CN105969883A - SNIP1 as target for diagnosis and treatment of inflammatory bowel disease - Google Patents
SNIP1 as target for diagnosis and treatment of inflammatory bowel disease Download PDFInfo
- Publication number
- CN105969883A CN105969883A CN201610470803.2A CN201610470803A CN105969883A CN 105969883 A CN105969883 A CN 105969883A CN 201610470803 A CN201610470803 A CN 201610470803A CN 105969883 A CN105969883 A CN 105969883A
- Authority
- CN
- China
- Prior art keywords
- snip1
- inflammatory bowel
- inflammatory
- expression
- bowel disease
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6875—Nucleoproteins
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
- G01N2333/4701—Details
- G01N2333/4703—Regulators; Modulating activity
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/06—Gastro-intestinal diseases
- G01N2800/065—Bowel diseases, e.g. Crohn, ulcerative colitis, IBS
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/06—Gastro-intestinal diseases
- G01N2800/067—Pancreatitis or colitis
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Biomedical Technology (AREA)
- Pharmacology & Pharmacy (AREA)
- Zoology (AREA)
- Veterinary Medicine (AREA)
- Biochemistry (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pathology (AREA)
- Genetics & Genomics (AREA)
- Epidemiology (AREA)
- Organic Chemistry (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to application of SNIP1 in diagnosis and treatment of an inflammatory bowel disease. The conditions that in the active phase, expression of SNIP1 in epithelial cells of inflammatory intestinal mucosa tissue of an inflammatory bowel disease patient is obviously reduced, however the expression quantity of the SNIP1 in the epithelial cells of the inflammatory bowel disease patient in remission has no difference with that of a normal control, are discovered for the first time, which hints that the SNIP1 can be used as a biomarker for the inflammatory bowel disease and diagnosis of activity of the inflammatory bowel disease. Further research shows that the SNIP1 has a function of inhibiting the epithelial cells from secreting inflammatory factors, the expression of the SNIP1 in the epithelial cells of a DSS-induced mouse intestinal inflammation model is improved, and the SNIP1 has a function of inhibiting DSS-induced intestinal mucosa inflammatory injury, which hint that the SNIP1 can be used as a new target for clinic treatment of the inflammatory bowel disease.
Description
Technical field
The present invention relates to clinical diagnosis mark and the therapy target of disease, specifically, relate to SNIP1 in inflammatory bowel
Application in sick diagnosis and treatment.
Background technology
Inflammatory bowel (inflammatory bowel disease, IBD) includes ulcerative colitis (UC) and Crow
Grace is sick (CD), is a kind of generation in gastrointestinal chronic nonspecific inflammation disease.Inflammatory bowel and canceration thereof at present
Reason and the mechanism of journey are the most unclear, immunity may adjust in, Intestinal Mucosal Tissues impaired with lasting intestinal infection, gut barrier
Joint is disorderly, gene susceptible with environment etc. factor relevant.China's inflammatory bowel number of patients is obvious ascendant trend in recent years, makes
Become heavy social medical economy burden.
The diagnosis of inflammatory bowel at present is mainly scope and histopathological examination, traumatic relatively big, and lacks clinically
The weary specific index the most relevant to inflammatory bowel and activeness thereof.Thus, it is found that the diagnosis marker of inflammatory bowel
It is extremely important for diagnosis and treatment process clinically, and the treatment for inflammatory bowel also has positive effect.
SNIP1 (Smad nuclear interacting protein 1, Smad nuclear interaction protein 1) be by
The nucleoprotein of 396 aminoacid compositions, its aminoterminal has important nuclear localization signal (N-terminal bipartite
Nuclear localization signal, NLS), it is the SNIP1 important area that regulates and controls other gene expressions.Occur at IBD
During development, NF-κ B is proved to be important the transcribing causing the inflammatory Cytokines Expression such as TNF-α, IL-1 β, IL-6 to raise
The factor.Research shows, SNIP1 not only can be done directly on the subunit p65 of NF-κ B, the most also can turning by suppression NF-κ B
The activity of record cofactor CBP/p300, indirectly causes the transcriptional activity of NF-κ B to reduce, shows that SNIP1 has important suppression
The function of inflammatory signals.
But at present SNIP1 expression in IBD patient's colon epithelial cell and function are the most unclear.Summary of the invention
It is an object of the invention to for deficiency of the prior art, it is provided that SNIP1 in diagnosis status of inflammatory bowel disease and treatment
In new application.The present invention also aims to explore SNIP1 expression in IBD patient's colon epithelial cell and merit
Can, provide new foundation for the diagnosis of clinical IBD and treatment.
In a first aspect of the present invention, it is provided that SNIP1 gene or the albumen use in preparing diagnostic reagent or test kit
On the way, described diagnostic reagent or test kit are for diagnosing whether test individual suffers from inflammatory bowel or its inflammatory bowel
Activeness.
In a second aspect of the present invention, it is provided that SNIP1 expression in detecting individual Colon mucosa cell
Reagent purposes in preparing diagnostic reagent or test kit, described diagnostic reagent or test kit are used for whether diagnosing test individual
Suffers from the activeness of inflammatory bowel or its inflammatory bowel.
In a third aspect of the present invention, it is provided that SNIP1 gene or albumen or their synergist are in preparing medicine
Application, described medicine is used for preventing and treating inflammatory bowel.
As a kind of detailed description of the invention of the present invention, described synergist is SNIP1 high expressed slow virus carrier.
In a fourth aspect of the present invention, it is provided that SNIP1 gene or albumen or their synergist are in preparing reagent
Application, described reagent is used for:
A) suppression Colon mucosa cell pro-inflammatory cytokine TNF-α, the expression of IL-1 β, IL-6, IL-8；
B) weight loss that suppression inflammatory bowel is individual；
C) disease activity that inflammatory bowel is individual is reduced；And/or
D) the intestinal mucosal injury degree that inflammatory bowel is individual is reduced.
As a kind of detailed description of the invention of the present invention, described synergist is SNIP1 high expressed slow virus carrier.
The invention has the advantages that:
1, present invention firstly discovers that SNIP1 is thin at active stage inflammatory bowel (IBD) patient inflammation Intestinal Mucosal Tissues epithelium
Intracellular expression significantly reduces, but the expression of catabasis IBD patient's epithelial cell SNIP1 and normal control are without notable district
Not, this is found to be clinical diagnosis IBD and judges that its activeness provides important evidence and method, prompting SNIP1 can as IBD and
The biomarker of its activeness diagnosis.Further study show that SNIP1 has the work of suppression epithelial cells inflammatory factor
With, the expression of SNIP1 in the mouse intestinal inflammatory model epithelial cell of raising DSS induction, find that SNIP1 has suppression DSS and leads
The effect of the endo enteritis damage caused, this discovery imply that SNIP1 can be as target spot new for clinical treatment IBD.
2, the present invention provide SNIP1 high expressed slow virus carrier and SNIP1 suppression slow virus carrier promotion express or
Strike fall effect very notable, achieve unforeseeable technique effect.
Accompanying drawing explanation
Fig. 1. real-time fluorescence quantitative PCR detection SNIP1 expresses fall in active stage IBD patient's Colon mucosa cell
Low.A-CD: active stage CD, A-UC: active stage UC, R-CD: catabasis CD, R-UC: catabasis UC, HC: normal healthy controls person.
Fig. 2. Immunohistochemical detection SNIP1 expresses reduction in active stage IBD patient's Colon mucosa cell.A-
CD: active stage CD, A-UC: active stage UC, HC: normal healthy controls person.
Fig. 3. the efficiency that in (A) fluorescence quantitative PCR detection SNIP1siRNA slow virus suppression epithelial cell, SNIP1 expresses.
(B) fluorescence quantitative PCR detection high expressed SNIP1 slow-virus transfection efficiency.(C) after suppression SNIP1, TNF-α in epithelial cell,
IL-1 β, IL-6, IL-8mRNA level raises.(D) after high expressed SNIP1, TNF-α, IL-1 β, IL-6, IL-in epithelial cell
8mRNA level reduces.
Fig. 4. real-time fluorescence quantitative PCR detection SNIP1 expresses water in the mouse colitis model epithelial cell that DSS induces
Pancake is low.DSS: feed the model group of DSS；Water: feed the matched group of water.
Fig. 5. give DSS group and Water group lumbar injection SNIP1-DNA and vector-DNA, quantitative fluorescent PCR skill respectively
Art detection finds that injection SNIP1-DNA epithelium posterius intracellular SNIP1 expression significantly rises.
Fig. 6. after epithelial cell high expressed SNIP1, the mouse colitis model weight loss degree (percent of DSS induction
Of initial weight) (A) and disease activity index (Disease Activity Index) (B) be all remarkably decreased.
After Fig. 7 .HE dyeing display epithelial cell high expressed SNIP1, under the colonic mucosal injury degree that DSS causes is notable
Fall.
Fig. 8. after epithelial cell high expressed SNIP1, its inflammatory factor TNF-α expressed, IL-1 β, IL-6, IL-8 significantly drop
Low.Comparison shown in figure is use SNIP1 control vector group.
Detailed description of the invention
The detailed description of the invention provided the present invention below in conjunction with the accompanying drawings elaborates.
SNIP1 albumen and gene
In this article, SNIP1 albumen used can be naturally-occurring, and such as it can be moved from suckling by isolated and purified
Thing.Additionally, described SNIP1 albumen can also be artificial preparation, such as prepare according to conventional gene engineering.Appoint
What suitably SNIP1 albumen may be applicable to the present invention.Described SNIP1 albumen includes that the SNIP1 albumen of total length or its biology are lived
Property fragment.
Through one or more amino acid residues replacement, lack or add and the aminoacid sequence of SNIP1 albumen that formed
Row are also included in the present invention.SNIP1 albumen or its bioactive fragment include the alternative sequence of a part of conserved amino acid, institute
State the sequence of amino acid replacement and have no effect on its activity or to remain it amount of activated.In suitably replacement aminoacid is this area
Known technology, described technology can be carried out easily and guarantee not change the biological activity of known molecular.These technology
Making those skilled in the art recognize, in general, the non essential amino acid area change single amino acids at a peptide species can't
Change biological activity.
The bioactive fragment of any SNIP1 albumen all may apply in the present invention.Here, SNIP1 albumen
The implication of bioactive fragment refer to a kind of polypeptide, it still can keep all or part of function of SNIP1 albumen of total length.
Under normal circumstances, described bioactive fragment at least keeps the total length SNIP1 albumen of 50%, 60% to 99% or 100%
Activity.
The present invention can also use the modified or all or part of amino acid whose SNIP1 albumen of improvement, such as, Ke Yiwei
The SNIP1 albumen promoting half-life, effectiveness, metabolism and/or the effect of albumen and modified or improve.Described through repairing
The SNIP1 albumen of decorations or improvement can be the conjugate of a kind of SNIP1 albumen, or its can be replaced or artificial aminoacid.
SNIP1 albumen or gene that described process is modified or improved can have certain difference with natural SNIP1 albumen or gene, but
It also is able to expand blood vessel, and other untoward reaction or toxicity will not be brought.It is to say, any life not affecting SNIP1 albumen
The version of the thing activity biological function of gene in other words conj.or perhaps can be used in the present invention.
SNIP1 synergist and application thereof
Described " SNIP1 synergist " includes agonist, upper adjustment, stabilizer etc., refers to any improve SNIP1's
Activity, improving the stability of SNIP1, raise the expression of SNIP1, increase the material of SNIP1 effective acting time, these materials are equal
Can be used for the present invention.They can be compound, chemical small molecule, biomolecule etc..Described biomolecule can be nucleic acid
Level (including DNA, RNA), protein level, it is also possible to be to raise the viral product etc. that SNIP1 expresses.
Herein, initialism lexical or textual analysis is shown in Table 1.
Table 1 initialism lexical or textual analysis
Table 2 primer sequence
Embodiment 1
One, experiment material
1 experimental apparatus and equipment
Magnetic rotor, magnetic stirring apparatus, ice bucket, ice chest, elbow tweezer, eye scissors, centrifuge tube shelf, test tube rack, streaming pipe support,
Quantitative real time PCR Instrument, magnetic stirring apparatus etc..
2 experiment reagents, consumptive material
In vivo-jet PEI transfection reagent, SNIP1 plasmid DNA (SNIP1-DNA), control plasmid DNA (Vector-
DNA), LV-SNIP1siRNA (SNIP1 suppresses slow virus carrier), LV-SNIP1 (SNIP1 high expressed slow virus carrier) and LV-
NC (slow virus empty carrier), SNIP1 antibody, EDTA solution, PCR kit for fluorescence quantitative, Western blot separation gel and dense
Contracting glue, PBS, dextran sulfate sodium (DSS), sterile gloves, suction pipe, centrifuge tube, pipet, pipettor, mask, timer, 1ml
Gauge hypodermic device, aseptic EP pipe etc..
Two, experimental technique
1, people and mouse Colon mucosal tissue epithelial cell separation and Extraction
(1) colon mucosa tissues is collected
A. people's colon mucosa tissues is collected: takes 8-10 block biopsy when those who are investigated's row colonoscopy, is placed in
10ml contains in the PBS of 1% streptomycin and penicillin, preserves on ice, standby.
B. mouse Colon mucosal tissue is collected: by taking-up colon of cutting open the belly after the sacrifice after modeling, use eye scissors
Scrape off stool in mice after being cut off by colon along the longitudinal axis gently, be then cut into the fragment of 0.5-1cm length, be placed in 50ml centrifuge tube
With PBS 2-3 time of pre-cooling.
(2) colon is placed in 30ml conical flask, add 15ml preheating containing hyclone (2%) and EDTA
(0.5mM) in PBS, put into the magnetic rotor of a dimension, be subsequently placed on magnetic stirring apparatus and at the uniform velocity stir 40min,
Note temperature to control at about 37 DEG C to be advisable.
(3) in bottle seen from after reaction terminates, troubled liquor and residue colon fragment, filter colon group with metal screen
Knitting, collect in the suspension containing epithelial cell is placed in 50ml centrifuge tube centrifugal, centrifugal condition is 4 DEG C, 1000rpm, 5min.
(4) centrifugal rear visible pipe floor cells precipitation, is colon epithelial cell.Supernatant discarded, then the PBS with appropriate pre-cooling
Clean residual EDTA2-3 time.The colon epithelial cell of gained i.e. can be used for ensuing real-time fluorescence quantitative PCR and
Western blot tests.
2, colon epithelial cell system cultivates and transfection
A. colon epithelial cell system HCT-116 is planted on six orifice plates equably, when cell confluency degree reaches 30%
Start transfection.
B. take to help in right amount and turn in agent addition cell culture medium, be subsequently placed in cell culture incubator and hatch 30min.
C. in every hole, add high expressed SNIP1 virus (LV-SNIP1), low expression SNIP1 virus after hatching end respectively
(LV-SNIP1siRNA) and matched group virus (LV-NC), transfection plural number MOI be 10.Then cultivation 24h it is placed in incubator.
Suck culture medium the most afterwards, change fresh culture.
E. use puromycin to kill the cell that transfection is failed, the cell of screening stable transfection after continuing to cultivate 48h, continue
Quantitative fluorescent PCR and Western blot experiment is can be used for after passing on.
3, murine colonic inflammation model building method
(1) it is dissolved in after DSS being weighed in aseptic distilled water, is configured to the solution containing 2%DSS.
(2) take the C57BL/6 mice 40 in 6-8 week, be randomly divided into 4 groups, feed water, feed 2%DSS's for the 3rd, 4 groups for the 1st, 2 groups
Solution 7 days, then feeds sterilized water 3 days.Note in modeling first 7 days, give the 1st, 3 groups of mouse peritoneals injection Vector-DNA every day
(control plasmid), to the 2nd, 4 groups of mouse peritoneal injection SNIP1-DNA.It is to say, make in described murine colonic inflammation model
Be common plasmid DNA, utilize transfection reagent to be transfected into well in colon epithelial cell.
(3) during modeling, every day weighs the indexs such as Mouse Weight, observed and recorded stool, modeling terminate after by mice
Extremely, take colon and analyze mice inflammatory conditions.
Well known to a person skilled in the art, inflammatory bowel includes Crohn disease and ulcerative colitis two types, its
Animal model has enteritis model that DSS, TNBS, DNBS induce etc., and the mice inflammatory model wherein built with DSS is permissible
The functions such as the permeability of good reaction epithelial cell, it is possible to reaction SNIP1 effect in epithelial cell more accurately, because of
This this research selects to use this model.
4, colon HE colouring method
(1) dyeing
A. colon's paraffin section is put into haematoxylin dyeing 1～about 5min；B. tap water is developed a film quarter；C.1% salt
Sour water differentiation 3～5s；Washing the most from the beginning, warm water oil blackeite is for a moment；E. 20s～2min contaminated by ethanol dye liquor in Yihong.
(2) dehydration, transparent, sealing
A.85% dehydration of alcohol 20s；B.95% dehydration of alcohol 1min；C. anhydrous alcohol I contaminates 1～2min；The most anhydrous
Ethanol II contaminates 2min；E. dimethylbenzene I soaks 2min；F. dimethylbenzene II soaks 2min；G. neutral gum mounting.
(3) end of dyeing is placed on basis of microscopic observation and often organizes mouse Colon degree of tissue damage and take pictures.
5, disease activity scoring
By stool situation as disease activity (DAI) evaluation index, point system is shown in Table 2.
Table 3 disease activity point system
6, Western experimental procedure
(1) protein sample is collected
A. in sample to be tested, add appropriate IP cell pyrolysis liquid or RIPA lysate, stand 30min on ice, make cell fill
Division solves.
B., after having cracked, at 4 DEG C, 12000rpm is centrifuged 15min.
C. the supernatant subpackage after being centrifuged is transferred in the centrifuge tube of 0.6ml, then carries out protein quantification and adds appropriate
Loading buffer.It is put in-20 DEG C of preservations, standby.
(2) electrophoresis
A.SDS-PAGE gel is prepared: the PAGE gel reagent preparation box description preparation using the green skies to produce is suitable
The preferably concentration glue of concentration.
B. rinse with water and concentrate glue, put it in electrophoresis tank, after adding enough electrophoresis liquid, begin preparing for loading.
C. with the adherent pipette samples of microsyringe, inspiration bubble is not wanted in sample sucking-off.It is inserted to add by sample injector syringe needle
Sample is slowly added to sample in hole.
D. electrophoresis time general 4～5h, voltage is that 80V is preferable.Electrophoresis has just been run out of can terminate to loading buffer
Electrophoresis, carries out transferring film.
(3) transferring film
A. according to the nitrocellulose filter that the size clip of glue is appropriately sized.Then put in the enamel tray added with transferring film liquid
Enter the clip of transferring film, two blocks of foam-rubber cushions, glass rod, filter paper and dipped film.
B. clip is opened and make black one side holding level.Pad a foam-rubber cushion above, mat pad three metafiltration paper,
The most fixing filter paper proficiency glass rod rolls bubble therein.
The most carefully peel separation gel to be placed on filter paper, make it align with filter paper with hand adjustment is whole.By membrane cover on glue, cover full
Whole glue bubble removing.At 3 filter paper of film upper cover and remove bubble.Whole operation is carried out in transfer liquid, constantly roll
Bubble.The filter paper on film both sides can not contact with each other, and can be short-circuited after contact.
D. clip is put in transferring film groove groove, the black flour of folder the to be made black flour to groove, to groove red of the flour of folder.Electricity turns
Meeting heat production during shifting, the ice cube of putting at groove is lowered the temperature.General with 120V transferase 12 h.
(4) close
After transferring film, immediately albuminous coat is placed in preprepared Western confining liquid, on shaking table slowly
Shake, room temperature is closed 60 minutes.
(5) one anti-hatch
With reference to an anti-description, resist, by the protein powder of film according to the anti-diluted of proper proportion Western mono-one
Overnight incubation under the conditions of being placed on 4 DEG C it is fully contacted with antibody diluent.
(6) two anti-hatch
With reference to two anti-description, according to proper proportion Western bis-anti-diluted horseradish peroxidase
(HRP) the two of labelling resist, and protein powder and the two anti-diluents of film are fully contacted and are placed on incubated at room temperature 2h.
(7) Protein Detection
Two anti-hatch end after, film is placed on scanning analysis on laser scanner and often organizes sample expressing quantity.
7, realtime fluorescent quantitative PCR experiment
(1) according to mRNA real-time fluorescence quantitative PCR detection description following reagent is individually positioned in and melts on ice,
To be dissolved completely after prepare according to sample number needed for reaction system.
Table 4 real-time fluorescence quantitative PCR reaction system
| Reagent component | Volume |
| miRNA cDNA | 1μl |
| SYBR FAST qPCR Master Mix | 10μl |
| Forward primer | 0.4μl |
| Reverse primer | 0.4μl |
| ROX High | 0.4μl |
| DEPC-H2O | Mend to 20 μ l |
(2) solution in above-mentioned reaction system is blown and beaten mixing gently, according to the sample permutations order being pre-designed by sample
This adds in 96 hole PCR plate, posts PCR film, reacts according to following reaction condition.
Table 5 real-time fluorescence quantitative PCR reaction condition
(3) data analysis: after reaction terminates, after the genes of interest of each sample and the CT value copy of reference gene 18s
It is placed in Excel table analysis.CT value represents that each sample fluorescence intensity reaches period used during threshold value.
Computing formula is as follows: Δ CT=genes of interest CT value-reference gene 18s CT value,
Δ Δ CT=experimental group genes of interest Δ CT-matched group genes of interest Δ CT,
Relative value=2-ΔΔCT。
Experimental result is analyzed, for statistical analysis according to above-mentioned principle and formula manipulation.
8, LV-SNIP1 siRNA slow virus carrier builds
(1) carrier information:
(2) prepared by double-stranded DNA Oligo:
(a) synthesis SNIP1 strand siRNA sequence: CCACCAAAGGAGAACGTCTAA；
B () primer annealing forms double-stranded DNA: paired primer dry powder after synthesis is dissolved in annealing buffer, 90 DEG C
Water-bath 15min, then naturally cools to room temperature.
(3) siRNA template sequence is building up to carrier pleno-GTP
(a) carrier enzyme action, reclaim and connect conversion
Carrier endonuclease reaction 4h, reaction system such as following table:
| Reagent | Volume |
| EcoR I | 1ul |
| BamH I | 1ul |
| 10*K buffer | 4ul |
| GTP | 4ul |
| Water | 30ul |
| Totle | 40ul |
(b) primer annealing: annealing reaction system and program
(c) amplification program: 95 DEG C, 4min；70℃,10min；Room temperature cools down
D carrier and gene after () enzyme action connect
Connect overnight in 16 DEG C after the mixing of following reagent, within second day, prepare to convert.Linked system is as follows
E () recombiant plasmid carries out digestion verification, concrete system is as follows:
| Reagent | Volume |
| EcoR I | 0.5μl |
| Kpn I | 0.5μl |
| 10×K Buffer | 2.0μl |
| Genes of interest DNA | 6.0μl |
| ddH2O | 11.0μl |
| Total | 20.0μl |
Reaction condition is 37 DEG C, 3 hours.
(4) product transformed competence colibacillus cell is connected
A () first dissolves competent cell on ice, start experiment after it dissolves；
B () connects product 10 μ L and joins in 50 μ L competent cells, hatch 30 minutes on ice；
(c) 42 DEG C of thermal shock cells 90 seconds；It is immediately transferred to hatch 2 minutes on ice；
D () adds 600 μ L LB fluid mediums, 37 DEG C, hatch 1 hour in the shaking table of 225rpm；
E () 10000rpm is centrifuged 1 minute, retain 100 μ L conversion products and be coated onto on the LB flat board containing ammonia benzyl, hatched for 37 DEG C
Night；
(5) select in positive colony and plasmid and take out: picking converts the monoclonal of growth and puts in liquid LB, shakes in shaking table
Swing incubated overnight, extract plasmid followed by test kit, comprise the following steps that shown:
(a) add 5ul ammonia benzyl in 5ml LB fluid medium, incubated overnight, bacterium solution is placed on a 1.5ml centrifuge tube
In, 12,000 × g is centrifuged 1 minute, thoroughly removes supernatant；
B () adds 250ul Buffer S1, the abundant resuspended antibacterial of agitator；
C () adds 250ul Buffer S2, reverse mixing 4-6 time；The sands are running out was in five minutes, it is to note that can not be violent
Mixing, otherwise there will be contaminating genomic DNA；
D () adds 350ul Solution III, gently reverse mixing 6-8 time；
(e) 12,000 × g, centrifugal 10 minutes；Being transferred to by supernatant in Miniprep post, Miniprep post inserts in waste liquid and receives
In collector, 12,000 × g is centrifuged 1 minute；Note: be not drawn onto precipitation, otherwise there will be genomic DNA and protein contamination；
F () abandons the waste liquid in collecting pipe, insert in collecting pipe by Miniprep post, adds 500ul Buffer W1 and arrives
In Miniprep post, 12,000 × g is centrifuged 1 minute；Repeat this step one time；
G () abandons the waste liquid in collecting pipe, insert in collecting pipe by Miniprep post, adds 700ul Buffer W2 and arrives
In Miniprep post, 12,000 × g is centrifuged 1 minute；Repeat this step one time；
H () abandons the waste liquid in collecting pipe, put into by Miniprep post in same collecting pipe, and 12,000 × g is centrifuged 1 minute
Thoroughly remove Buffer W2；
I Miniprep post is put in new clean 1.5ml centrifuge tube by (), add 80ul Eluent, and room temperature places 1 point
Zhong Hou, 12,000 × g are centrifuged 1 minute；Solution in centrifuge tube is extracted plasmid.
9, LV-SNIP1 (SNIP1 high expressed slow virus carrier) builds:
(1) SNIP1 gene order: atgaaggcggtgaagagcgaacgggagcgagggagccggcgaagacaccggg
acggggacgtggtgctgccggcgggggtggtggtgaagcaggagcgtctcagcccagaagtcgcacctcccgcccac
cgccgtccggaccactccggtggtagcccgtctccgccgaccagcgagccggcccgctcgggccaccgcgggaaccg
agcccgaggagttagccggtccccacccaaaaagaaaaacaaggcctcagggagaagaagcaagtctcctcgcagta
agagaaaccgaagtcctcaccactcaacagtcaaagtgaagcaggagcgtgaggatcatccccggagaggacgggag
gatcggcagcacagggaaccatcagaacaggaacacaggagagctaggaacagtgaccgggacagacaccggggcca
ttcccaccaaaggagaacgtctaacgagaggcctgggagtgggcagggtcagggacgggatcgagacactcagaacc
tgcaggctcaggaagaagagcgggagttttataatgccaggcgacgggagcatcgccagaggaatgacgttggtggt
ggcggcagtgagtctcaggagttggttcctcggcctggtggcaacaacaaagaaaaagaggtgcccgctaaagaaaa
accaagctttgaactttctggggcacttcttgaggacaccaacactttccggggtgtagtcattaaatatagtgagc
ccccagaagcacgtatccccaaaaaacggtggcgtctctacccatttaaaaatgatgaggtgcttccagtcatgtac
atacatcgacagagtgcgtacctactgggtcgacaccgccgcattgcagacattccaattgatcacccgtcttgttc
aaagcagcatgcggtctttcaatatcggcttgtggaatatacccgtgctgatggcacagttggccgaagagtgaagc
cctacatcattgaccttggctcaggcaatggaaccttcttaaacaacaaacgtattgagccacagagatactatgaa
ctaaaagaaaaggatgtactcaaatttggattcagtagcagagaatacgtcttgctccatgagtcgtcggacacttc
tgaaatagacaggaaagatgacgaggatgaggaggaggaggaagaagtgtctgacagctag
(2) carrier information:
(3) carrier enzyme action: according to following list, prepares 40 μ l enzyme action systems.It is sequentially added into various reagent by tab sequential,
Mixing is blown and beaten gently with pipettor, of short duration centrifugal, it is placed in 37 DEG C of reaction 3h or overnight.Carrier digestion products carries out agarose coagulate
Gel electrophoresis, reclaims purpose band.
(4) fragment in amplifying target genes CDS region:
Reaction system:
| Reagent | Volume |
| KOD-PLUS DNA polymerase | 1 |
| dNTPMixture(2.5mM) | 5 |
| MgSO4 | 2 |
| Primer-F (10uM) | 1.5 |
| Primer-R (10uM) | 1.5 |
| Template DNA | 2 |
| KOD Plus Buffer | 5 |
| Add ddH2O to cumulative volume | 50ul |
Amplification program:
SNIP1 PCR primer endonuclease reaction system:
(5) gene after enzyme action is connected with carrier
Connect overnight in 16 DEG C after the mixing of following reagent, within second day, prepare to convert.Linked system is as follows:
| Reaction system | Volume |
| Carrier DNA | 1.0ul |
| Genes of interest DNA | 1.0ul |
| 10×T4 DNA Ligase Buffer | 1.0ul |
| T4 DNA Ligase | 7.0ul |
(6) convert and connect product in bacillus coli DH 5
A () first dissolves competent cell on ice, start experiment after it dissolves；
B () connects product 10 μ L and joins in 50 μ L competent cells, hatch 30 minutes on ice；
(c) 42 DEG C of thermal shock cells 90 seconds；
D () is immediately transferred to hatch 2 minutes on ice；
E () adds 600 μ L LB fluid mediums, 37 DEG C, hatch 1 hour in the shaking table of 225RPM.；
F () 10000RPM is centrifuged 1 minute, retain 100 μ L conversion products and be coated onto on the LB flat board containing ammonia benzyl, hatched for 37 DEG C
Night；
(7) plasmid extraction: the correct bacterium solution that checks order is transferred in 10ml contains the LB fluid medium of corresponding antibiotic, 37
DEG C overnight incubation, carries middle amount test kit with sky root carry out plasmid extraction without endotoxin plasmid is little, extracts under qualified plasmid enters
Trip flow process.Detailed operating procedures is as follows:
A () is collected the bacterium solution of incubated overnight and is received bacterium in the good 5ml centrifuge tube of labelling, 12000rpm, centrifugal 2min；
B () abandons supernatant, add 250 μ l cell re-suspension liquid, fully vibrate, and makes truffle suspend uniformly；
C () adds 250 μ l cell pyrolysis liquids, add 10 μ l E.C. 3.4.21.64s, turn upside down 5-6 time, mix gently；Stand
1-2min, causes cellular lysate to be clarified；
D () adds 350 μ l neutralizers, mixing of turning upside down, make albumen separate out completely, and ice bath stands 5min；
E () 10000rpm is centrifuged 10min, abandon albumen, collects supernatant in another the most aseptic 1.5ml EP pipe；
F () 12000rpm is centrifuged 5min, prepare the recovery post that labelling is good simultaneously, is transferred to supernatant reclaim in post,
12000rpm is centrifuged 1min, abandons lower floor's waste liquid；
G () adds 600 rinsing liquids pre-configured for μ l, 12000rpm is centrifuged 1min, abandons lower floor's waste liquid, is repeated once,
12000rpm is empty from 2min, removes the rinsing liquid of residual further；
H () is transferred to reclaiming post in new 1.5ml EP pipe in super-clean bench, stand 10-20min, naturally dry；
I () adds 95 μ l Nuclease-Free Water in recovery post, stand 2min, 12000rpm and be centrifuged 2min,
Collect sample and carry out numbering, electrophoresis, measure concentration, carry out identifying, quality inspection.
10, lentivirus production experimental procedure
(1) cell inoculation: the slow virus incasing cells transfection 293T cell of trypsinization exponential phase, again
It is inoculated in 10cm Tissue Culture Dish (each plating cell is about 2-2.5x10E6), 37 DEG C, cultivates in 5%CO2 incubator；
(2) plasmid and the preparation of transfection reagent: four kinds of plasmid DNA solutions in preparation slow virus packaging system；Add aseptic
Water is settled to 1800 μ l, adds CaCl2 (2.5mol/L) solution 200 μ l, mixing, adds 2 × BBS buffer salt solution 2000 μ
L, room temperature places 20～25min；
(3) plasmid transfection: transfect when cell density reaches 60%～70%. each plasmid and calcium phosphate mixed liquor are transferred to
In culture fluid containing cell monolayer, mixing, discard the culture fluid containing transfection mixture after cultivating 6-8hrs, add PBS
15ml, discards after jog, repeats this step 3 time；
(4) change culture medium: every bottle of cell adds the cell culture fluid 6ml containing 10% hyclone, continue to cultivate
48hrs；
(5) viral supernatants is collected: collect the 293T cell supernatant of transfection 72h；
(6) vial supernatant is centrifuged, filters: by the supernatant of collection in 4 DEG C, 4000g is centrifuged 10min, collects after being centrifuged
Supernatant；Supernatant is filtered with 0.45 μm filter；
(7) ultracentrifugation: in 40ml ultracentrifugation pipe, 4 DEG C, 25000rpm/min is centrifuged 2hrs；Then with ice PBS liquid
Or 500 μ l DMEM respin viral pellet dissolve overnight in 4 DEG C.
Three, interpretation of result
1, SNIP1 expresses reduction in active stage inflammatory bowel (IBD) patient's Colon mucosa cell
Take Crohn disease (CD), ulcerative colitis (UC) and normal healthy controls person's Intestinal Mucosal Tissues respectively, live according to disease
CD and UC is divided into four groups by dynamic degree, and respectively active stage CD (A-CD), active stage UC (A-UC), catabasis CD (R-CD) are alleviated
Phase UC (R-UC), HC: normal healthy controls person.Use in quantitative fluorescent PCR, immunohistochemistry staining method's detection epithelial cell
The expression of SNIP1.Result is shown in Fig. 1 and Fig. 2.Find after comparing with normal healthy controls person, active stage CD and UC patient's colonic epithelium
In cell, the expression of SNIP1 significantly reduces, but in catabasis IBD patient's colon epithelial cell, the expression of SNIP1 is with strong
Health person compares no significant difference, and in imply that detection IBD patient's colon epithelial cell, the expression of SNIP1 can be as judgement
The important indicator of IBD Disease Activity.
2, SNIP1 suppresses epithelial cell inflammatory Cytokines Expression
In IBD pathogenic process, in epithelial cell, abnormal gene expression may result in the cytokine of epithelial cells and sends out
Raw change.TNF-α, IL-1 β, IL-6, IL-8 are the important pro-inflammatory cytokines that enterocyte produces, and may result in intestinal and stick
Envelope barrier function damage and immune cell function are disorderly, have vital effect in IBD occurs evolution.This part
In primary study epithelial cell, SNIP1 expresses the impact reduced epithelial cell inflammatory Cytokines Expression.Utilize slow-virus transfection
Method builds the colon epithelial cell system (HCT-116) of high expressed (Fig. 3 A) and low expression (Fig. 3 B) SNIP1 respectively and stablizes strain, so
The rear method detection SNIP1 impact on epithelial cell inflammatory Cytokines Expression utilizing quantitative fluorescent PCR.It was found that on Yi Zhi
In chrotoplast, the expression of SNIP1 is remarkably improved the expression (Fig. 3 C) of intracellular TNF-α, IL-1 β, IL-6, IL-8, but high
After expressing SNIP1, TNF-α, the expression of IL-1 β, IL-6, IL-8 substantially reduce (Fig. 3 D).The above results shows that SNIP1 has
The effect that suppression epithelial cell pro-inflammatory cytokine is expressed, after SNIP1 reduces, inflammatory factor produces obvious increasing, and points out IBD
In patient's mucous membrane of colon, the inflammatory Cytokines Expression such as TNF-α, IL-1 β, IL-6, IL-8 raises and may reduce relevant with SNIP1 expression.
3, SNIP1 expression in the mouse colitis model epithelial cell that DSS induces reduces
Utilize C57BL/6 mice to build the colitis model of DSS induction, after separating enterocyte, use fluorescent quantitation
The expression of SNIP1 in round pcr detection mouse Colon epithelial cell, found that colitis mice epithelial cell SNIP1 table
The amount of reaching compared with normal wild-type mice epithelial cell significantly reduces (Fig. 4).
4, after mouse Colon epithelial cell high expressed SNIP1, the mouse colitis degree of inflammation of DSS induction significantly alleviates
Mouse peritoneal injection SNIP1DNA (experiment is given respectively under the effect helping transfection reagent in vivo-jetPEI
Group) or vector DNA (matched group), modeling uses SNIP1 in fluorescent quantitative PCR technique detection mouse epithelial cells after terminating
Expression, in finding epithelial cell, SNIP1 expression relatively matched group significantly rises (Fig. 5), i.e. epithelial cell transfection SNIP1 becomes
Merit.Finding during modeling, after giving mice DSS, experimental mice weight loss degree substantially reduces, and disease activity shows
Write and decline (Fig. 6).Colon HE dyeing finds that experimental mice colonic mucosal injury degree substantially reduces, and mainly shows as bursting
Infections depth shallower, quantity reduce, and the inflammatory cell quantity of infiltration is remarkably decreased etc. (Fig. 7) in proper mucous membrane.TNF-α, IL-1
These pro-inflammatory cytokines of β, IL-6, IL-8 have activation inflammatory cell in colitis generation evolution, damage intestinal sticks
The effect of membrane tissue, separates epithelial cell and carries out fluorescence quantitative PCR detection discovery, these cytokine tables after SNIP1 high expressed
The amount of reaching reduces (Fig. 8).In result above shows high expressed epithelial cell, generation and the development of mouse intestinal inflammation are had by SNIP1
Significantly inhibitory action, imply that the SNIP1 important target spot possibly as IBD diagnosis and treatment.
The above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
Member, on the premise of without departing from the inventive method, it is also possible to makes some improvement and supplements, and these improve and supplement and also should be regarded as
Protection scope of the present invention.
Claims (6)
1.SNIP1 gene or the albumen purposes in preparing diagnostic reagent or test kit, it is characterised in that described diagnostic reagent
Or test kit is for diagnosing whether test individual suffers from the activeness of inflammatory bowel or its inflammatory bowel.
2. in detecting individual Colon mucosa cell the reagent of SNIP1 expression in preparing diagnostic reagent or test kit
Purposes, it is characterised in that described diagnostic reagent or test kit be used for diagnosing test individual whether suffer from inflammatory bowel or
The activeness of its inflammatory bowel.
3.SNIP1 gene or albumen or the application in preparing medicine of their synergist, it is characterised in that described medicine is used
In preventing and treating inflammatory bowel.
Application the most according to claim 3, it is characterised in that described synergist is SNIP1 high expressed slow virus carrier.
5.SNIP1 gene or albumen or the application in preparing reagent of their synergist, it is characterised in that described reagent is used
In:
A) suppression Colon mucosa cell pro-inflammatory cytokine TNF-α, the expression of IL-1 β, IL-6, IL-8；
B) weight loss that suppression inflammatory bowel is individual；
C) disease activity that inflammatory bowel is individual is reduced；And/or
D) the intestinal mucosal injury degree that inflammatory bowel is individual is reduced.
Application the most according to claim 5, it is characterised in that described synergist is SNIP1 high expressed slow virus carrier.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610470803.2A CN105969883A (en) | 2016-06-24 | 2016-06-24 | SNIP1 as target for diagnosis and treatment of inflammatory bowel disease |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610470803.2A CN105969883A (en) | 2016-06-24 | 2016-06-24 | SNIP1 as target for diagnosis and treatment of inflammatory bowel disease |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105969883A true CN105969883A (en) | 2016-09-28 |
Family
ID=57020529
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610470803.2A Pending CN105969883A (en) | 2016-06-24 | 2016-06-24 | SNIP1 as target for diagnosis and treatment of inflammatory bowel disease |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105969883A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018210338A1 (en) * | 2017-05-18 | 2018-11-22 | Coyote Diagnostics Lab (Beijing) Co., Ltd. | Methods for detecting malignant colon conditions |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104977415A (en) * | 2015-03-09 | 2015-10-14 | 中国人民解放军第二军医大学 | Applications and kit of METRNL protein as inflammatory bowel disease diagnostic serum marker |
-
2016
- 2016-06-24 CN CN201610470803.2A patent/CN105969883A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104977415A (en) * | 2015-03-09 | 2015-10-14 | 中国人民解放军第二军医大学 | Applications and kit of METRNL protein as inflammatory bowel disease diagnostic serum marker |
Non-Patent Citations (3)
| Title |
|---|
| HE C, ET AL.: "miR-301a promotes intestinal mucosal inflammation through induction of IL-17A and TNF-α in IBD", 《INFLAMMATORY BOWEL DISEASE》 * |
| RICHARD H. KIM ET AL.: "A novel Smad nuclear interacting protein, SNIP1, suppresses p300-dependent TGF-β signal transduction", 《GENES & DEVELOPMENT》 * |
| Y SHI ET AL.: "Smad nuclear interacting protein 1 (SNIP1) inhibits intestinal inflammation through regulation of epithelial barrier function", 《MUCOSALIMMUNOLOGY》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018210338A1 (en) * | 2017-05-18 | 2018-11-22 | Coyote Diagnostics Lab (Beijing) Co., Ltd. | Methods for detecting malignant colon conditions |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109182278A (en) | Seneca Valley virus strain and its application | |
| US20230277605A1 (en) | Whole bacteria capsule, preparation method therefor and use thereof | |
| CN103614494B (en) | Two-color fluorogenic quantitative PCR (Polymerase Chain Reaction) detection kit for CDV (canine distemper viruses) and CPV (canine parvo viruses) | |
| CN106591242B (en) | One plant of canine parvovirus poison strain CPV-YH and its application | |
| CN113564131B (en) | Coxsackie virus A6 type strain and application thereof | |
| CN105524924A (en) | Cyclic RNA circ-ZKSCAN1 use | |
| Cavanagh | Innovation and discovery: the application of nucleic acid-based technology to avian virus detection and characterization | |
| CN106191067A (en) | Circular rna circ NFATC3 and application thereof | |
| CN113684190B (en) | Infectious clone plasmid of circular virus 3 type double-copy full-length gene, construction method and application thereof | |
| CN107663539A (en) | Circular rna circ PTGR1 purposes | |
| CN113564133B (en) | Coxsackie virus A16 type strain and immunogenic composition and application thereof | |
| CN106282132A (en) | The low virulent strain of Pseudorabies virus variant and application thereof | |
| CN105969883A (en) | SNIP1 as target for diagnosis and treatment of inflammatory bowel disease | |
| CN107354238A (en) | A kind of specific primer and application for being used to detect aviadenovirus IV types | |
| CN106103714B (en) | In vivo infection microorganism, parasitic microbe, the noncoding RNA of symbiotic microorganism and its identification and application | |
| CN111073862A (en) | Bovine viral diarrhea type2 attenuated strain and application thereof | |
| CN113564132B (en) | Coxsackie virus A16 type strain and application thereof | |
| CN116064417A (en) | Cat panleukopenia virus strain and application thereof | |
| CN109504766A (en) | The application of miRNA marker miRNA-345-3p | |
| CN115141273A (en) | Monoclonal antibody of feline calicivirus and application thereof | |
| CN106011248A (en) | Method for detecting amyotrophy and kit | |
| CN108396014A (en) | The separation identification of one plant of I type aviadenovirus serum 8b strain and purification process and its application | |
| CN111073863B (en) | Porcine epidemic diarrhea and porcine delta coronavirus bivalent attenuated vaccine and preparation method thereof | |
| CN112630443A (en) | IFA (IFA neutralizing antibody) detection method of PCV2 | |
| CN108210497B (en) | Application of compound MLN4924 in preparation of bunyaviridae phlebovirus inhibitor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20160928 |