicular formation in WIF-B9 cells | |
| Lin et al. | Tumorigenesis and spontaneous metastasis by luciferase-labeled human xenograft osteosarcoma cells in nude mice | |
| Rada et al. | Disruption of integrin alpha-5/beta-1-dependent transforming growth factor beta-1 signaling pathway attenuates vessel co-option in colorectal cancer liver metastases | |
| Fan et al. | Vestigial suppresses apoptosis and cell migration in a manner dependent on the level of JNK‐Caspase signaling in the Drosophila wing disc |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161012 |