CN105999223A - Application of PDL1-IgGFc fusion protein in inhibition of severe malaria morbidity - Google Patents

Abstract

The invention discloses an application of a PDL1-IgGFc fusion protein in inhibition of severe malaria morbidity, and belongs to the technical field of anti-malaria drug preparation. A fusion gene of a PDL1 molecule extracellular fragment and an IgG molecule Fc fragment is constructed, the fusion gene is constructed into adenovirus or is expressed in vitro, and the fusion protein is verified to be successfully expressed by a Western Blot method. In in-vitro cell experiments, the fusion protein can significantly inhibit ConA induced CD8+T cell activation; at the same time, in mice in-vivo cell experiments, through caudal vein injection of recombinant adenovirus for expressing the PDL1-IgGFc fusion protein, occurrence of cerebral malaria caused by infection of a plasmodium berghei ANKA strain can be significantly alleviated, and the survival time of mice is prolonged. The PDL1-IgGFc fusion protein is indicated to have a role in inhibiting severe malaria morbidity, and the inhibition role is involved with inhibition of CD8+T cell activation. The fusion protein provides a new drug selection for treatment of cerebral malaria and other severe malaria in clinic.

Description

The application of PDL1-IgGFc fusion protein suppression severe malaria morbidity

Technical field

The invention belongs to anti-malaria medicaments preparing technical field, be specifically related to the application of PDL1-IgGFc fusion protein suppression severe malaria.

Background technology

Malaria is one of the most serious the most popular infectious disease, and the whole world has 3,200,000,000 people to be threatened by it, and global malaria disease number of cases in 2014 is about 2.14 hundred million people, dead 440,000 people.The plasmodium infecting people mainly has 5 kinds, severe malaria is generally caused by Plasmodium falciparum, wherein, cerebral malaria is one of the most serious severe malaria, research is had to point out, even if still may be up to 18% through its mortality rate of active treatment, Most of children Brain natriuretic peptide is dead, even if survival case also tends to leave over nervous system sequela in postictal 1-2 days of central nervous system symptom.Major part research is thought, cerebral malaria sticks cerebrovascular and causes by infecting plasmodial erythrocyte, followed by and the cerebral tissue local microcirculation obstacle risen and immunopathogenesis damage collaborative to cause blood-brain barrier disruption be the topmost Histopathologic characteristics of cerebral malaria.But so far, the concrete mechanism of cerebral malaria generation Blood Brain Barrier (BBB) permeability illustrates the most completely.

Existing numerous studies show: the plasmodium composition of the cerebrovascular endothelial cell picked-up of activation can be combined with MHC I quasi-molecule, and intersect offer to CD8+T cell, plasmodium specific C D8+T cell (CTL cell) target killing these offer the endotheliocyte of plasmodium antigens, cause the pathological change such as Blood Brain Barrier (BBB) permeability and follow-up hemorrhage, cerebral edema.Therefore, it can speculate: if the activation degree of CD8+CTL cell when lowering Infected With Plasmodium with suitable approach, it is possible to alleviate Blood Brain Barrier (BBB) permeability degree, thus reduce incidence rate and the mortality rate of cerebral malaria.

Programmed death receptor-1 (Programmed cell death-1, PD-1) it is the important negative regulator costimulatory molecules of T cell surface expression of activation, be combined with PD-1 part, transduction T cell suppression signal, T cell propagation and activity can be suppressed, be conducive to maintaining immunity of organism homeostasis, thus prevent the generation of excessive immunologic injury and autoimmune disease.PD-1 part has PDL1 and PDL2 two kinds.The breakthrough that PD-1/PD-L path research in recent years obtains in the field such as antitumor, anti-autoimmune disease brings new enlightenment to cerebral malaria immunization therapy.

Research in non-cerebral malaria model shows, PD-1 expresses and causes T effector cell exhaustion, if blocking PD-1/PD-L path, then t cell response level improves further, is more beneficial for host and removes plasmodium.Simultaneously, according to the research of this seminar early stage, in cerebral malaria model, if blocking PD-1/PDL path, then mice cerebral malaria symptom can be because t cell response level improves further and increases the weight of, decreased survival time, therefore this seminar proposes, in cerebral malaria model, PD-1/PDL path signal is improved as artificial, suppression CD8+T cell hyperactivity, then be expected to alleviate cerebral malaria symptom, thus provides new Therapeutic Method for the severe malaria such as clinical treatment cerebral malaria.

Summary of the invention

It is an object of the invention to provide the application of a kind of PDL1-IgGFc fusion protein suppression severe malaria morbidity.

The present invention is to be achieved through the following technical solutions:

The invention discloses the application in the medicine of preparation treatment severe malaria of the PDL1-IgGFc fusion protein.

Described medicine is the suppression overactive medicine of T cell.

The action target spot of described medicine is the PD-1 molecule being expressed in activating T cell surface.

Described medicine is the medicine by PD-1/PD-L approach suppression CD8+T cell hyperactivity.

Described medicine is the medicine of suppression encephalic malaria.

The fusion protein that described PDL1-IgGFc fusion protein is made up of PDL1 molecule extracellular fragment and IgG molecule Fc fragment.

The nucleotide sequence of coding PDL1-IgGFc fusion protein is as shown in SEQ.ID.NO.1.

The cell administration amount of PDL1-IgGFc fusion protein is 1 μ g/ml～100 μ g/ml.

The animal dosage of PDL1-IgGFc fusion protein is 1～100mg/kg.

Compared with prior art, the present invention has a following useful technique effect:

The method by molecular biology that the present invention provides, build PDL1 molecule extracellular fragment and the fusion gene of IgG molecule Fc fragment, this Fusion gene construction is entered adenovirus or expresses in vitro, by this expressing fusion protein success of qPCR and Western Blot method validation.In vitro in cell experiment, this fusion protein can significantly inhibit the CD8+T cell activation of ConA induction, simultaneously in In-vivo test in mice, the recombinant adenovirus of tail vein injection expression PDL1-IgG1Fc fusion protein can substantially be alleviated P. berghei peace card strain and infect the generation of the cerebral malaria caused, and extends the life span of mice.Therefore, present invention demonstrates that PDL1-IgGFc fusion protein has the effect that suppression severe malaria occurs, and the activation that this inhibitory action can suppress CD8+T cell with it is relevant.This fusion protein is that the severe malarias such as clinical treatment cerebral malaria provide new medicament selection.

Accompanying drawing explanation

Fig. 1 is Cloning of mouse's PDL1 extracellular fragment and IgG1Fc fragment gene result figure；Wherein, (a) is PDL1 extracellular fragment PCR result, and (b) is IgG1Fc fragment PCR result；

Fig. 2 is pIRES2-EGFP plasmid map；

Fig. 3 is that IgG1Fc-pIRES2 builds result, and EcoR I and Sac II double digestion qualification result, small fragment is IgG1Fc；

Fig. 4 is that PDL1-IgG1Fc-pIRES2 builds result；Wherein, (a) is Bgl II and EcoR I double digestion qualification result, and small fragment is PDL1；B () is the plasmid schematic diagram successfully constructed；

Fig. 5 is PDL1-IgG1Fc-pIRES2 rotaring redyeing 293 cell, the expression of results of basis of microscopic observation green fluorescent protein；

Fig. 6 is recombination adenovirus construction principle schematic；

Fig. 7 is that PCR verifies PDL1-IgG1Fc/IgG1Fc-PMT85 shuttle vector result；Wherein, (a) is that PCR verifies PDL1-IgG1Fc；B () is that PCR verifies IgG1Fc；

Fig. 8 is PDL1-IgG1Fc/IgG1Fc-PMT85 shuttle vector collection of illustrative plates；Wherein, (a) is PDL1-IgG1Fc-PMT85；B () is IgG1Fc-PMT85；

Fig. 9 is restructuring adenovirus infection HEK293 cell；

Figure 10 is Western Blot testing goal protein expression；

Figure 11 is vivoexpression destination protein Western Blot testing result；

Figure 12 is that PDL1-IgG1Fc suppresses spleen cell proliferation results；Wherein, (a) is that ConA stimulates spleen cell propagation, cell quantity 1 × 10⁶Cells/well, stimulates 72 hours；B () is that PDL1-IgG1Fc suppresses spleen cell proliferation results；

Figure 13 is that PDL1-IgG1Fc suppresses CD8+T Cell proliferation results；Wherein, (a) be ConA concentration be 2 μ g/ml, stimulate 72 hours；B () PDL1-IgG1Fc suppresses CD8+T Cell proliferation results；

Figure 14 is PDL1-IgG1Fc recombinant adenovirus experiment in vivo result.

Detailed description of the invention

Below in conjunction with specific embodiment, the present invention is described in further detail, and the explanation of the invention is not limited.

Present invention preliminary result in PD-1 gene knockout cerebral malaria mouse model demonstrates: cerebral malaria is lapsed to have and significantly affects by the regulation and control of PD-1/PD-L path, and this allows for alleviating the Immunotherapy Strategy of the severe malaria symptoms such as cerebral malaria be possibly realized by suitably raising PD-1/PD-L path.

The present invention proposes hypothesis below based on above result of study: if in mice cerebral malaria model, can allow vascular endothelial cell specificity process LAN PD-L part, then CD8+CTL cell will accept more PD-L signal from endotheliocyte, its surface just has more PD-1 receptor and is activated, thus signal is more suppressed to endocellular transduction, lower the activation degree of CD8+CTL cell further, finally alleviate the degree of injury of endotheliocyte and blood brain barrier, reduce incidence rate and the mortality rate of cerebral malaria.

The present invention constructs a kind of PDL1-IgG1Fc fusion protein, and this fusion protein is by the excessive immunoreation of suppression body thus reaches the effect suppressing cerebral malaria to occur, thus provides new method for severe malarias such as clinical treatment cerebral malaria.

1, the structure of PDL1-IgG1Fc fusion gene

1.1 obtain mice PDL1 extracellular fragment and IgG1Fc fragment gene

1.1.1 primer is designed

According to NCBI data, design amplification PDL1 extracellular fragment and the primer of IgG1Fc fragment gene, it is to insert pIRES2-EGFP carrier smoothly simultaneously, add suitable restriction enzyme digestion sites, additionally, due to the hinge region of IgG1Fc molecule exists 4 cysteine, disulfide bond can be formed, therefore the method using point mutation, is serine by cysteine mutation.

PDL1F:CAGAGA TCTATG AGG ATA TTT GCT GGC ATT (black underscore is Bgl II restriction enzyme site)

PDL1R:CTCGAA TTCGTG AGT CCT GTT CTG TGG AGG (black underscore is EcoR I restriction enzyme site)

IgG1Fc F:GACGAA TTCGTG CCC AGG GAT AGT GGT AGT AAG CCT AGC ATA AGT ACA GTC CCA GAA GTA TCA TCT (black underscore is EcoR I restriction enzyme site)

IgG1Fc R:ATTCCG CGGTCA TTT ACC AGG AGA GTG GGA (black underscore is Sac II restriction enzyme site).

1.1.2 extract mice total serum IgE and reverse transcription is cDNA

Mice is implemented eyeball and takes blood, it is thus achieved that mouse peripheral blood, use mouse lymphocyte separation liquid separating mouse peripheral blood mononuclear lymphocyte (PBMC), extract the total serum IgE of mice PBMC, be cDNA by RNA reverse transcription.

Total serum IgE extracts:

(1) every 5 × 10⁶Cell adds 1ml TRizol, piping and druming mixing, is transferred in 1ml EP pipe；

(2) often pipe adds 200 μ l chloroforms, turns upside down EP pipe 15s with hands, and room temperature stands 10min, 4 DEG C, 12000rpm, centrifugal 15min；

(3) draw supernatant and move to new 1.5ml EP pipe, add the isopropanol of equal-volume pre-cooling, mix rear 4 DEG C of precipitation 10min；

(4) 4 DEG C, 12000rpm, after centrifugal 10min, removes supernatant；

(5) 1ml 75% ethanol (the water Fresh processed with DEPC) is added, washing precipitation；

(6) 4 DEG C, 10000rpm, centrifugal 5min, discard major part supernatant；

(7) 4 DEG C, 10000rpm recentrifuge 5min, suck supernatant

(8) drying at room temperature, wait evaporate clean after, add 20 μ l RNase-free water, to being completely dissolved, ultra-violet analysis measures the concentration of institute's extracting RNA, gained RNA carry out reverse transcription reaction immediately or 70 DEG C frozen.

RNA reverse transcription obtains cDNA

Taking 1 μ g RNA is template, use TAKARA Reverse Transcriptase kit, be cDNA by RNA reverse transcription, reaction condition: 37 DEG C reaction 1h, 85 DEG C of 5s make reverse transcriptase inactivate, product can be used to do next step pcr template or-20 DEG C frozen.

1.1.3 Cloning of mouse PDL1 extracellular fragment and IgG1Fc fragment gene

With mice cDNA as template, use the high-fidelity DNA polymerase of TAKARA company, respectively with PDL1 primer to and IgG1Fc primer to PCR amplification PDL1 extracellular fragment and IgG1Fc fragment gene, reaction condition: 95 DEG C of denaturations 5min, 95 DEG C of degeneration 30 seconds, anneal 30 seconds for 62 DEG C, and 72 DEG C extend 1 minute, carrying out 35 circulations altogether, 72 DEG C extend 5 minutes eventually.1.5% agarose gel electrophoresis, result is as shown in Figure 1, a () is PDL1PCR result, swimming lane 1 is PDL1 extracellular fragment pcr amplification product, swimming lane 2 is Maker, and (b) is IgG1Fc PCR result, and swimming lane 1 is IgG1Fc fragment amplification product, swimming lane 2 is Maker, reclaims PCR primer.

The structure of 1.2 PDL1-IgG1Fc fusion genes

With pIRES2-EGFP carrier as skeleton, building PDL1-IgG1Fc-pIRES2 plasmid, pIRES2-EGFP plasmid map sees Fig. 2, and its multiple clone site contains Bgl II, EcoR I and Sac II restriction enzyme site.

1.2.1 build IgG1Fc-pIRES2 plasmid

Use EcoR I and Sac II double digestion pIRES2-EGFP plasmid and IgG1Fc PCR fragment respectively, 1.5% agarose gel electrophoresis, reclaim digestion products, with pIRES2 as carrier, T4DNA ligase is used IgG1Fc fragment to be connected on carrier, connection product is converted in XL-10 competent cell, coat on the solid LB media of kalamycin resistance, it is inverted overnight incubation, picking monoclonal bacterium colony, extract plasmid, EcoR I and Sac II double digestion are identified, as shown in Figure 3, swimming lane 2 is EcoR I and Sac II double digestion product, small fragment is IgG1Fc, swimming lane 1 is Maker, enzyme action identifies that correct product is delivered the order-checking of Sheng Gong biotech firm and identified.

1.2.2 build PDL1-IgG1Fc-pIRES2 plasmid

nullIdentify that correct IgG1Fc-pIRES2 plasmid and PDL1PCR fragment use Bgl II and EcoR I double digestion respectively，1.5% agarose gel electrophoresis，Reclaim digestion products，With IgG1Fc-pIRES2 as carrier，T4DNA ligase is used PDL1 fragment to be connected on carrier，Connection product is converted in XL-10 competent cell，Coat on the solid LB media of kalamycin resistance，It is inverted overnight incubation，Picking monoclonal bacterium colony，Extract plasmid，Bgl II and EcoR II double digestion are identified，See Fig. 4，In (a)，Swimming lane 1 is Maker，Swimming lane 2 is Bgl II and EcoR I double digestion product，Small fragment is PDL1，Enzyme action identifies that correct product is delivered the order-checking of Sheng Gong biotech firm and identified.

So far, having built PDL1-IgG1Fc fusion gene, and be integrated into pIRES2-EGFP plasmid, seen Fig. 4 (b), expression product is PDL1 extracellular fragment and IgG1Fc section fusion protein.

1.3 PDL1-IgG1Fc-pIRES2 plasmid transfection experiment

Checking PDL1-IgG1Fc-pIRES2 plasmid construction is correct, is transfected 293A cell, observes the expression of green fluorescent protein.

Recovery 293A cell, starts experiment after cell growth condition is good, when cell degrees of fusion is 80-90%, starts transfection procedure (as a example by 24 orifice plates)；

(1) 0.8 μ g plasmid DNA, gently 3-5 mixing of pressure-vaccum, left at room temperature 5min are diluted with 50 μ L serum-free mediums.

(2) overturn mixing transfection reagent gently, dilute 2.0 μ L Lipofectamine TM2000, gently 3-5 mixing of pressure-vaccum, left at room temperature 5min with 50 μ L serum-free mediums.

(3) mixing transfection reagent and plasmid DNA diluent, gently 3-5 mixing of pressure-vaccum, left at room temperature 20min.

(4) during transfection composite joins 24 porocyte plates, 100 μ L/ hole, front and back jog cell plates mix homogeneously.

(5) cell plates are placed in 37 DEG C, 5%CO₂Incubator is cultivated about 6h, carries out changing liquid, change the ordinary culture medium containing 10% serum into, at 37 DEG C, 5%CO₂Incubator continues cultivate.

(6), after 48-72h, the expression of fluorescence microscope transfected cell green fluorescent protein is used.

After transfected PDL1-IgG1Fc-pIRES2 plasmid, seeing Fig. 5, at fluorescence microscopy Microscopic observation, cell presents bright yellow-green fluorescence.

2, the recombination adenovirus construction of PDL1-IgG1Fc/IgG1Fc albumen is expressed

Use AdMax adenovirus packaging system, its operation principle is by the adenovirus shuttle plasmid of foreign gene-carrying and the auxiliary packaging plasmid cotransfection HEK293 cell carrying adenovirus most gene group, the effect utilizing Cre/loxP recombinase system realizes restructuring, produce recombinant adenovirus, as shown in Figure 6.The virus yield that this system is easy and simple to handle, recombination efficiency is high, obtain is high, the expression of genes of interest is high.

2.1 shuttle vectors build

PDL1-IgG1Fc gene is connected by this process with shuttle vector PMT85, IgG1Fc fragment is connected with shuttle vector PMT85 simultaneously, compares as the former.

2.1.1 IgG1Fc '-pIRES2 vector construction

Owing to IgG1Fc is 5 ' ends of IgG1 gene, not having promoter and signal peptide, need to redesign primer, introduce promoter and signal peptide, this experiment uses the promoter identical with PDL1 and signal peptide.

IgG1Fc ' Primer F:AGCAGA TCTATG AGG ATA TTT GCT GGC ATT ATA TTC ACA GCC TGC TGT CAC TTG CTA CGG GCG GTG CCC AGG GAT AGT GGT AGT promoter and the signal peptide sequence of PDL1 (the red sequence be)

IgG1Fc ' Primer R:ATTCCG CGG TCA TTT ACC AGG AGA GTG GGA

With IgG1Fc-pIRES2 plasmid as template, use the high-fidelity DNA polymerase of TAKARA company, with above-mentioned primer, PCR is expanded IgG1Fc fragment, reaction condition: 95 DEG C of denaturations 5min, 95 DEG C of degeneration 30 seconds, anneal 30 seconds for 62 DEG C, and 72 DEG C extend 1 minute, carrying out 35 circulations altogether, 72 DEG C extend 5 minutes eventually.1.5% agarose gel electrophoresis, reclaims PCR primer-IgG1Fc '.

Use Bgl II and EcoR I double digestion pIRES2-EGFP plasmid and IgG1Fc ' PCR fragment respectively, 1.5% agarose gel electrophoresis, reclaim digestion products, with pIRES2 as carrier, T4DNA ligase is used IgG1Fc ' fragment to be connected on carrier, connection product is converted in XL-10 competent cell, coat on the solid LB media of kalamycin resistance, it is inverted overnight incubation, picking monoclonal bacterium colony, extracting plasmid, Bgl II and EcoR I double digestion to identify, enzyme action identifies that correct product is delivered the order-checking of Sheng Gong biotech firm and identified.

2.1.2 PDL1-IgG1Fc-/IgG1Fc '-PMT85 shuttle vector builds

For convenience of being connected with PMT85 shuttle vector, Xbal I and the restriction enzyme site of Cla I restricted enzyme need to be introduced respectively at PDL1-IgG1Fc/IgG1Fc ' gene two ends.

Primer 1:G AAC CGT CAG ATCTCTAGAGCC ACC ATG AGG ATA TTT GCT GGC ATT ATA (black underscore is Xbal I restriction enzyme site)

Primer 2:G AGG TTG ATTATCGATTCA TTT ACC AGG AGA GTG GGA GAG (black underscore is Cla I restriction enzyme site)

With PDL1-IgG1Fc-pIRES2/IgG1Fc '-pIRES2 plasmid as template, use the high-fidelity DNA polymerase of TAKARA company, PDL1-IgG1Fc/IgG1Fc ' fragment is expanded as primer PCR using Primer 1 and Primer 2, reaction condition: 95 DEG C of denaturations 5min, 95 DEG C of degeneration 30 seconds, anneal 30 seconds for 55 DEG C, and 72 DEG C extend 1 minute, carrying out 35 circulations altogether, 72 DEG C extend 5 minutes eventually.1.5% agarose gel electrophoresis, reclaims PCR primer.

Use Xbal I and Cla I double digestion PMT85 plasmid and PDL1-IgG1Fc/IgG1Fc ' fragment respectively, 1.5% agarose gel electrophoresis, reclaim digestion products, with PMT85 as carrier, use T4DNA ligase PDL1-IgG1Fc/IgG1Fc ' fragment to be connected on carrier, connection product is converted in XL-10 competent cell, coat on the solid LB media of kalamycin resistance, be inverted overnight incubation, picking monoclonal bacterium colony, extract plasmid, use PCR method to verify:

Checking primer

Primer ID(+)CGCAAATGGGCGGTAGGCGTG

Primer ID (-) GAAATTTGTGATGCTATTGC

Reaction condition: 95 DEG C of denaturations 5min, 95 DEG C of degeneration 30 seconds, anneal 30 seconds for 55 DEG C, 72 DEG C extend 1 minute, carry out 35 circulations altogether, and 72 DEG C extend 5 minutes eventually, and 1.5% agarose gel electrophoresis detects.Result sees Fig. 7, and wherein, (a) is that PCR verifies PDL1-IgG1Fc, and swimming lane 1 is Maker, and swimming lane 2 is PDL1-IgG1Fc PCR primer, and (b) is that PCR verifies IgG1Fc, and swimming lane 1 is Maker, and swimming lane 2 is IgG1Fc PCR primer.Two shuttle vectors have built, collection of illustrative plates such as Fig. 8.

2.2 recombinant adenovirus packagings

(1) recovery HEK293 cell, uses after cell growth condition is good；

(2) day before transfection, inoculates in 10cm Tissue Culture Dish by cell, and density when controlling cell transfecting is 70-90%；

(3) transfect previous hour and take out cell culture vessel, remove original cell culture medium, add the Opti-MEM culture medium of 10ml, send cell back to incubator；

(4) complex of transfection reagent and plasmid is prepared:

Take 1.5ml Ep pipe one, add viral vector plasmid to be transfected, with Opti-MEM culture medium polishing to 500 μ l, mix gently；

Take 1.5ml Ep pipe one, add Trans-EZ solution, with Opti-MEM culture medium polishing to 500 μ l, mix gently；

Being added drop-wise in plasmid diluent by Trans-EZ diluent, limit edged is placed 20 minutes in room temperature after mixing gently, makes DNA and Trans-EZ fully combine and forms stable transfecting complexes；

(5) take out Tissue Culture Plate, DNA-Trans-EZ complex obtained above is joined in cell culture vessel, carries out labelling, put back to incubator；

(6) sucking culture medium after 6h, PBS washes once, adds 10ml fresh growth medium and cultivates, and if any a large amount of cell levitatings, does not removes supernatant, adds 6ml complete medium, 37 DEG C of incubated overnight, change liquid next day；

Within (7) three days, change once, virus plaque occurred in general about 7-15 days.

Treat that typical pathological changes occurs in most cells, and have the cell of 50% to take off wall (as it is shown in figure 9, a large amount of levitating of cell, and great expression green fluorescent protein), collect cell ,-70 DEG C with 37 DEG C of multigelations 3 times, collect viral supernatants in-70 DEG C of preservations.

The amplification in a small amount of 2.3 recombinant adenoviruss

(1) when cultivate HEK293 cell reach 80～90% converge time, abandon culture fluid, keep and cover cell surface a little；

(2) with liquid-transfering gun, the above-mentioned virus liquid of 10 μ l is added in 10cm Tissue Culture Dish, mixing, put into 37 DEG C, in 5%CO2 incubator；

(3) add 10ml culture fluid after 2h, put into incubator and cultivate；

After (4) 4～5 days, HEK293 to be cultivated becomes round, de-wall, some cells float, and its color from orange become yellow time show cell pathological changes, can collect with liquid-transfering gun ,-70 DEG C save backup.

A large amount of amplifications of 2.4 recombinant adenoviruss and gradient centrifugation purification

This experiment recombinant adenovirus is used for zoopery, uses the classical caesium chloride density gradient centrifugation method of Hitt et al. (1998) to be purified.

(1) cell is prepared: use for 30 × 150mm culture dish, when all infected cell roundings and fraction floats shave culture dish, then proceed in 50ml centrifuge tube by cell and supernatant, 750g, centrifugal 10 minutes.Resuspended with the Tris-HCl (PH 8.0) of the 0.1M of 15ml ,-80 DEG C of preservations.

(2) sample dissolution, every 15ml cell solute adds 1.5ml 5% NaTDC, mixing incubated at room 30 minutes.Obtain clarification relatively, full-bodied suspension.

(3) the cell solute of every 15ml adds DNase I solution of 150 μ l magnesium chlorides and 75 μ l, mixing, hatches 30-60 minute for 37 DEG C, and every mixing in 10 minutes once, now viscosity should reduce, only a little than the somewhat thickness of water.

(4) high speed tabletop centrifuge is used, 4 DEG C, high speed centrifugation 15 minutes.

(5) simultaneously, prepare cesium chloride gradient (with the ultrapure pipe of SW41 rotor, sample for 5ml): each pipe adds the cesium chloride solution of the 1.5g/cc of 0.5ml, the cesium chloride solution of the 1.35g/cc spreading 3ml above gently, the cesium chloride solution of the 1.25g/cc repaving last layer 3ml gently.Gradient cannot be upset after adding well.

(6) the supernatant 5ml that the pipe of each gradient obtains in adding the 4th step.

(7) using SW41 rotor, 4 DEG C, 35 000rpm are centrifuged, 1 hour (accelerate and deceleration arranges 1)

(8) virus band (should be between 1.25g/cc and 1.35g/cc) is collected.

(9) transfer to the virus band obtained, in the aseptic pipe that SW50.1 rotor is supporting, fill it up with pipe with 1.35g/cc solution), mixing.Use SW50.1 rotor, 4 DEG C, 35 000rpm, centrifugal 16-20 hour (or use SW41 rotor, and 10 DEG C, 35000rpm, be centrifuged 16-24 hour).

(10) with the least volume collection virus (typically 0.5-1ml), proceeding in bag filter, 4 DEG C, the 10mM Tris-HCl, PH 8.0 of 500 times of volumes (or bigger) dialyses, at least 24 hours, between change 2-3 solution.

(11), after dialysis, the viral subpackage aliquot-80 of purification preserves.

2.5 recombinant adenovirus titre detections

(1) choose HEK293 cell in good condition, use complete medium re-suspended cell, be prepared as 5.0 × 10⁵The cell suspension of individual/ml, plants into 1ml cell, 37 DEG C, 5%CO in the 24 each holes of orifice plate₂Cultivate.

(2) virus sample getting out 10 times of gradient dilutions (prepares 7 aseptic Ep pipes, adds the complete culture solution of 990 μ l, respectively add the complete culture solution of 900 μ l in remaining 6 pipe in first Ep pipe；The dilution of virus liquid to be measured: take 10 μ l adenoviral stocks and add and do 1:100 dilution (10 in the Ep pipe of 990 μ l^-2)；The most with this as the starting point, then take 100 μ l diluents and join the Ep pipe of 900 μ l does 1:10 dilution (10^-3), until being diluted to 10^-8), the most successively by 10^-5To 10^-8The virus liquid of dilution adds in 24 orifice plates, and every hole adds 100 μ l, and each dilution factor takies a hole.

(3) 37 DEG C, 5%CO2 infect 48 hours.

(4) removal culture fluid gently, is slowly added into the methanol 0.5ml of pre-cooling ,-20 DEG C of fixing 20min (rifle head does not touch cell) along 24 orifice plate sidewalls.

(5) using PBS flushing cell gently 3 times, cell (is never rushed) by each 5min.

(6) add 0.2ml 1%BSA 37 DEG C to close 1 hour.

(7) add in an anti-solution extremely each hole of 0.2ml, hatch 1 hour for 37 DEG C.

(8) PBS flushing cell gently is used 3 times, each 5min.

(9) add the two of 0.2ml to resist to every hole, hatch 1 hour for 37 DEG C.

(10) PBS flushing cell gently is used 3 times, each 5min.

(11) working solution of company newly configured for addition 0.2ml is to every hole, incubated at room 5-10min (incubation time does not exceeds 10min).

(12) abandoning working solution, use PBS 2 times, every hole adds 1mlPBS.

(13) every hole randomly chooses 5 visuals field, uses and calculates positive cell number under optical microscope 10 × object lens.

(14) mean number and the virus titer of every hole positive cell are calculated.

Result of calculation:

The positive cell average that this experiment calculates in 5 visuals field under the microscope is 28.2, this hole viral dilution 10⁷Times, draw according to above formula:

PDL1-IgG1Fc recombinant adenovirus titre: 2.23 × 10¹¹pfu/ml

IgG1Fc recombinant adenovirus titre: 2.29 × 10¹¹pfu/ml。

2.6 recombinant expressed detection qPCR

2.6.1 Real time PCR testing goal gene expression

QPCR primer:

PDL1-IgG1Fc F:AATCAACCAGAGAATTTCC

PDL1-IgG1Fc R:TTGTCCAGATTACCTCAG

IgG1Fc F:CCATTACTCTGACTCCTAA

IgG1Fc R:CCTCCACATCATCTACAA

PDL1-IgG1Fc recombinant adenovirus and IgG1Fc recombinant adenovirus transfection 293T cell, after 5 days, extract cell RNA and reverse transcription be cDNA, and use above-mentioned primer qPCR testing goal gene mRNA transcribes situation,

Reaction condition (two-step method): 95 DEG C of denaturations 30 seconds, 95 DEG C of degeneration 5 seconds, 60 DEG C of annealing, extend 30 seconds, circulate 40 times, using 2-Δ Δ Ct analytic process to analyze genetic transcription situation, genes of interest (PDL1-IgG1Fc, IgG1Fc) has process LAN, as shown in Table 1 and Table 2, compared with compared with control cells (the empty adenovirus of transfection), PDL1-IgG1Fc and IgG1Fc process LAN 1 × 10 respectively⁸With 3.3 × 10⁷Times.

Expression efficiency (PDL1-IgG1Fc) after table 1 qPCR checking recombinant adenovirus transfectional cell

Sample	Actin(CT)	PDL1-IgG1Fc(CT)	-ΔCt	-ΔΔCt	2-ΔΔCt
						PMT85	18.22405	40	-21.7759	0	1
PSB2030	18.73667	13.93551	4.801158	26.57711	1×108
						BLANK	19.00078	Undetermined			Nothing

Expression efficiency (IgG1Fc) after table 2 qPCR checking recombinant adenovirus transfectional cell

Sample	Actin(CT)	IgG1Fc(CT)	-ΔCt	-ΔΔCt	2-ΔΔCt
						PMT85	18.22405	40	-21.7759	0	1
PSB2030	18.73667	15.13091	4.801158	26.57711	32666477
						BLANK	19.00078	Undetermined			Nothing

Wherein, BLANK is 293T cell；PMT85 is comparison adenoviral plasmid transfection 293T cell；Psb2030 is that PDL1-IgG1Fc gene overexpression adenoviral plasmid transfects 293T groups of cells；Psb2032 is that IgG1Fc gene overexpression adenoviral plasmid transfects 293T groups of cells.

2.6.2Western the expression of blot testing goal albumen

(1) receive sample to extract with total protein, quantitatively:

Receive the cell of cell platform, discard cell culture fluid, add, by cell concentration, the 1.5ml EP pipe that appropriate 1 × Lysis Buffer, 4 DEG C of cell lysis 10～15min, and labelling are empty；

Scrape with cell or liquid-transfering gun scrapes cell or blows down, and be transferred in the 1.5ml EP pipe that corresponding labelling is good, ice bath 10～15min；

4 DEG C, 12 000g, centrifugal 5min, in slow absorption supernatant to new 1.5ml EP pipe；

BCA method protein quantification (concrete steps reference reagent box description), calculates protein concentration；

Process protein sample: add 5 × Loading Buffer, 95 DEG C～100 DEG C heating 5min ,-20 DEG C of preservations.

(2) preparation SDS-PAGE

(3) loading electrophoresis, 100V, electrophoresis 1.5 hours；

(4) transferring film, under 400mA constant current conditions, electricity turns 120min；

(5) the TBST solution containing 5% skim milk closes pvdf membrane；

(6) one anti-hatch: with PE glove, the pvdf membrane closed is wrapped, add the antibody of confining liquid dilution, 4 DEG C of overnight incubation；

(7) 1 × TBST wash film 3 times, each 10min；

(8) two anti-hatch: resist with confining liquid dilution corresponding two, incubated at room temperature pvdf membrane 2h

(9) film is washed: 1 × TBST washes film 3 times, each 10min.

(10) ECL colour developing, X-ray develops, and carries out obtaining the film of display band in dark place.

As shown in Figure 10, swimming lane 2 is compared with control cells (untransfected adenovirus) to experimental result, and swimming lane 3 is PDL1-IgG1Fc Adenovirus Transfection cell, and swimming lane 4 is IgG1Fc Adenovirus Transfection cell, and compared with matched group, destination protein has great expression.

3, PDL1-IgG1Fc protein active detection (cellular level)

Overactive CD8+T cell plays a part important and key in the pathogenic process of severe malaria, if suppressing CD8+T cell hyperactivity by PDL1-IgG1Fc fusion protein, then it is expected to use the generation of PDL1-IgG1Fc fusion protein suppression severe malaria, this part experiment purpose to be the ability of vitro detection PDL1-IgG1Fc suppression T cell activation.

Cooperating with biochemistry teaching and research room of this department, vivoexpression purification PDL1-IgG1Fc and IgG1Fc (as comparison) albumen Western blot testing result are shown in that Figure 11, swimming lane 1 are PDL1-IgG1Fc fusion protein, 2 IgG1Fc albumen of swimming lane.

3.1 PDL1-IgG1Fc suppression spleen cell propagation

T lymphocyte just can need to be bred under certain incentive condition, therefore detection PDL1-IgG1Fc suppression T cell propagation efficiency can evaluate the activity of PDL1-IgG1Fc.

3.1.1 determine that ConA stimulates the condition of spleen cell propagation

Disconnected neck puts to death mice, takes out spleen cell, grinds, cross 500 eye mesh screens, collect single cell suspension, use erythrocyte cracked liquid splitting erythrocyte, collect spleen cell and count under aseptic condition；Use 96 orifice plates, use drug concentration gradient (ConA Concentraton gradient: 0,05,1,2,4,6,8,10 μ g/ml), cell quantity gradient (splenocyte quantity difference 1 × 10 respectively⁵、2×10⁵、5×10⁵、1×10⁶Individual cells/well) and stimulation time gradient (stimulation time 48h, 72h), use CCK8 kit detection cell multiplication rate, determine every hole 1 × 10⁶Cells/well, ConA concentration is 2 μ g/ml, stimulates 72 hours optimal stimulus conditions (as shown in Figure 12 (a)) for T cell propagation.

3.1.2 PDL1-IgG1Fc suppression spleen cell propagation

(splenocyte quantity 1 × 10 under optimal ConA incentive condition⁶Cells/well, ConA concentration is 2 μ g/ml, stimulate 72 hours), use PDL1-IgG1Fc Concentraton gradient (0,0.3,1,3,10 μ g/ml), compared with matched group (IgG1Fc albumen), 10 μ g/ml PDL1-IgG1Fc can significantly inhibit Spleen cell proliferation (as shown in Figure 12 (b), cell proliferation is substantially suppressed).

3.2 PDL1-IgG1Fc suppresses CD8+T cell proliferation

3.2.1 paramagnetic particle method separates CD8+T cell

Disconnected neck puts to death mice, takes out mouse spleen, grinds, cross 500 eye mesh screens, collect single cell suspension, use erythrocyte cracked liquid splitting erythrocyte under aseptic condition, collects spleen cell, numeration；

Spleen cell is blown and beaten gently uniformly, to the cell count collected, take 1 × 10⁷Individual spleen cell, uses U.S. sky Ni CD8+T cell separation test kit (Solid phase) to separate CD8+T cell, numeration, uses CD3 and CD8 antibody Flow Cytometry grouping system efficiency more than 90%.

3.2.2 ConA stimulates CD8+T cell proliferation

According to the experiment of Spleen cell proliferation, determine that ConA stimulates the condition of CD8+T cell proliferation: splenocyte quantity 1 × 10⁵Cells/well (CD8+T cell accounts for splenocyte total amount 10%), ConA concentration is 2 μ g/ml, stimulates 72 hours, shown in results of stimulation such as Figure 13 (a).

3.2.3 PDL1-IgG1Fc suppresses CD8+T cell proliferation

(CD8+T cell quantity 1 × 10 under optimal ConA incentive condition⁵Cells/well, ConA concentration is 2 μ g/ml, stimulate 72 hours), use PDL1-IgG1Fc Concentraton gradient (0,0.3,1,3,10 μ g/ml), compared with matched group (IgG1Fc albumen), 10 μ g/ml PDL1-IgG1Fc can significantly inhibit CD8+T cell proliferation, as shown in Figure 13 (b).

Conclusion: PDL1-IgG1Fc has the ability significantly suppressing CD8+T cell proliferation, and CD8+T cell activation is suppressed, and is expected to the generation for alleviating severe malaria.

4 PDL1-IgG1Fc recombinant adenovirus experiment in vivo

Test-type cerebral malaria model is set up: week old is the healthy C57BL6 mice in 6-8 week, intraperitoneal inoculation 1 × 10⁶The erythrocyte (iRBC) that the peace card strain of individual P. berghei is infected, after 7-14 days, mice there will be cerebral malaria symptom and death.

Taking the C57 mice of health, be divided into three groups, often group 10, is respectively as follows: 1. PDL1-IgG1Fc recombinant adenovirus；2. IgG1Fc recombinant adenovirus；3. empty adenovirus.Every mouse peritoneal inoculation 1 × 10⁶Individual iRBC, sets up cerebral malaria；Every mice is inoculating the previous day of iRBC, first day, the 3rd day, the 5th day respectively, is 1 × 10 through tail vein injection 0.2ml titre¹⁰The corresponding recombinant adenovirus (total 2 × 10 of each group of pfu/ml⁹Pfu/ is only), within after infection the 3rd day, rise, detect mice parasitemia level every day, observe mouse survival situation simultaneously, draw survival curve.Compared with matched group, PDL1-IgG1Fc recombinant adenovirus can significantly extend the mouse survival time, as shown in figure 14, green curve is injection PDL1-IgG1Fc recombinant adenovirus, prove that PDL1-IgG1Fc albumen can significantly reduce the generation of mouse experiment type cerebral malaria, extend the life span of infecting mouse, thus provide valuable time for clinical treatment severe malaria.

Claims (9)

1. The application in the medicine of preparation treatment severe malaria of the 1.PDL1-IgGFc fusion protein.
2. Apply the most as claimed in claim 1, it is characterised in that described medicine is suppression T cell mistake The medicine of degree activation.
3. Apply the most as claimed in claim 2, it is characterised in that the action target spot of described medicine is for expressing PD-1 molecule in activating T cell surface.
4. Apply the most as claimed in claim 3, it is characterised in that described medicine is for passing through PD-1/PD-L The medicine of approach suppression CD8+T cell hyperactivity.
5. Apply the most as claimed in claim 1, it is characterised in that described medicine is suppression encephalic malaria Medicine.
6. Apply the most as claimed in claim 1, it is characterised in that described PDL1-IgGFc fusion protein The fusion protein being made up of PDL1 molecule extracellular fragment and IgG molecule Fc fragment.
7. Apply the most as claimed in claim 1, it is characterised in that coding PDL1-IgGFc fusion protein Nucleotide sequence as shown in SEQ.ID.NO.1.
8. Apply the most as claimed in claim 1, it is characterised in that the cell of PDL1-IgGFc fusion protein Dosage is 1 μ g/ml～100 μ g/ml.
9. Apply the most as claimed in claim 1, it is characterised in that the animal of PDL1-IgGFc fusion protein Dosage is 1～100mg/kg.