CN105969868B - The detection method and its application of MAP7 expression in CN-AML tissue sample - Google Patents

The detection method and its application of MAP7 expression in CN-AML tissue sample Download PDF

Info

Publication number
CN105969868B
CN105969868B CN201610344737.4A CN201610344737A CN105969868B CN 105969868 B CN105969868 B CN 105969868B CN 201610344737 A CN201610344737 A CN 201610344737A CN 105969868 B CN105969868 B CN 105969868B
Authority
CN
China
Prior art keywords
map7
seq
primer
expression
aml
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201610344737.4A
Other languages
Chinese (zh)
Other versions
CN105969868A (en
Inventor
石金龙
付林
付华平
徐克曼
王晶
克晓燕
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Peking University Third Hospital
Original Assignee
Peking University Third Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Peking University Third Hospital filed Critical Peking University Third Hospital
Priority to CN201610344737.4A priority Critical patent/CN105969868B/en
Publication of CN105969868A publication Critical patent/CN105969868A/en
Application granted granted Critical
Publication of CN105969868B publication Critical patent/CN105969868B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/112—Disease subtyping, staging or classification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The detection method and its application of MAP7 expression in CN-AML tissue sample.The present invention provides the primer pair of 7 gene of microtubule bindin, the sequence of one of them primer pair is tcctgggagctgcaattaca (SEQ ID NO:2) and gggtgcttttggtcttctgg (SEQ ID NO:3) or their complementary series.Primer pair of the present invention is used for the expression height by detecting microtubule bindin 7 to the layering of normal karyotype Patients with Acute Myeloid Leukemia danger level or prognosis evaluation.The present invention also provides genetic chips and kit comprising the primer pair.

Description

The detection method and its application of MAP7 expression in CN-AML tissue sample
Technical field
The invention belongs to field of biotechnology, are related to detection, the danger level point of normal karyotype acute myeloid leukemia gene Layer and clinical prognosis assessment, more particularly to the detection primer of normal karyotype acute myeloid leukemia gene, genetic chip and examination Agent box.
Background technique
Acute myeloid leukemia (acute myeloid leukemia, AML) is a kind of extremely strong hematologic of heterogeneity Disease, account for 80% of adult acute leukemia or so (referring to MROZEK K, HEEREMA N A, BLOOMFIELD C D., Cytogenetics in acute leukemia [J] .Blood reviews, 2004,18 (2): 115-36), it includes many Entity with different genetic abnormality situations and Clinical symptoms, prognosis have the heterogeneity of height.Chromosome translocation is wherein most Common diagnosis and prognostic markers object, but approximately half of patient does not have chromosome abnormality in CN-AML, referred to as normally Caryogram acute myeloid leukemia (cytogenetically normal acute myeloid leukemia, CN-AML).In In NCCN (National Comprehensive Cancer Network) danger level hierarchical guide, CN-AML is substantially all In middle danger group.But CN-AML patient is the heterogeneous extremely strong entirety of one group of inside prognosis, and is lacked with judging prognosis Characteristic chromosomal, therefore, clinically the layering diagnosis of CN-AML and individualized treatment are extremely difficult at present, it would be highly desirable to find effectively Prognostic marker confirm that the intensity of such patient treatment avoids a part of prognosis good to realize accurately individualized treatment Good patient's treatment intensity is excessive, brings numerous unnecessary complication, equally also avoids the patient of another part prognosis mala It is insufficient to treat intensity, eventually leads to leukemia relapse.
In the prior art, CN-AML judges the genetic marker of its clinical prognosis without chromosome level, but has one There is pathogenic gene mutation inside the CN-AML of part, these gene mutations have to CN-AML patient carry out danger level layering and The value of clinical judgment prognosis, for example, carry FLT3-ITD (referring to WHITMAN S P, MAHARRY K, RADMACHER M D, et al.FLT3 internal tandem duplication associates with adverse outcome and gene-and microRNA-expression signatures in patients 60 years of age or older with primary cytogenetically normal acute myeloid leukemia:a Cancer and Leukemia Group B study [J] .Blood, 2010,116 (18): 3622-6) CN-AML patient have poor prognosis, And NPM1 mutation is carried (referring to DOHNER K, SCHLENK R F, HABDANK M, et al.Mutant nucleophosmin (NMP1)predicts favorable prognosis in younger adults with acute myeloid leukemia and normal cytogenetics:interaction with other gene mutation[J] .Blood, 2005,106 (12): 3740-6), CEBPA it is bis- mutation (referring to PASTORE F, KLING D, HOSTER E, et al.Long-term follow-up of cytogenetically normal CEBPA-mutated AML[J].Journal Of hematology&oncology, 2014,7) patient has relatively good prognosis.CN104508143A is disclosed for examining The method of disconnected, prediction, treatment and processing acute myeloid leukemia, this method are related to prediction with Patients with Acute Myeloid Leukemia Survival rate, comprising: the genetic material that separate from the patient of analysis whether there is cytogenetic abnormalities, and in gene FLT3、NPMI、DNMT3A、NRAS、CEBPA、TET2、WTI、IDHI、IDH2、KIT、RUNXI、MLL-PTD、ASXLI、PHF6、 With the presence or absence of mutation at least one of KRAS, PTEN, P53, HRAS and EZH2.
Summary of the invention
It is high that the object of the present invention is to provide a kind of sensibility, and versatility is good, the marker of high specificity, to detect CN-AML Cell or tissue sample is based on the consideration to help to judge danger level layering or the clinical prognosis of CN-AML patient: (1) gene mutation cannot cover all CN-AML, and gene expression can cover all CN-AML patients；(2)CN-AML The molecule mechanism occur, developed is still unclear at present, and seeking new clinical prognosis marker helps to understand the morbidity of CN-AML Mechanism, and can lay the foundation for the accurate targeted therapy of CN-AML.
The inventors discovered that MAP7 (microtubule associated proteins7, microtubule bindin 7) high table Up to the presence that can prompt normal karyotype acute myeloid leukemia cell, and normal karyotype Patients with Acute Myeloid Leukemia can be prompted Higher danger level layering and poor clinical prognosis.Therefore, the present invention provides MAP7 as CN-AML marker, sensibility Height, versatility is good, high specificity, can be used to help to judge danger level layering or the clinical prognosis of CN-AML patient.
On the one hand, it is high to provide MAP7 expression in a kind of detection normal karyotype acute myeloid leukemia cell or tissue by the present invention Low method, is characterized in that, uses the primer pair or probe of 7 gene of microtubule bindin.The detection includes vitro detection, It is detected including non-diagnostic purpose.The white blood of normal karyotype acute myeloid based on the MAP7 of differential expression compared with normal control cells The identification and its application of sick cancer specific feature (signature) design MAP7 gene primer pair or probe, normal to detect The expression height of MAP7 in caryogram acute myeloid leukemia cell or tissue, by detecting the expression height of MAP7 come to CN-AML Patient carries out danger level layering and analyzes clinical prognosis.The layering of the highly expressed CN-AML sample of MAP7 danger level with higher and Poor clinical prognosis.The CN-AML sample of MAP7 low expression has the layering of lower danger level and preferable clinical prognosis.
Second aspect, the present invention provide micro-pipe in a kind of detection normal karyotype acute myeloid leukemia cell or tissue sample Binding protein 7 expresses the kit of height, is characterized in that, wherein including the primer pair or probe of 7 gene of microtubule bindin.
The third aspect, the present invention provide micro-pipe in a kind of detection normal karyotype acute myeloid leukemia cell or tissue sample Binding protein 7 expresses the genetic chip of height, is characterized in that, including drawing for solid phase carrier and 7 gene of microtubule bindin Object to or probe.
Further, the present invention provides the primer pairs of 7 gene of microtubule bindin or probe passes through detection in preparation The expression of microtubule bindin 7 just carries out the base of danger level layering or prognosis evaluation to normal karyotype acute myeloid leukemia Because of the purposes in chip or kit.
Further, due to the inventors discovered that normal karyotype acute myeloid leukemia is related to MAP7 differential expression, Therefore the present invention provides MAP7 genes to design or prepare for the detection of normal karyotype acute myeloid leukemia, danger level point The reagent or the purposes in kit of layer or prognosis evaluation.
The present invention also provides MAP7 to screen or prepare in the drug for treating normal karyotype acute myeloid leukemia Purposes.
The identification of the sequence of MAP7 differential expression and lead to different prognosis result in CN-AML cell or normal cell Differential expression allow in many ways using the information.For example, specific therapeutic scheme can be assessed (for example, determining chemotherapeutic Whether object improves the long-term prognosis of particular patient).In addition, MAP7 gene expression profile (or genes of individuals), which allows to screen, inhibits CN- AML express spectra or the drug candidates that poor prognosis spectrum is transformed into better prognosis spectrum.
Present invention provides measurement CN-AML subject prognosis method comprising, measurement from subject by In test agent MAP7 gene product level (its prognosis for example good or positive with the specific prognosis of CN-AML, difference or not The prognosis of benefit is related).According to these methods, compared with the level of MAP7 gene product corresponding in control sample, given the test agent In MAP7 gene product level relevant to specific prognosis change, instruction subject suffer from specific prognosis CN-AML. MAP7 gene product expression height is related to unfavorable (that is, poor) prognosis.The example of unfavorable prognosis includes but is not limited to low survival rate With disease rapid progress.
In one embodiment of the invention, provide a kind of detection normal karyotype acute myeloid leukemia cell or The method that MAP7 expresses height in tissue, is characterized in that, using the primer pair of 7 gene of microtubule bindin, the primer pair Sequence is following sequence or their complementary series:
LEFT PRIMER tcctgggagctgcaattaca SEQ ID NO:2
RIGHT PRIMER gggtgcttttggtcttctgg SEQ ID NO:3.
In another specific embodiment of the invention, a kind of detection normal karyotype acute myeloid leukemia cell is provided Or the method that MAP7 expresses height in tissue, it is characterized in that, using the primer pair of 7 gene of microtubule bindin, the primer pair Sequence be following sequence or their complementary series:
LEFT PRIMER ccagaagaccaaaagcaccc SEQ ID NO:5
RIGHT PRIMER agctagctgtttctcccgtt SEQ ID NO:6.
In another specific embodiment of the invention, a kind of detection normal karyotype acute myeloid leukemia cell is provided Or the method that MAP7 expresses height in tissue, it is characterized in that, using the primer pair of 7 gene of microtubule bindin, the primer pair Sequence be following sequence or their complementary series:
LEFT PRIMER catcttgcagccccatcatc SEQ ID NO:8
RIGHT PRIMER agctggttgtcttgctttgg SEQ ID NO:9
The MAP7 expression height in a kind of detection normal karyotype acute myeloid leukemia cell provided by the invention or tissue Kit a specific embodiment in, the kit include 7 gene of microtubule bindin primer pair, the primer Pair sequence be following any group of sequence or their complementary series:
First group of primer pair:
LEFT PRIMER tcctgggagctgcaattaca SEQ ID NO:2
RIGHT PRIMER gggtgcttttggtcttctgg SEQ ID NO:3.
Second group of primer pair:
LEFT PRIMER ccagaagaccaaaagcaccc SEQ ID NO:5
RIGHT PRIMER agctagctgtttctcccgtt SEQ ID NO:6.
Third group primer pair:
LEFT PRIMER catcttgcagccccatcatc SEQ ID NO:8
RIGHT PRIMER agctggttgtcttgctttgg SEQ ID NO:9.
The MAP7 expression height in a kind of detection normal karyotype acute myeloid leukemia cell provided by the invention or tissue Genetic chip a specific embodiment in, the genetic chip includes 7 gene of solid phase carrier and microtubule bindin Primer pair, the sequence of the primer pair are following any group of sequence or their complementary series:
First group of primer pair:
LEFT PRIMER tcctgggagctgcaattaca SEQ ID NO:2
RIGHT PRIMER gggtgcttttggtcttctgg SEQ ID NO:3.
Second group of primer pair:
LEFT PRIMER ccagaagaccaaaagcaccc SEQ ID NO:5
RIGHT PRIMER agctagctgtttctcccgtt SEQ ID NO:6.
Third group primer pair:
LEFT PRIMER catcttgcagccccatcatc SEQ ID NO:8
RIGHT PRIMER agctggttgtcttgctttgg SEQ ID NO:9.
It is therefore preferred that being characterized in that present invention provides one group of primer pair, sequence is following any group of sequence Column or their complementary series:
First group of primer pair:
LEFT PRIMER tcctgggagctgcaattaca SEQ ID NO:2
RIGHT PRIMER gggtgcttttggtcttctgg SEQ ID NO:3
Second group of primer pair:
LEFT PRIMER ccagaagaccaaaagcaccc SEQ ID NO:5
RIGHT PRIMER agctagctgtttctcccgtt SEQ ID NO:6
Or
Third group primer pair:
LEFT PRIMER catcttgcagccccatcatc SEQ ID NO:8
RIGHT PRIMER agctggttgtcttgctttgg SEQ ID NO:9.
In technical solution of the invention preferred, provide one group of primer pair, the primer pair be SEQ ID NO:2 and The sequence or their complementary series of SEQ ID NO:3:
LEFT PRIMER tcctgggagctgcaattaca SEQ ID NO:2
RIGHT PRIMER gggtgcttttggtcttctgg SEQ ID NO:3
Preferably, it the present invention provides a kind of genetic chip, is characterized in that comprising solid phase carrier and above-mentioned primer pair The sequence or their complementary series of SEQ ID NO:2 and SEQ ID NO:3.Present invention provides a kind of kit, Sequence or their complementary series comprising above-mentioned primer pair SEQ ID NO:2 and SEQ ID NO:3.The above-mentioned primer of the present invention Sequence or their complementary series, its genetic chip or kit to SEQ ID NO:2 and SEQ ID NO:3 is for detecting MAP7 expression height in cell or tissue.In a preferred embodiment of the invention, above-mentioned primer pair, gene core Piece, kit are for detecting MAP7 expression height in normal karyotype acute myeloid leukemia cell or tissue.Of the invention one In a preferred embodiment, above-mentioned primer pair, genetic chip, kit are anxious for non-diagnostic purpose detection normal karyotype Property marrow series leukemia cell or tissue in MAP7 expression height.
Preferably, the present invention provides a kind of method of MAP7 expression height in detection cell or tissue sample, feature exists In, using the sequence of above-mentioned primer pair SEQ ID NO:2 and SEQ ID NO:3 of the invention or their complementary series, its Genetic chip or kit.In of the invention one more preferable specific embodiment, the present invention provides a kind of detection is normal The method that MAP7 expresses height in caryogram acute myeloid leukemia cell or tissue sample, is characterized in that, using of the invention upper State the sequence or their complementary series, its genetic chip or kit of primer pair SEQ ID NO:2 and SEQ ID NO:3. In a preferred embodiment of the invention, the present invention provides a kind of detection normal karyotype of non-diagnostic purpose is acute The method that MAP7 expresses height in marrow series leukemia cell or tissue sample, is characterized in that, uses above-mentioned primer pair of the invention The sequence or their complementary series, its genetic chip or kit of SEQ ID NO:2 and SEQ ID NO:3.The detection MAP7 expression height is the detection to isolated cells or tissue sample.
Preferably, the present invention provides the sequences or their complementation of primer pair SEQ ID NO:2 and SEQ ID NO:3 Sequence carries out danger level layering to normal karyotype Patients with Acute Myeloid Leukemia by detecting the expression height of MAP7 in preparation Or the purposes in the genetic chip of clinical prognosis assessment；And primer pair SEQ ID NO:2 and SEQ ID NO:3 sequence or Their complementary series carries out normal karyotype Patients with Acute Myeloid Leukemia by detecting the expression height of MAP7 in preparation Purposes in the kit of danger level layering or clinical prognosis assessment.
It is highly preferred that the present invention provides one group of primers of the expression height for detecting MAP7 in cell or tissue sample Right, sequence is SEQ ID NO:2 and SEQ ID NO:3 or their complementary series:
LEFT PRIMER tcctgggagctgcaattaca SEQ ID NO:2
RIGHT PRIMER gggtgcttttggtcttctgg SEQ ID NO:3.
In a specific embodiment, the sequence of the MAP7 is SEQ ID NO:1.Pcr amplification product size is 216, Product Sequence is SEQ ID NO:4.Preferably, the cell or tissue sample is CN-AML cell or tissue sample, institute State the detection that detection is non-diagnostic purpose.The detection is carried out to isolated cells or tissue.
It is highly preferred that the present invention also provides it is a kind of for detect MAP7 expression height genetic chip, be characterized in that, It includes solid phase carrier and above-mentioned primer pair SEQ ID NO:2 and SEQ ID NO:3 or their complementary series.The present invention Provide it is a kind of for detect MAP7 expression height kit, it includes above-mentioned primer pair SEQ ID NO:2 and SEQ ID NO:3 or their complementary series.In a preferred embodiment of the invention, above-mentioned primer pair SEQ ID NO:2 With SEQ ID NO:3 or their complementary series, genetic chip, kit for detecting normal karyotype acute myeloid leukemia MAP7 expression height in cell or tissue.In a preferred embodiment of the invention, above-mentioned primer pair SEQ ID NO:2 and SEQ ID NO:3 or their complementary series, genetic chip, kit are for non-diagnostic purpose detection normal karyotype MAP7 expression height in acute myeloid leukemia cell or tissue.
It is highly preferred that the present invention also provides MAP7 expression in a kind of detection cell or tissue sample of non-diagnostic purpose is high Low method, is characterized in that, using the sequence of above-mentioned primer pair SEQ ID NO:2 and SEQ ID NO:3 of the invention or it Complementary series, its genetic chip or kit.It is highly preferred that wherein the cell or tissue sample is that normal karyotype is acute Marrow series leukemia cell or tissue sample.The detection MAP7 expression height is non-diagnostic purpose, is in vitro tissue sample Detection.In one embodiment of the invention, provide for the expression height by detecting MAP7 to normal Caryogram Patients with Acute Myeloid Leukemia carries out one group of primer pair of danger level layering or clinical prognosis assessment, and sequence is SEQ ID NO:2 and SEQ ID NO:3 or their complementary series:
LEFT PRIMER tcctgggagctgcaattaca SEQ ID NO:2
RIGHT PRIMER gggtgcttttggtcttctgg SEQ ID NO:3
Pcr amplification product size is 216, and amplified production sequence is SEQ ID NO:4.
In a specific embodiment of the invention, provide for the expression height by detecting MAP7 to normal core Type Patients with Acute Myeloid Leukemia carries out the genetic chip of danger level layering or clinical prognosis assessment comprising solid phase carrier and draws Object, the primer are the sequences or their complementary series of SEQ ID NO:2 and SEQ ID NO:3.The present invention also provides Sequence is table of the primer of SEQ ID NO:2 and SEQ ID NO:3 or their complementary series in preparation by detection MAP7 Normal karyotype Patients with Acute Myeloid Leukemia is carried out in the genetic chip of danger level layering or clinical prognosis assessment up to height Purposes.
In a specific embodiment of the invention, provide for the expression height by detecting MAP7 to normal core Type Patients with Acute Myeloid Leukemia carries out the kit of danger level layering or clinical prognosis assessment, is SEQ ID it includes sequence The primer or their complementary series of NO:2 and SEQ ID NO:3.The present invention also provides sequence be SEQ ID NO:2 and The primer of SEQ ID NO:3 or their complementary series is in preparation by detecting the expression height of MAP7 to normal karyotype Patients with Acute Myeloid Leukemia carries out the purposes in the kit of danger level layering or prognosis.
In specific embodiment above, the primer pair used can use SEQ ID NO:5 and SEQ ID NO:6 generation It replaces, pcr amplification product size is 194, and amplified production sequence is SEQ ID NO:7.The primer pair used can also be SEQ ID NO:8 and SEQ ID NO:9, pcr amplification product size are 224, and amplified production sequence is SEQ ID NO:10.SEQ ID NO:1 It is the sequence of the MAP7,4536bp.
Further, the present invention provides MAP7 to screen or prepare in the drug for treating acute myeloid leukemia Purposes.
Further, the present invention also provides MAP7 genes to design or prepare for normal karyotype acute myeloid leukemia Detection, the reagent of danger level layering or prognosis evaluation or the purposes in kit.
The primer pair sequence of MAP7 of the present invention or their complementary series, the gene core comprising carrier and MAP7 primer pair MAP7 expression height in piece, the kit comprising MAP7 primer pair, detection normal karyotype acute myeloid leukemia cell or tissue Method, can be used for clinical or non-clinical detection MAP7 expression, can be used for diagnosis or non-diagnostic purpose.It can use The method of MAP7 expression height, MAP7 gene in detection normal karyotype acute myeloid leukemia cell or tissue provided by the invention Primer pair, genetic chip, kit, by the expression of the cell or tissue sample detection MAP7 to CN-AML patient height come pair CN-AML patient carries out danger level layering and analyzes clinical prognosis.The highly expressed CN-AML patient of MAP7 danger level with higher Layering and poor clinical prognosis.The CN-AML patient of MAP7 low expression has the layering of lower danger level and preferable clinic pre- Afterwards.MAP7 gene primer of the present invention, genetic chip, kit can be also used for non-clinical or non-diagnostic purpose, including but It is not limited to laboratory research, the detection of MAP7 in cell culture or tissue cultures, blood product detection, standard control etc..
The primer pair or probe of MAP7 gene of the present invention can be by the way that well known to a person skilled in the art methods to be set Meter, primer pair or probe of the invention are prepared by biological or chemical synthetic technology well known in the art.It can be used a variety of The expression of the measurement gene product of technology known to the technical staff of field.Such as use rna blot analysis, Northern Blot, Southern Blot, Western Blot or fluorescence quantitative PCR detection detect gene product in given the test agent Level is higher than control sample lower than the level of gene product in the level or given the test agent of gene product corresponding in control sample The level of corresponding gene product in product.
Attached drawing briefly describes
It is MAP7 shown in Fig. 1 in the expression in CN-AML patient and normal person's sample and between other prognostic markers Compare figure.
It is that display figure is increased in CN-AML Bone Marrow of Patients sample VS Normal Human Bone Marrow sample MAP7 expression shown in Figure 1A.
It is that display figure is increased in CN-AML patient peripheral blood specimen VS Normal human peripheral's blood specimen MAP7 expression shown in Figure 1B.
It is the comparison result figure that MAP7 expresses height in FLT-ITD, NPM1 mutation, CEBPA mutation patient shown in Fig. 1 C. The expression of MAP7 is positively correlated with FLT3-ITD, is negatively correlated with double mutation CEBPA.
It is the result figure that MAP7 expresses height situation in other prognostic markers shown in Fig. 1 D.Other prognosis mala markers More easily occur in MAP7 high expression, prognosis bona's marker is easier to occur in MAP7 low expression.
It is detection and prognosis survival analysis display figure of the MAP7 in CN-AML Patient Sample A shown in Fig. 2.
It is that whole CN-AML bone marrow specimens are carried out with the detection of MAP7 expression to analyze with overall survival (OS) shown in Fig. 2A Scheme as the result is shown.MAP7 is the poor prognosis marker of CN-AML and CN-AML patient.MAP7highWith shorter OS (p= 0.0441).It is that whole CN-AML bone marrow specimens are carried out with the detection of MAP7 expression and Event-free survival rate (EFS) shown in Fig. 2 B Analysis is schemed as the result is shown.MAP7 is the poor prognosis marker of CN-AML and CN-AML patient.MAP7highWith shorter EFS (p=0.0114).
It is that OS prognosis is carried out to (ELN) low danger patient in the layering of the Europe CN-AML leukaemia cooperative groups danger level shown in Fig. 2 C The figure as the result is shown (p=0.8856) of analysis.
It is the figure (p=as the result is shown that EFS prognostic analysis is carried out to danger CN-AML patient low in ELN classification shown in Fig. 2 D 0.9389)。
It is the figure as the result is shown that prognostic analysis is carried out to -1 patient of middle danger in ELN classification, MAP7 shown in Fig. 2 EhighWith compared with Short OS (p=0.0344).
It is the figure as the result is shown that prognostic analysis is carried out to -1 patient of middle danger in ELN classification, MAP7 shown in Fig. 2 FhighWith compared with Short EFS (p=0.0052).
Specific embodiment
MAP7 primer entrusts Sangon Biotech (Shanghai) Co., Ltd.) limited liability company's synthesis.It is detected with real-time fluorescence quantitative PCR MAP7 expression height.The common fluorescent dye of real-time fluorescence quantitative PCR has Taqman probe, SYBR Green I etc..SYBR Green I is a kind of fluorescent dye, can be combined with arbitrary double-stranded DNA, by the collection of fluorescence signal, reflects template copy Several numbers.The present invention mainly uses SYBR Green I to carry out real-time fluorescence quantitative PCR detection.
The extraction of 1 total serum IgE of embodiment
In experimental implementation, extracts with RNA and detect related micropipettor, Tip rifle point, EP pipe etc. and be both needed to by nothing RNase processing.
1, lytic cell: the QIAZOL reagent of 1ml being added into the cell precipitation of collection, and oscillator concussion mixes, room temperature Crack it sufficiently within effect 15 minutes or more.If RNA cannot be extracted at once after QIAZOL reagent is added, -20 DEG C can be put it into It saves, can be used in a short time.
2, according to chloroform: QIAZOL volume ratio is the ratio of 1:4, and about 300 μ l chloroforms are added, mixing 1 minute of turning upside down, Be stored at room temperature 5-10 minutes, low-temperature centrifugation: 4 DEG C, 12600rpm is centrifuged 10 minutes.
3, after being centrifuged, three layers of EP liquid in pipe point, upper layer is the supernatant containing RNA, and middle lower layer is DNA and albumen Matter.Then, supernatant is transferred in new EP pipe, and isometric isopropanol is added, mixing of turning upside down, stand at low temperature 10 Minute, centrifugation: 4 DEG C, 12600rpm is centrifuged 15 minutes.
4, supernatant is abandoned, white precipitate is RNA, and 75% ethyl alcohol (preparation of DEPC water) of 1ml is added, is gently mixed by inversion, Room temperature centrifugation: 8000rpm is centrifuged 5 minutes.
5, it dissolves RNA: removing supernatant, and EP pipe is buckled on blotting paper, blot nozzle.It is got rid of then at centrifuge overhead several Second, remaining alcohol is all sucked out with sample loading gun, is air-dried 3-5 minutes.The water dissolution of the nuclease free of certain volume is added RNA。
6, UV spectrophotometer measuring RNA concentration.It extracts obtained RNA and puts -20 DEG C of preservations, can be used in one month；It sets It then can be reserved for relatively long time in -80 DEG C.
Embodiment 2RNA reverse transcription
1, prepare reverse transcription system according to table 1, total reaction volume is 25 μ l (total serum IgE amount is 1 μ g).It operates below in ice Upper progress:
The preparation of 1 reverse transcription system of table
2, after above each reactive component being formulated into the PCR reaction tube of 0.2ml, it is anti-to be put into progress reverse transcription in PCR instrument It answers, program is 37 DEG C, 2h；4 DEG C, forever.The product obtained after reaction is cDNA, is put after reaction product is taken out It is saved in -20 DEG C stand-by.
The detection of 3 real-time fluorescence quantitative PCR of embodiment
1, real time PCR mix is prepared according to table 2.
2,2 × SYBR Green I of 2 times of volumes, Nuclease-free water, template cDNA are first prepared in reaction tube And II mixture of ROX, packing is into the PCR reaction tube of two 0.2ml after mixing, then is separately added into target gene SEQ ID Primer pair SEQ ID NO:2 and 3 or internal reference GAPDH (glyceraldehyde-3-phosphate dehydrogenase, the glyceraldehyde-3- of NO:1 Phosphate dehydrogenase) primer, mix gently.
3, reaction tube is put into real-time fluorescence quantitative PCR instrument and carries out PCR amplification, response procedures are 95 DEG C, 1 minute；95 DEG C, 5s；60 DEG C, 20s；40 circulations altogether.Then 95 DEG C, 1 minute；60 DEG C, 1 minute, 95 DEG C, 30s.Phosphor collection o'clock is 60 DEG C, PCR product SEQ ID NO:4 is taken out after reaction.
4, it is for statistical analysis that data will be obtained, using GAPDH as internal reference.
The preparation of 2 real time PCR mix of table
The detection of 4 real-time fluorescence quantitative PCR of embodiment
1, real time PCR mix is prepared according to table 2.
2,2 × SYBR Green I of 2 times of volumes, Nuclease-free water, template cDNA are first prepared in reaction tube And II mixture of ROX, packing is into the PCR reaction tube of two 0.2ml after mixing, then is separately added into target gene SEQ ID The primer of primer pair the SEQ ID NO:5 and 6 or internal reference GAPDH of NO:1, mix gently.
3, reaction tube is put into real-time fluorescence quantitative PCR instrument and carries out PCR amplification, response procedures are 95 DEG C, 1 minute；95 DEG C, 5s；60 DEG C, 20s；40 circulations altogether.Then 95 DEG C, 1 minute；60 DEG C, 1 minute, 95 DEG C, 30s.Phosphor collection o'clock is 60 DEG C, PCR product SEQ ID NO:7 is taken out after reaction.
4, it is for statistical analysis that data will be obtained, using GAPDH as internal reference.
The preparation of 2 real time PCR mix of table
The detection of 5 real-time fluorescence quantitative PCR of embodiment
1, real time PCR mix is prepared according to table 2.
2,2 × SYBR Green I of 2 times of volumes, Nuclease-free water, template cDNA are first prepared in reaction tube And II mixture of ROX, packing is into the PCR reaction tube of two 0.2ml after mixing, then is separately added into target gene SEQ ID The primer of primer pair the SEQ ID NO:8 and 9 or internal reference GAPDH of NO:1, mix gently.
3, reaction tube is put into real-time fluorescence quantitative PCR instrument and carries out PCR amplification, response procedures are 95 DEG C, 1 minute；95 DEG C, 5s；60 DEG C, 20s；40 circulations altogether.Then 95 DEG C, 1 minute；60 DEG C, 1 minute, 95 DEG C, 30s.Phosphor collection o'clock is 60 DEG C, PCR product SEQ ID NO:10 is taken out after reaction.
4, it is for statistical analysis that data will be obtained, using GAPDH as internal reference.
The preparation of 2 real time PCR mix of table
Detection of expression and comparative analysis of 6 MAP7 of embodiment in CN-AML patient and Normal Human Bone Marrow or peripheral blood and Compared between other CN-AML prognostic markers
To initial cell in the CN-AML patient bone marrow samples 116 of 70-97% and 5, Normal Human Bone Marrow sample, pass through Genetic chip high throughput gene expression level detects to obtain, and according to the experimental condition of embodiment 1-2, carries out MAP7 detection of expression, Figure 1A is obtained, shows that (GSE is GSE1159http://www.ncbi.nlm.nih.gov/geoMiddle pattern detection number) in 116 (p=is increased in 5 Normal Human Bone Marrow sample MAP7 expression of CN-AML Bone Marrow of Patients sample (initial cell is in 70-97%) VS 0.04) (Figure 1A).With initial cell 70-97% CN-AML patient peripheral blood sample 7, Normal human peripheral's blood sample 10 MAP7 detection of expression is carried out, Figure 1B is obtained, shows that (initial cell is in 70- for 7 CN-AML patient peripheral blood samples in GSE9476 97%) (p=0.008) (Figure 1B) is increased in 10 Normal human peripheral's blood sample MAP7 expression of VS.
Detection of expression of 7 MAP7 of embodiment in CN-AML patient tissue samples and with other CN-AML prognostic markers Between comparison
By genetic chip high throughput gene expression level detection method, according to the experimental condition of embodiment 1-2, to CN- The expression of MAP7 and other prognostic markers is detected and has been compared in AML patient tissue samples, as a result, it has been found that, MAP7 Expression be positively correlated with FLT3-ITD, be negatively correlated (Fig. 1 C) with double mutation CEBPA, other prognosis mala markers are easier Occur in MAP7 high expression, prognosis bona's marker is easier to occur in MAP7 low expression, (Fig. 1 D).
The expression of 8 MAP7 of embodiment detects and single factor test and multiplicity with the other indexs of CN-AML
It is detected by genetic chip high throughput gene expression level, according to the experimental condition of embodiment 1-2, to GSE6891 In in the peripheral blood sample of CN-AML patient (age was less than 60 years old) controlled at the beginning of 129 expression of MAP7 and CN-AML it is other Index carries out single factor test and multiplicity.
Single factor test detection and analysis result confirms: in MAP7highGroup, 1) higher (p=of ratio of FLT3-ITD is carried 0.005)；2) ratio for carrying double mutation CEBPA is lower (p=0.005)；3) ERG, WT1 with higher, DNMT3B, DNMT3A, MAPKBP1, ITPR2, ATP1B1 (P=0.0004, P < 0.0001, P < 0.0001, P=0.03, P=0.01, P= 0.005, P < 0.001) (table 3).
It is equally confirmed in multiplicity: compared with other prognosis mala factors, in CN-AML, MAP7highIt all has Shorter OS and EFS (table 4).
The expression of table 3:MAP7 and the single factor analysis of the other indexs of CN-AML
Illustrate: FAB, French-American-British classification (method, American and Britain's classification system)； ITD, internal tandem duplication (internal series-connection repetition)；TKD, tyrosine kinase domain (junket ammonia Kinase domain).High ERG, BAALC, LEF1, WT1, DNMT3B, DNMT3A, MAPKP1, ITPR2 and ATP1B1 expression difference It is defined higher than the expression of all samples average value.
The expression of table 4:MAP7 and the multiplicity of the other indexs of CN-AML
HR, hazards ratio (Hazard ratio)；CI, confidence interval (confidence interval).
9 MAP7 of embodiment is the poor prognosis marker of CN-AML patient
By genetic chip high throughput gene expression level detection method, according to the experimental condition of embodiment 1-2, to CN- The bone marrow specimens of AML (129, the age was less than 60 years old) patient carry out the detection of MAP7 expression, and carry out prognostic analysis. MAP7highWith shorter OS (p=0.0441) and EFS (p=0.0114) (Fig. 2A, B).Because in ELN guide classification standard In, CN-AML almost all is distributed in middle danger-I, prognostic analysis has been carried out to-I patient that endangers in ELN, in this group of Patient Sample A In, MAP7highEqually there is shorter OS (p=0.0344) and EFS (p=0.0052) (Fig. 2 C, D).
Conclusion: 1) MAP7 is CN-AML patient's prognosis mala marker；2) it is prognosis that MAP7, which is endangered in ELN guide in-I, Bad marker, therefore MAP7 can be used as the layering of CN-AML danger level and prognostic marker further refines this kind of patient. The highly expressed CN-AML patient of MAP7 danger level layering with higher and poor clinical prognosis, the CN-AML of MAP7 low expression Patient has the layering of lower danger level and preferable clinical prognosis.
Above-described embodiment is intended merely to that the present invention will be described in detail, rather than limits protection model of the invention in any way It encloses.
Sequence table
The mRNA sequence of SEQ ID NO:1:MAP7,4536bp:
agtgggagggggctggtaggggaggtggggaagctgctgctaggtgaggggaactgcagggcctcagt tgccaagtggctggtactatctgtcagctgtttgcaaactgtttacccataggggatctattacaagtgctcaaat gaacaggcagcttaggaactagcagcttcctgggagctgcaattacataagcatatatttttaatataatcacaat taaaaaaaaaaaaaacaagtagcagcggtatgcctggatcagctacagctctccgacatgagagactgaagaagac caatgcaaggccaattcctcttggtttattcaccattaatgaggaagacgaacagcaaaagaatggaaattccaga agaccaaaagcacccgacagctacaaagtgcaagataagaaaaatgcctccagccgccctgcctctgcaatttcag gacaaaataacaaccactcaggaaataaaccagaccctccgcctgtgttacgtgttgatgaccggcagcggctggc ccgggagcgacgtgaggaacgggagaaacagctagctgcaagagaaatagtgtggttagaaagagaagagcgagcc aggcagcactacgagaagcacctggaagagcggaagaagaggttggaggagcagaggcagaaggaggagcggagga gggctgctgtggaggagaagcggaggcagagacttgaggaggacaaagaacgccacgaagctgttgtacggcgcac aatggaaaggagccagaagccaaaacagaagcataaccgttggtcgtggggaggctctctccatgggagccctagc atccacagtgcagatccagacaggcggtcagtttccaccatgaatctttcgaaatatgttgatcccgtcattagca agcggctctcctcttcatctgcaactttactaaattctccagatagagctcgccgcctgcagctcagcccatggga gagcagcgttgttaacagactcctgacgcccacacattcgttcctggccagaagtaaaagcacagctgccttgtct ggagaagcagttatccccatttgtcctcgttcagcatcttgcagccccatcatcatgccctacaaagctgcacact ctagaaattcgatggatcgaccaaaactctttgtaacaccacctgagggctcttctcgcaggaggatcattcatgg cacagcgagctataaaaaagaaagagagagagaaaatgtactcttcctcacatctggcacccgaagggctgtatct ccatctaatcccaaagcaagacaaccagctcgctcccgactttggcttccgtccaagtctcttcctcatttgcctg gcacacccagaccgacatcctccttgccacccggctcagtcaaagctgctcctgctcaggtccggcccccatcccc cggcaacatccgccctgtcaagagggaagtcaaagtggagcctgagaagaaagatcctgagaaggaacctcagaaa gttgccaatgagccctcactaaagggcagagcacctttagtgaaggtagaagaagccacagttgaagagcggacac ctgctgaaccagaagttggccctgctgctccagccatggccccagctccagcctcggccccagctccagcctcggc cccagctccagccccggtccccaccccagccatggtctcagccccgtcatccactgtgaatgccagtgcttctgtt aagacttctgcaggcaccaccgacccagaggaggccacaaggcttctagctgagaagaggcggctggcccgagagc agagagaaaaggaagaaagggagaggagggagcaggaagagcttgaaagacaaaagagagaggaattggctcaacg tgtggctgaagagaggacgactcgccgtgaggaggagtcgcgcaggctggaagccgagcaggcccgggagaaggag gagcagctgcagcggcaggcggaggagcgggcgctgcgcgagcgggaggaggcagagcgcgcccagaggcagaaag aagaagaagctcgcgttcgtgaagaagcagagagggtccggcaggaacgagagaagcatttccagagagaagagca agagcgcctggagagaaagaagcgacttgaggagattatgaaaagaaccaggagaacagaagctacagataagaaa accagtgatcagagaaacggtgatatagccaagggagctctcactggaggaacagaggtgtctgcacttccatgta caacaaacgctccgggaaatggaaagccagttggcagcccacatgtggttacctcacaccagtcaaaagtgacagt ggagagcactcccgatttggaaaaacaaccaaatgaaaatggtgtatctgttcagaatgaaaattttgaagaaatt ataaacttacccattggatctaaaccatccagattagatgtcaccaacagtgagagcccagaaattcctttgaatc caattttggcctttgatgatgaagggacacttgggcccctgcctcaggtagatggtgttcagacacagcagactgc agaagttatatgagtgtttcttctgaagaaccaaagctgaaatttaatgagaatttctacaattaatggaattcct ttcctgctataaaggagcatcccctccacccgttttctagagttcttgaccatcattttgaaaagatttattaaaa ctagctaaagacaacagactggatagcttttctaataattttcatcaataggaaaaaagaaatacgtctcattctt caatactttaaaatggctttttccagtgtgctccttcttagcaatcaatatttttctgcattctttaaaagacaag agaatttggttataaaagaaatgggctgactaggcatgatttttttggtcttaaaagcttaacatgtaaaattggc aaaaaaaattttttaccttttataatacttgaaaaataagtacctctttgttctacaagtagaatgaataggagaa gagtttaagcctgtttttttaaaatattattgcaaagagctctatttgtagaagcaaattataggcagattaccag gttcttataaatacagcttgtacatggacattctgcaaacccagctgtcacatttttcttgcaactccttttgcaa aagcagactaaaatgttttaaaatgtgaaaaaacattattttttcaaagcaagaaaataatttactgccctcttac ataatgtatttataaagtttttccagataaactaatcaaataaattagaataatgtgacaacattacaaatttaat ttgttagctgcattccttctgatgttaccacgatagaatgttactgatgattcagggctatttctgaagtctgtat gttgctgctgtccccagtgatggtggacttatctttgccttacctgatcacaaattatgttggggaaaataaagat ttaatatttctttaaatagaaaaagaatttggttttgctcgtttaagagcaatgagaaaatgatggaatgttgact gtgtttggcacacaggacacggaccttcatggaagt ccttgctctgcgtggcatctgtcagcttttcacctttca ttcttattcttcacttttgctgctgagcctagctgtacaaacttgcactttcatttgctaatataaattcagtttt attttaccattttagagactactaatgattaaatgtagaaggagagggtgcacatgtttttatgtggagtgtttaa aagataaatttataccactgtaatgtgcagcttttattaaaagagaaattggttgaactgctaggttgaatgagag acttcatctattggactattttttttaatccaggcatatggtctttagtaatggcttgtaatttgtgaaaacatta atttgggggttttccctgttttcagttgtccatgtacacatagtcattatattagaaaagaaatctgttcaacaaa cttgtttaatttgtttaaatcaacatagcatgaaacaccaaataaaatgtttgacatagttttacttttagctttc tcatatgttataacttcactcagattgattcttgagtcttcagattgtccttcatttaactcagtgacattttcct agcctcctgttgattaagcatataggatagccttatttaaaatttagagcagtaggtgtattttggctgtttttct ttttcatgtgtgtttttaaactttagtcatcattagcaaacggaaagccttctaagtaatcaagttttaattagaa gtggtgcaaaattcttaattatattgtgttaaagagcagcgctgccagagaatgaccctgacctttacaatggctg gcttgctttttggccagcactggaaaaatctatatttacttgcagaccttaaggaggtcttcagtattcaccctac attaaggggagcgctcaggaatcaa
atatggccctcagtatgaaatgagagtgaatgggct
SEQ ID NO:2:MAP7 primer:
tcctgggagctgcaattaca
SEQ ID NO:3:MAP7 primer:
gggtgcttttggtcttctgg
The pcr amplification product sequence of SEQ ID NO:4:MAP7:
tcctgggagctgcaattacataagcatatatttttaatataatcacaattaaaaaaaaaaaaaacaag tagcagcggtatgcctggatcagctacagctctccgacatgagagactgaagaagaccaatgcaaggccaattcct cttggtttattcaccattaatgaggaagacgaacagcaaaagaatggaaattccagaagaccaaaagcaccc
SEQ ID NO:5:MAP7 primer:
ccagaagaccaaaagcaccc
SEQ ID NO:6:MAP7 primer:
agctagctgtttctcccgtt
The pcr amplification product sequence of SEQ ID NO:7:MAP7:
ccagaagaccaaaagcacccgacagctacaaagtgcaagataagaaaaatgcctccagccgccctgcc tctgcaatttcaggacaaaataacaaccactcaggaaataaaccagaccctccgcctgtgttacgtgttgatgacc ggcagcggctggcccgggagcgacgtgaggaacgggagaaacagctagct
SEQ ID NO:8:MAP7 primer:
catcttgcagccccatcatc
SEQ ID NO:9:MAP7 primer:
agctggttgtcttgctttgg
The pcr amplification product sequence of SEQ ID NO:10:MAP7:
catcttgcagccccatcatcatgccctacaaagctgcacactctagaaattcgatggatcgaccaaaa ctctttgtaacaccacctgagggctcttctcgcaggaggatcattcatggcacagcgagctataaaaaagaaagag agagagaaaatgtactcttcctcacatctggcacccgaagggctgtatctccatctaatcccaaagcaagacaacc agct 。
Sequence table
The mRNA sequence of SEQ ID NO:1:MAP7,4536bp:
agtgggagggggctggtaggggaggtggggaagctgctgctaggtgaggggaactgcagg
gcctcagttgccaagtggctggtactatctgtcagctgtttgcaaactgtttacccatag
gggatctattacaagtgctcaaatgaacaggcagcttaggaactagcagcttcctgggag
ctgcaattacataagcatatatttttaatataatcacaattaaaaaaaaaaaaaacaagt
agcagcggtatgcctggatcagctacagctctccgacatgagagactgaagaagaccaat
gcaaggccaattcctcttggtttattcaccattaatgaggaagacgaacagcaaaagaat
ggaaattccagaagaccaaaagcacccgacagctacaaagtgcaagataagaaaaatgcc
tccagccgccctgcctctgcaatttcaggacaaaataacaaccactcaggaaataaacca
gaccctccgcctgtgttacgtgttgatgaccggcagcggctggcccgggagcgacgtgag
gaacgggagaaacagctagctgcaagagaaatagtgtggttagaaagagaagagcgagcc
aggcagcactacgagaagcacctggaagagcggaagaagaggttggaggagcagaggcag
aaggaggagcggaggagggctgctgtggaggagaagcggaggcagagacttgaggaggac
aaagaacgccacgaagctgttgtacggcgcacaatggaaaggagccagaagccaaaacag
aagcataaccgttggtcgtggggaggctctctccatgggagccctagcatccacagtgca
gatccagacaggcggtcagtttccaccatgaatctttcgaaatatgttgatcccgtcatt
agcaagcggctctcctcttcatctgcaactttactaaattctccagatagagctcgccgc
ctgcagctcagcccatgggagagcagcgttgttaacagactcctgacgcccacacattcg
ttcctggccagaagtaaaagcacagctgccttgtctggagaagcagttatccccatttgt
cctcgttcagcatcttgcagccccatcatcatgccctacaaagctgcacactctagaaat
tcgatggatcgaccaaaactctttgtaacaccacctgagggctcttctcgcaggaggatc
attcatggcacagcgagctataaaaaagaaagagagagagaaaatgtactcttcctcaca
tctggcacccgaagggctgtatctccatctaatcccaaagcaagacaaccagctcgctcc
cgactttggcttccgtccaagtctcttcctcatttgcctggcacacccagaccgacatcc
tccttgccacccggctcagtcaaagctgctcctgctcaggtccggcccccatcccccggc
aacatccgccctgtcaagagggaagtcaaagtggagcctgagaagaaagatcctgagaag
gaacctcagaaagttgccaatgagccctcactaaagggcagagcacctttagtgaaggta
gaagaagccacagttgaagagcggacacctgctgaaccagaagttggccctgctgctcca
gccatggccccagctccagcctcggccccagctccagcctcggccccagctccagccccg
gtccccaccccagccatggtctcagccccgtcatccactgtgaatgccagtgcttctgtt
aagacttctgcaggcaccaccgacccagaggaggccacaaggcttctagctgagaagagg
cggctggcccgagagcagagagaaaaggaagaaagggagaggagggagcaggaagagctt
gaaagacaaaagagagaggaattggctcaacgtgtggctgaagagaggacgactcgccgt
gaggaggagtcgcgcaggctggaagccgagcaggcccgggagaaggaggagcagctgcag
cggcaggcggaggagcgggcgctgcgcgagcgggaggaggcagagcgcgcccagaggcag
aaagaagaagaagctcgcgttcgtgaagaagcagagagggtccggcaggaacgagagaag
catttccagagagaagagcaagagcgcctggagagaaagaagcgacttgaggagattatg
aaaagaaccaggagaacagaagctacagataagaaaaccagtgatcagagaaacggtgat
atagccaagggagctctcactggaggaacagaggtgtctgcacttccatgtacaacaaac
gctccgggaaatggaaagccagttggcagcccacatgtggttacctcacaccagtcaaaa
gtgacagtggagagcactcccgatttggaaaaacaaccaaatgaaaatggtgtatctgtt
cagaatgaaaattttgaagaaattataaacttacccattggatctaaaccatccagatta
gatgtcaccaacagtgagagcccagaaattcctttgaatccaattttggcctttgatgat
gaagggacacttgggcccctgcctcaggtagatggtgttcagacacagcagactgcagaa
gttatatgagtgtttcttctgaagaaccaaagctgaaatttaatgagaatttctacaatt
aatggaattcctttcctgctataaaggagcatcccctccacccgttttctagagttcttg
accatcattttgaaaagatttattaaaactagctaaagacaacagactggatagcttttc
taataattttcatcaataggaaaaaagaaatacgtctcattcttcaatactttaaaatgg
ctttttccagtgtgctccttcttagcaatcaatatttttctgcattctttaaaagacaag
agaatttggttataaaagaaatgggctgactaggcatgatttttttggtcttaaaagctt
aacatgtaaaattggcaaaaaaaattttttaccttttataatacttgaaaaataagtacc
tctttgttctacaagtagaatgaataggagaagagtttaagcctgtttttttaaaatatt
attgcaaagagctctatttgtagaagcaaattataggcagattaccaggttcttataaat
acagcttgtacatggacattctgcaaacccagctgtcacatttttcttgcaactcctttt
gcaaaagcagactaaaatgttttaaaatgtgaaaaaacattattttttcaaagcaagaaa
ataatttactgccctcttacataatgtatttataaagtttttccagataaactaatcaaa
taaattagaataatgtgacaacattacaaatttaatttgttagctgcattccttctgatg
ttaccacgatagaatgttactgatgattcagggctatttctgaagtctgtatgttgctgc
tgtccccagtgatggtggacttatctttgccttacctgatcacaaattatgttggggaaa
ataaagatttaatatttctttaaatagaaaaagaatttggttttgctcgtttaagagcaa
tgagaaaatgatggaatgttgactgtgtttggcacacaggacacggaccttcatggaagt
ccttgctctgcgtggcatctgtcagcttttcacctttcattcttattcttcacttttgct
gctgagcctagctgtacaaacttgcactttcatttgctaatataaattcagttttatttt
accattttagagactactaatgattaaatgtagaaggagagggtgcacatgtttttatgt
ggagtgtttaaaagataaatttataccactgtaatgtgcagcttttattaaaagagaaat
tggttgaactgctaggttgaatgagagacttcatctattggactattttttttaatccag
gcatatggtctttagtaatggcttgtaatttgtgaaaacattaatttgggggttttccct
gttttcagttgtccatgtacacatagtcattatattagaaaagaaatctgttcaacaaac
ttgtttaatttgtttaaatcaacatagcatgaaacaccaaataaaatgtttgacatagtt
ttacttttagctttctcatatgttataacttcactcagattgattcttgagtcttcagat
tgtccttcatttaactcagtgacattttcctagcctcctgttgattaagcatataggata
gccttatttaaaatttagagcagtaggtgtattttggctgtttttctttttcatgtgtgt
ttttaaactttagtcatcattagcaaacggaaagccttctaagtaatcaagttttaatta
gaagtggtgcaaaattcttaattatattgtgttaaagagcagcgctgccagagaatgacc
ctgacctttacaatggctggcttgctttttggccagcactggaaaaatctatatttactt
gcagaccttaaggaggtcttcagtattcaccctacattaaggggagcgctcaggaatcaa
atatggccctcagtatgaaatgagagtgaatgggct
SEQ ID NO:2:MAP7 primer:
tcctgggagctgcaattaca
SEQ ID NO:3:MAP7 primer:
gggtgcttttggtcttctgg
The pcr amplification product sequence of SEQ ID NO:4:MAP7:
tcctgggagctgcaattacataagcatatatttttaatataatcacaatt
aaaaaaaaaaaaaacaagtagcagcggtatgcctggatcagctacagctc
tccgacatgagagactgaagaagaccaatgcaaggccaattcctcttggt
ttattcaccattaatgaggaagacgaacagcaaaagaatggaaattccag
aagaccaaaagcaccc
SEQ ID NO:5:MAP7 primer:
ccagaagaccaaaagcaccc
SEQ ID NO:6:MAP7 primer:
agctagctgtttctcccgtt
The pcr amplification product sequence of SEQ ID NO:7:MAP7:
ccagaagaccaaaagcacccgacagctacaaagtgcaagataagaaaaatgcctccagccg
ccctgcctctgcaatttcaggacaaaataacaaccactcaggaaataaaccagaccctccg
cctgtgttacgtgttgatgaccggcagcggctggcccgggagcgacgtgaggaacgggaga
aacagctagct
SEQ ID NO:8:MAP7 primer:
catcttgcagccccatcatc
SEQ ID NO:9:MAP7 primer:
agctggttgtcttgctttgg
The pcr amplification product sequence of SEQ ID NO:10:MAP7:
catcttgcagccccatcatcatgccctacaaagctgcacactctagaaattcgatggatcg
accaaaactctttgtaacaccacctgagggctcttctcgcaggaggatcattcatggcaca
gcgagctataaaaaagaaagagagagagaaaatgtactcttcctcacatctggcacccgaa
gggctgtatctccatctaatcccaaagcaagacaaccagct

Claims (1)

1. the primer pair of 7 gene of microtubule bindin is in preparation by detecting the expression height of microtubule bindin 7 to normal The genetic chip or the purposes in kit that caryogram acute myeloid leukemia carries out danger level layering or prognosis evaluation；It is wherein described The primer pair of 7 gene of microtubule bindin is following any group of sequence:
First group of primer pair:
LEFT PRIMER tcctgggagctgcaattaca SEQ ID NO:2
RIGHT PRIMER gggtgcttttggtcttctgg SEQ ID NO:3
Second group of primer pair:
LEFT PRIMER ccagaagaccaaaagcaccc SEQ ID NO:5
RIGHT PRIMER agctagctgtttctcccgtt SEQ ID NO:6
Or
Third group primer pair:
LEFT PRIMER catcttgcagccccatcatc SEQ ID NO:8
RIGHT PRIMER agctggttgtcttgctttgg SEQ ID NO:9.
CN201610344737.4A 2016-05-23 2016-05-23 The detection method and its application of MAP7 expression in CN-AML tissue sample Expired - Fee Related CN105969868B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610344737.4A CN105969868B (en) 2016-05-23 2016-05-23 The detection method and its application of MAP7 expression in CN-AML tissue sample

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610344737.4A CN105969868B (en) 2016-05-23 2016-05-23 The detection method and its application of MAP7 expression in CN-AML tissue sample

Publications (2)

Publication Number Publication Date
CN105969868A CN105969868A (en) 2016-09-28
CN105969868B true CN105969868B (en) 2019-11-15

Family

ID=56956838

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610344737.4A Expired - Fee Related CN105969868B (en) 2016-05-23 2016-05-23 The detection method and its application of MAP7 expression in CN-AML tissue sample

Country Status (1)

Country Link
CN (1) CN105969868B (en)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011075724A2 (en) * 2009-12-18 2011-06-23 The University Of North Carolina At Chapel Hill Methods and compositions for analysis of clear cell renal cell carcinoma

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Changes in microtubules, microtubule-associated proteins, and intermediate filaments during the differentiation of HL-60 leukemia cells;Mun-Fai Leung等;《Cancer Research》;19920215;第52卷;第949-954页 *
Microtubule-associated proteins as targets in cancer chemotherapy;Kumar M.R等;《Clin Cancer Res》;20070315;第13卷(第10期);第2849-2853页 *
MLL is fused to EB1（MAPRE1）,which encodes a microtubule-associated protein,in a patient with acute lymphoblastic leukemia;JF Fu等;《Genes chromosomes cancer》;20050630;第43卷(第2期);第206-210页 *

Also Published As

Publication number Publication date
CN105969868A (en) 2016-09-28

Similar Documents

Publication Publication Date Title
Inubushi et al. Oncogenic miRNAs identified in tear exosomes from metastatic breast cancer patients
Liu et al. Blood-based liquid biopsy: Insights into early detection and clinical management of lung cancer
Lin et al. Aberrant expression of microRNAs in serum may identify individuals with pancreatic cancer
Kolostova et al. Next generation sequencing of glioblastoma circulating tumor cells: non-invasive solution for disease monitoring
CN107881239B (en) miRNA marker related to colorectal cancer metastasis in plasma and application thereof
CN109055555A (en) A kind of lung cancer transfer diagnosis marker and its kit and application in early days
Rao et al. Identification of plasma exosomes long non-coding RNA HAGLR and circulating tumor cells as potential prognosis biomarkers in non-small cell lung cancer
CN107614696A (en) Gene expression profiles and the method for being applied to breast cancer medical treatment
CN107287345B (en) Detection kit for accurate diagnosis and treatment of acute myeloid leukemia and TSEN34 clinical application
CN110106244A (en) A kind of noninvasive molecule parting kit of breast cancer and method
CN107312865B (en) Purposes of the LOC100130111 in preparation osteosarcoma diagnostic products, therapeutic agent
CN109628600A (en) A kind of biomarker for early-stage breast cancer diagnosis
CN106244675B (en) Kit for adult AML risk stratification and clinical prognosis evaluation and application of CPNE3
Wei et al. Epithelial-mesenchymal transition classification of circulating tumor cells predicts clinical outcomes in progressive nasopharyngeal carcinoma
CN105969867B (en) The detection method and its application of CPT1A expression in AML tissue sample
CN105969868B (en) The detection method and its application of MAP7 expression in CN-AML tissue sample
CN108456730A (en) Distant place risk of recurrence gene group and in-vitro diagnosis product and application in breast cancer parting
CN107641650A (en) Applications of the NR1H3 in acute myeloid leukemia precisely targets detection and prognosis evaluation
CN114350812A (en) NSCLC-free RNA-3 related to oxicetitinib drug resistance and application thereof
CN109563548A (en) For identifying the in-vitro method of cancer of pancreas or pancreatic intraductal papillary mucinous tumor
CN106636440A (en) Application of plasma microRNAs to preparation of diagnosis reagent for screening and diagnosing lung adenocarcinoma patients from male population
CN106282366A (en) A kind of molecular marked compound relevant to carcinoma of prostate and application thereof
Xia et al. Bioinformatics analysis and experimental verification of TIGD1 in non-small cell lung cancer
CN107365859A (en) Molecular markers of the LncRNA as diagnosis and treatment osteosarcoma
CN102864238A (en) Serologic biomarker miR-451 (microRNA) for detecting ovarian tumor and application thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20191115