CN105969751A

CN105969751A - Beta-glucose glycosides enzyme gene and application thereof

Info

Publication number: CN105969751A
Application number: CN201610424102.5A
Authority: CN
Inventors: 姜岷; 薛梦蕾; 董维亮; 马江锋
Original assignee: Nanjing Tech University
Current assignee: Nanjing Tech University
Priority date: 2016-06-14
Filing date: 2016-06-14
Publication date: 2016-09-28
Anticipated expiration: 2036-06-14
Also published as: CN105969751B

Abstract

The invention relates to a beta-glucose glycosides enzyme gene. The beta-glucose glycosides enzyme gene is obtained from soil total DNA, and the nucleotide sequence is SEQ ID NO: 1. According to the beta-glucose glycosides enzyme, a surface display or signal peptide expression technology is not needed, a thallus can directly utilize cellobiose, and thus production of succinic acid is conducted.

Description

A kind of beta-glucosidase gene and application thereof

Technical field

The present invention relates to microbial technology field, be specifically related to a kind of beta-glucosidase gene and application thereof.

Background technology

Beta-glucosidase (EC3.2.1.21) belongs to hydrolytic enzyme.It can hydrolyze and combine the β-D-Fructus Vitis viniferae of end, irreducibility Sugar and corresponding aglucon.Cellobiose or short chain glucosan can be hydrolyzed into glucose by this enzyme.Hydrolyze because it participates in cellulose A rear step, so being considered as often the rate-limiting enzyme of cellulose hydrolysis and saccharification process.Beta-glucosidase is permissible according to aminoacid sequence It is divided into glycoside hydrolase Families 1 and 3 liang of classes of glycoside hydrolase Families.Enzyme in glycoside hydrolase Families 1 is mainly derived from carefully Bacterium, plant and mammal；In glycoside hydrolase Families 3, enzyme source is in fungus, antibacterial and plant.Its source visible is wider General.It is glucose that beta-glucosidase typically reaches to decompose cellobiose outside born of the same parents by the way of surface display and signal peptide expression, Supply cell with this and utilize growth, the most not yet have beta-glucosidase to need not by surface display or signal peptide expression and just may be used With the report utilizing cellobiose to grow.

Summary of the invention

One of technical purpose of the present invention, is to provide a kind of beta-glucosidase gene from soil STb gene, described Soil STb gene gathers near Bian Shang little garden, playground, Nanjing University of Technology east.

For realizing above-mentioned technical purpose, the present invention adopts the following technical scheme that

Beta-glucosidase gene of the present invention, derives from soil near Bian Shang little garden, playground, Nanjing University of Technology east total DNA, its nucleotide sequence is as shown in SEQ ID NO:1, and its aminoacid sequence is as shown in SEQ ID NO:2.

Described beta-glucosidase gene is the genomic library by building soil STb gene, through a series of enzyme action, enzyme Positive colony needed for the means acquisitions such as company, conversion, extracts the order-checking of positive colony plasmid, it is thus achieved that beta-glucosidase nucleotides sequence Row.Genes of interest is i.e. obtained by PCR further according to obtained primers.Advantage is that convenient and swift efficiency is high.

For obtaining beta-glucosidase gene of the present invention, concretely comprise the following steps:

(1) sample collecting: pedotheque picks up near Bian Shang little garden, playground, Nanjing University of Technology east.

(2) extraction of soil STb gene: weigh 1g pedotheque, adds 1mL 0.1mol/mL, pH 8.0 phosphate buffer And bead, vibrate 1min, adds lysozyme 5mg, and making lysozyme ultimate density is 2.5mg/mL, shaken at room temperature 15min, Place refrigerator 30min, centrifugal after adding 125 μ L 20%SDS oscillation treatment 15min, add phenol (1:1 volume) and extract 1 time, chloroform- Isoamyl alcohol (1:1 volume) extracts 2 times, adds 0.6 volume isopropanol, and room temperature places 1h, centrifugal, 70% ethanol purge, 30 μ L TE dissolves.

(3) genomic library of soil STb gene is built: with restricted enzyme EcoRI, STb gene is partially digested, then through fine jade Sepharose electrophoretic separation reclaim 2-3kb DNA fragmentation, with dephosphorization carrier pUC118 (BamHI/BAP) (TaKaRa, Code: D3321) after connecting, chemical conversion imports the E.coli DH5 α competent cell prepared, and builds genomic library.

Restricted enzyme EcoRI enzyme action STb gene system is: STb gene 15 μ L, 10 × buffer H 3 μ L, EcoRI 3 μ L, Add distilled water and be adjusted to cumulative volume 30 μ L.

37 DEG C of enzyme action 30min.Add 3 μ L 10 × loading buffer and terminate endonuclease reaction.Digestion products coagulates through 1.5% agarose Gel electrophoresis separates, and reclaims 2-3kb DNA fragmentation.Reclaim and carry out according to test kit description.

Endonuclease bamhi and the connection of dephosphorization carrier pUC118 (BamHI/BAP):

1 μ L pUC118 (BamHI/BAP) carrier DNA is transferred in sterile eppendorf tubes, adds 6 μ L STb gene EcoRI enzyme action reclaims fragment, adds water to 8.5 μ L, makes the cohesive end again annealed unwind, by mixture in 45 DEG C of 5min that heat It is cooled to 0 DEG C.It is subsequently adding 1 μ L 10 × T₄DNA ligase buffer, 0.5 μ L T₄DNA ligase.16 DEG C connect anti- Answer more than 12h.

(4) enzyme connects the conversion of product and obtains positive colony: 10 μ L enzymes are connected product and joins 200 μ L after thawed on ice E.coli DH5 α competent cell in, ice bath 30min, in 42 DEG C of water-baths after heat shock 90s, be quickly transferred to ice bath Middle cooling 1～2min, adds 800 μ L LB liquid medium in often pipe, 37 DEG C of shaking table 80-90rpm incubation 45min, Recovery cell.4000rpm is centrifuged 3min, remains 200 μ L competent cells and coats containing 8mM pNPG and 100mg/l On the LB agar plate of ampicillin, flat-plate inverted is placed in 37 DEG C of incubators and cultivates, and occurs bacterium colony after 12-16h, selects there is sky So clone of variable color, is positive colony containing beta-glucosidase gene fragment, is numbered positive colony simultaneously. Choose single colony inoculation in 5mL LB liquid tube, upgrading grain checking after growing bacteria suspension.

(5) order-checking of positive colony plasmid, acquisition beta-glucosidase nucleotide sequence: the survey of the sub-Insert Fragment of positive colony are extracted Sequence entrusts Nanjing Genscript Biotechnology Co., Ltd. to complete.Sequencing primer is specificity on pUC118 (BamHI/BAP) carrier Primer, and design primer according to two ends sequencing result, until being surveyed by whole Insert Fragment logical.

Sequence order-checking completed is compared in ncbi database, and utilizes ORF finder instrument to identify Insert Fragment institute The ORF contained.

(6) design of primer and synthesis: designing PCR primer according to the gene order of sequencing result, design of primers is as follows:

Design length is the primer of about 50mer, and this primer is divided into two parts, and the Part I of P1 is that upstream vector end is same Source sequence, Part II is gene specific forward extension increasing sequence.The Part I of P2 is the reverse extension increasing sequence of gene specific, Part II is downstream vector terminal homologous sequence.

PCR is utilized to carry out beta-glucosidase gene amplification, in 50 μ L reaction systems, the addition of two primers of P1, P2 Being 1 μ L, amplification condition is: 94 DEG C of preheating 10min；94 DEG C, 45s；60 DEG C, 45s；72 DEG C, 2.5min；72 DEG C, 10min, Middle three steps totally 30 circulations, the archaeal dna polymerase of use is 2 × Phanta^@Master Mix enzyme (Nuo Weizan company, China).

After PCR terminates, 1.5% agarose gel reclaims fragment, measures concentration.Simultaneously for expression vector pET-28a (+) with limit Property restriction endonuclease EcoRI linearization for enzyme restriction, 1.5% agarose gel reclaim fragment, measure concentration.Calculate the suitableeest cloning vehicle usage amount (=0.02 × cloning vehicle base logarithm) ng and the suitableeest Insert Fragment usage amount (=0.04 × Insert Fragment base logarithm) ng (example As, when the Insert Fragment of a length of 2kb is cloned into the cloning vehicle of a length of 5kb, the suitableeest usage amount of cloning vehicle should be: 0.02 × 5000=100ng；The suitableeest usage amount of Insert Fragment should be: 0.04 × 2000=80ng).Utilize One Step Cloning Kit Test kit (Nuo Weizan company) carries out recombining reaction.It is transformed in DH5 α competence after 37 DEG C of reaction 30min.Obtain length For the positive colony of the SEQ ID NO:1 sequence of 2775bp, it is the beta-glucosidase gene of the present invention.

Present invention also offers a kind of recombinant vector, described recombinant vector contains above-mentioned beta-glucosidase gene.

Present invention also offers a kind of host cell, described host cell contains above-mentioned recombinant vector.

Described host cell can be prokaryotic cell.

Described prokaryotic cell can be E. coli BL21 (DE3).

For realizing above-mentioned technical purpose, specifically can adopt the following technical scheme that above-mentioned SEQ ID NO:1 sequence directly with former Nuclear expression carrier pET-28a (+) connect, 37 DEG C of reaction 30min.By this vector competence bacillus coli DH 5 alpha.By bacterium solution It is coated on solid LB media (2% peptone, 1% yeast powder, 1%NaCl, 1～2% containing 30 μ g/mL kanamycin mycins Agar) cultivate after obtain single bacterium colony.Picking list bacterium colony with 5mL liquid LB Tube propagation overnight, upgrading grain, carry out single double enzyme Cut checking.Choose checking correct plasmid and be transformed into E. coli BL21 (DE3).By bacterium solution coating containing 30 μ g/mL cards The solid LB media of that mycin obtains single bacterium colony after cultivating.

Present invention also offers the beta-glucosidase gene of the present invention application in producing succinic acid.

The beta-glucosidase of the present invention is a kind of novel beta-glucosidase, and it is a class application biological enzyme widely. By to the prokaryotic expression of this gene and purification, can apply in the industrialized production of this enzyme.The beta-glucosidase of the present invention The technology that need not utilize surface display or signal peptide to express just can directly make thalline utilize cellobiose, thus carries out succinic acid Production.

Accompanying drawing explanation

Fig. 1 is at E.coli BL21 (pET-28a (+) with beta-glucosidase gene of the present invention) in high efficient expression experimental program figure.

Fig. 2 is the optimum temperature curve chart of beta-glucosidase of the present invention.

The stability curve figure of the temperature of Fig. 3 position beta-glucosidase of the present invention.

Fig. 4 is the optimum pH curve chart of beta-glucosidase of the present invention.

Fig. 5 is the stability curve figure of the pH of beta-glucosidase of the present invention.

Fig. 6 is that metal ion affects block diagram to what beta-glucosidase enzyme of the present invention was lived.

Fig. 7 is that organic solvent affects block diagram to what beta-glucosidase enzyme of the present invention was lived.

Detailed description of the invention

Technical scheme is described in detail below in conjunction with accompanying drawing.Embodiment is only in order to illustrate technical scheme rather than limit System, although the present invention is described in detail with reference to preferred embodiment, it will be understood by those within the art that, can be right The technical scheme of invention is modified or equivalent, and without deviating from the spirit and scope of technical solution of the present invention, it all should be contained Cover in scope of the presently claimed invention.

If the reagent unexplained reference used by the present invention, it is purchased from Sigma-Austria's aldrich (Sigma-Aldrich) company.

The present invention relates to molecular biosciences experiment, if the most dated, all with reference to from " Molecular Cloning: A Laboratory guide " book (J. Pehanorm Brooker, D.W. Russell write, and 2002, Science Press.)

Embodiment 1 obtains beta-glucosidase gene

This example demonstrates that the method obtaining beta-glucosidase gene of the present invention.Specifically comprise the following steps that

(2) extraction of soil STb gene: weigh 1g pedotheque, adds 1mL 0.1mol/mL, pH 8.0 phosphate buffer And bead, vibrate 1min, adds lysozyme 5mg, and making lysozyme ultimate density is 2.5mg/mL, shaken at room temperature 15min, Place refrigerator 30min, centrifugal after adding 125 μ L 20%SDS oscillation treatment 15min, add phenol (1: 1 volume) and extract 1 time, chloroform -isoamyl alcohol (1: 1 volume) extracts 2 times, adds 0.6 volume isopropanol, and room temperature places 1h, centrifugal, 70% ethanol purge, 30 μ L TE dissolves.

(3) genomic library of soil STb gene is built: with restricted enzyme EcoRI, STb gene is partially digested, then Through agarose gel electrophoresis separation and recovery 2-3kb DNA fragmentation, with dephosphorization carrier pUC118 (BamHI/BAP) (TaKaRa, Code:D3321) after connecting, chemical conversion imports the E.coli DH5 α competent cell prepared, and builds genomic library.

(4) enzyme connects the conversion of product and obtains positive colony: 10 μ L enzymes are connected product and joins 200 μ L after thawed on ice E.coli DH5 α competent cell in, ice bath 30min, in 42 DEG C of water-baths after heat shock 90s.It is quickly transferred to ice bath Middle cooling 1～2min, adds 800 μ L LB liquid medium in often pipe, 37 DEG C of shaking table 80-90rpm incubation 45min, Recovery cell.4000rpm is centrifuged 3min, remains 200 μ L competent cells and coats containing 8mM pNPG and 100mg/l On the LB agar plate of ampicillin, flat-plate inverted is placed in 37 DEG C of incubators and cultivates, and occurs bacterium colony after 12-16h, selects there is sky So clone of variable color, is positive colony containing beta-glucosidase gene fragment, is numbered positive colony simultaneously. Choose single colony inoculation in 5mL LB liquid tube, upgrading grain checking after growing bacteria suspension.

(6) design of primer and synthesis: design PCR primer according to the gene order of sequencing result, utilize PCR carry out β- Alpha-glucosidase gene expands, and after PCR terminates, reclaims fragment with 1.5% agarose gel, measures concentration, i.e. obtains institute of the present invention State beta-glucosidase gene.

The amplification of embodiment 2 beta-glucosidase gene

This example demonstrates that the detailed process that beta-glucosidase gene expands.

Referring to Fig. 1, clone the beta-glucosidase gene of the present invention by PCR mode.The primer of design is as follows:

Forward primer P1:Tm=66.7,45mer；Primer sequence is as follows:

CAAATGGGTCGCGGATCCGAATTCATGAAAGTAAAATCAACATGG；

Downstream primer P2:Tm=68.7,52mer；Primer sequence is as follows:

TTGTCGACGGAGCTCGAATTCTTACTTTTTTGCCTTTTCTGTAGAGGTTGCC；

PCR is utilized to carry out beta-glucosidase gene amplification, in 50 μ L reaction systems, the addition of two primers of P1, P2 Being 1 μ L, amplification condition is: 94 DEG C of preheating 10min；94 DEG C, 45s；55 DEG C, 45s；72 DEG C, 2.5min；72 DEG C, 10min, Middle three steps totally 30 circulations, the archaeal dna polymerase of use is 2 × Phanta^@Master Mix enzyme (Nuo Weizan company, China).

After PCR terminates, 1.5% agarose gel reclaims fragment, measures concentration.Calculate the suitableeest cloning vehicle usage amount (=0.02 × gram Grand carrier base logarithm) ng and the suitableeest Insert Fragment usage amount (=0.04 × Insert Fragment base logarithm) ng, utilize One Step Cloning Kit test kit (Nuo Weizan company) carries out recombining reaction.It is transformed in DH5 α competence after 37 DEG C of reaction 30min. Obtain the positive colony of a length of 2775bp, be the beta-glucosidase gene of the present invention, its nucleotide sequence such as SEQ ID Shown in NO:1.

Embodiment 3 beta-glucosidase gene is at expression in escherichia coli

By above-mentioned SEQ ID NO:1 sequence directly with prokaryotic expression carrier pET-28a (+) be connected, 37 DEG C are reacted 30min.Should Vector competence DH5 α.By the bacterium solution coating solid LB media containing 30 μ g/mL ampicillin, (mass fraction is joined Fang Wei: 2% peptone, 1% yeast powder, 1%NaCl, 1～2% agar) cultivate after obtain single bacterium colony.Picking list bacterium colony 5mL Liquid LB Tube propagation overnight, upgrading grain, carry out the checking of single double digestion.Choose checking correct plasmid and be transformed into E. coli BL21(DE3).Single bacterium colony is obtained after being cultivated by the bacterium solution coating solid LB media containing 30 μ g/mL ampicillin.Again Picking list bacterium colony with 5mL liquid LB Tube propagation overnight, upgrading grain, carry out the checking of single double digestion, choose the bacterium that checking is correct Falling, be inoculated in 50mL LB liquid medium (2% peptone, 1% yeast powder, 1%NaCl), 37 DEG C of shaking tables are cultivated, Until bacterial concentration reaches OD₆₀₀When being 0.6～0.8, with the isopropyl-β-D-thiogalactoside (IPTG) of final concentration of 0.3mM Carry out abduction delivering, 25 DEG C, 150rpm, induces 20h.

The purification of embodiment 4 beta-glucosidase

Culture fluid embodiment 3 finally obtained is at 4 DEG C, and 8000rpm is centrifuged 10min and obtains thalline, with the 50mM of pre-cooling Tris-HCl buffer (PH=8.5) washs three times, finally resuspended with the 100mMTris-HCl buffer (PH=8.5) of pre-cooling. Ultrasonication obtains just enzyme liquid, and at 4 DEG C, 12000rpm is centrifuged 30min, the supernatant being centrifuged with filtering with microporous membrane, uses Ni-Agarose pillar is purified into destination protein.Preserve liquid with albumen after being dialysed by destination protein to save.

The enzyme kinetic properties analysis of embodiment 5 beta-glucosidase

Beta-glucosidase dynamical property analysis main substrate is pNPG.Reaction uses the system in embodiment 4.Main mensuration The enzyme K to substrate_mWith maximum reaction velocity V_max.That is, under conditions of temperature, pH and enzyme concentration are constant, substrate is dense Spend the speed to enzymatic reaction to have a great impact.When concentration of substrate is the lowest, the speed (v) of enzymatic reaction is with concentration of substrate Increase and increase sharply；Along with the continuation of concentration of substrate increases, the increase of response speed starts to slow down；When concentration of substrate increases to Time to a certain degree, response speed reaches a ultimate value (V_max)。

Concentration of substrate can use Michaelis-Menten equation to represent with this relation of response speed:

v = \frac{V_{\max} [S]}{K_{m} + [S]}

In formula: v-response speed；K_m-Michaelis constant；V_max-enzyme reaction maximal rate；[S]-concentration of substrate.

Linewaver-Burk graphing method is used to measure K_m、V_max, this method is the form reciprocal according to Michaelis-Menten equation, with 1/v pair 1/ [S] maps, and obtains straight line.Straight line intercept on transverse axis is-1/K_m, vertical intercept is 1/V_max, obtain K_mWith V_max.Described equation is as follows:

\frac{1}{v} = \frac{K_{m}}{V_{m a x}} \cdot \frac{1}{[S]} + \frac{1}{V_{m a x}}

Here our concentration of substrate used is: pNPG (from 0.5mM to 8mM).Obtained result such as table 1 Shown in.

Table 1

The Analysis of The Physiological And Biochemical Properties of embodiment 6 beta-glucosidase

The liquid of protease preserved in embodiment 4 is done specific Analysis of The Physiological And Biochemical Properties.This process is in following enzyme reaction system In carry out: 100mM Tris-HCl buffer (pH=8.5) of 80 μ L adds the pNPG substrate of the 8mM of 100 μ L, After 40 DEG C of preheating 2min, add the enzyme liquid that 20 μ L suitably dilute and start reaction, at 40 DEG C, react 10min, add 100 μ L The Na of 0.5M₂CO₃Terminate reaction.Then at 405nm, measure the burst size of paranitrophenol.Here we define necessarily The enzyme of quantity is 1U at the vigor of the paranitrophenol of catalysis per minute 1 μM.The protein concentration of beta-glucosidase is to use Micro-Spectrophotometer K5500 analyzes.

The physio-biochemical characteristics that we analyze mainly have an optimum temperature of enzyme, the temperature stability of enzyme, the optimum pH of enzyme, pH's Stability, the impact that enzyme is lived by metal ion, the impact that enzyme is lived by organic solvent.In figure relative activity refer at optimum temperature and Measure the enzyme that obtains under the conditions of optimum pH to live, as the benchmark of 100%, record under the conditions of other activity compare therewith thus To ratio be the relative activity under the conditions of this.

When the temperature of the optimal reaction of studying enzyme, the temperature of reaction is from the beginning of 20 DEG C, every 10 DEG C, until 80 DEG C.Often Individual system is done 3 and is repeated test (following each reaction be 3 times repeat), result of study as in figure 2 it is shown, it can be seen that The beta-glucosidase of the present invention 20-50 DEG C have high enzyme live, wherein optimum temperature is 40 DEG C, temperature more than 50 DEG C time Wait enzyme activity rapid decrease, more than 60 DEG C after substantially do not have enzyme live.

When the temperature stability of studying enzyme, mainly mensuration enzyme is at 20,30,40 and 50 DEG C of these four treatment of different temperature enzyme liquid, Then measuring the residual activity of enzyme under optimum temperature, result of study is as it is shown on figure 3, it can be seen that the β-Fructus Vitis viniferae of the present invention The growth over time of glycosidase enzyme activity is gradually lowered.Under the conditions of 20 DEG C, enzyme is lived the most stable, and under the conditions of 30-40 DEG C, vigor is successively Declining, in the case of 50 DEG C, enzyme stability is rapidly reduced to inactive.Visible relatively low temperature is more suitable for preserving this enzyme.

When the optimum pH of studying enzyme, select different buffer, mainly have citric acid-trisodium citrate buffer (0.1M, PH4.0-6.0), phosphate buffer (0.1M, pH6.0-8.0), Tris-HCl buffer (0.05M, pH8.0-9.0), Glycine-NaOH buffer (0.05M, pH8.5-10.0)；Result of study as shown in Figure 4, it can be seen that different pH Having an impact enzyme activity, under pH is in sour environment, enzyme activity is relatively low.Wherein optimum pH is 8.5, and this enzyme is at alkalescence ring There is more preferable enzyme activity than under sour environment under border.

When the pH stability of studying enzyme, be first by enzyme in different pH buffer, at 4 DEG C process 24h, then exist The residual activity of enzyme is measured under optimum pH；Result of study is as it is shown in figure 5, it can be seen that this enzyme is in the basic conditions than acid Under the conditions of property more stable and best at optimum pH stability inferior.

In the impact that enzyme is lived by metal ion, organic solvent is to be processed with different influence factors, then by enzyme the impact that enzyme is lived The residual activity of enzyme is measured in the optimal reaction system of enzyme.Result of study as Figure 6-Figure 7, it can be seen that base This all of metal ion has activation to this enzyme, wherein Fe²⁺Activation the most obvious；Except SDS in organic solvent With Tritonx-100, this enzyme being had activation, other organic reagents all play inhibitory action, and the inhibitory action of carbamide is the strongest.

Experiments verify that, enzyme is at 40 DEG C, and during pH8.5, activity is the highest.

Embodiment 7

The present embodiment describes beta-glucosidase gene application in producing succinic acid by experiment, and β-Fructus Vitis viniferae of the present invention is described Glycosidase is applied to the superiority of industrialized production.

The step using beta-glucosidase gene of the present invention production succinic acid is specific as follows:

(1) build plasmid pTrc99a-bglB, import in bacillus coli DH 5 alpha competence.

The wherein acquisition methods of beta-glucosidase gene (bglB).Specifically comprise the following steps that

1. sample collecting: pedotheque picks up near Bian Shang little garden, playground, Nanjing University of Technology east.

2. the extraction of soil STb gene: weigh 1g pedotheque, adds 1mL 0.1mol/mL, pH 8.0 phosphate buffer and glass Glass pearl, vibrate 1min, adds lysozyme 5mg, and making lysozyme ultimate density is 2.5mg/mL, shaken at room temperature 15min, Place refrigerator 30min, centrifugal after adding 125 μ L 20%SDS oscillation treatment 15min, add phenol (1: 1 volume) and extract 1 time, chloroform -isoamyl alcohol (1: 1 volume) extracts 2 times, adds 0.6 volume isopropanol, and room temperature places 1h, centrifugal, 70% ethanol purge, 30 μ L TE dissolves.

3. the genomic library of soil STb gene is built: with restricted enzyme EcoRI, STb gene is partially digested, then through fine jade Sepharose electrophoretic separation reclaim 2-3kb DNA fragmentation, with dephosphorization carrier pUC118 (BamHI/BAP) (TaKaRa, Code: D3321) after connecting, chemical conversion imports the E.coli DH5 α competent cell prepared, and builds genomic library.

4. enzyme connects the conversion of product and obtains positive colony: 10 μ L enzymes are connected product and joins 200 μ L after thawed on ice In E.coli DH5 α competent cell, ice bath 30min, in 42 DEG C of water-baths after heat shock 90s.It is quickly transferred in ice bath Cooling 1～2min, adds 800 μ L LB liquid medium, 37 DEG C of shaking table 80-90rpm incubation 45min in often pipe, answers Soviet Union's cell.4000rpm is centrifuged 3min, remains 200 μ L competent cells and coats containing 8mM pNPG and 100mg/l ammonia On the LB agar plate of benzylpcnicillin, flat-plate inverted is placed in 37 DEG C of incubators and cultivates, and occurs that bacterium colony, selection have natural after 12-16h The clone of variable color, is positive colony containing beta-glucosidase gene fragment, is numbered positive colony simultaneously. Choose single colony inoculation in 5mL LB liquid tube, upgrading grain checking after growing bacteria suspension.

5. the order-checking of positive colony plasmid, acquisition beta-glucosidase nucleotide sequence: the order-checking of the sub-Insert Fragment of positive colony are extracted Nanjing Genscript Biotechnology Co., Ltd. is entrusted to complete.Sequencing primer is that on pUC118 (BamHI/BAP) carrier, specificity draws Thing, and design primer according to two ends sequencing result, until being surveyed by whole Insert Fragment logical.

6. the beta-glucosidase gene of the present invention is cloned by PCR mode.The primer of design is as follows:

Forward primer P1:Tm=66,40mer；Primer sequence is as follows:

GCCTGCAGGTCGACTCTAGATTACTTTTTTGCCTTTTCTG；

Downstream primer P2:Tm=63,40mer；Primer sequence is as follows:

GGAAACAGACCATGGAATTCGTGAAAGTAAAATCAACATG；

After PCR terminates, 1.5% agarose gel reclaims fragment, measures concentration.Simultaneously for expression vector pTrc99a with restricted Restriction endonuclease EcoRI and XbaI enzyme cutting linearisation, 1.5% agarose gel reclaims fragment, measures concentration.Calculate the suitableeest cloning vehicle to make Consumption (=0.02 × cloning vehicle base logarithm) ng and the suitableeest Insert Fragment usage amount (=0.04 × Insert Fragment base logarithm) ng, One Step Cloning Kit test kit (Nuo Weizan company) is utilized to carry out recombining reaction.It is transformed into after 37 DEG C of reaction 30min In DH5 α competence.

(2) extract plasmid, after checking plasmid is correct, correct plasmid is imported in escherichia coli suc260 competence, continue Checking, completes strain construction suc260-pTrc99a-bglB.

(3) with bacterium suc260-pTrc99a for comparison bacterium, anaerobic fermentation is carried out.First overnight growth in 5mL LB test tube, then Being transferred in the shaking flask of 50mL LB, 37 DEG C, 200rpm grows, to OD₆₀₀IPTG induction when being 0.6～0.8, the denseest Degree is 0.3mM；25 DEG C, 150rpm cultivates 6～8h.3 times are washed in order to wash with pure water after collecting bacterium solution with centrifuge tube Fall original LB culture medium.Finally with pure water resuspended bacterium mud, make final OD₅₅₀Control about 4, then add in serum bottle Entering bacterium solution, inoculum concentration is 10%, and wherein, the culture medium in serum bottle is AM1 culture medium, and sole carbon source is the fiber of 30g/L Disaccharide, liquid amount is 30mL.CO is used before inoculation₂Gas mixes the cellobiose in culture medium and basic magnesium carbonate in advance, about Mixing 1min, then inoculates, again leads to CO after taking first sample in each serum bottle₂Gas, it is therefore an objective to be bacterium solution and cultivation Base fully mixes and ensures anaerobic state.37 DEG C, 180rpm cultivates.Cultivation takes whole sample after terminating.After testing, tunning The mass yield of middle succinic acid is 0.85g/g (i.e. the succinic acid yield to cellobiose).

Sequence table

<110>Nanjing University of Technology

<120>a kind of beta-glucosidase gene and application thereof

<130> xb16061401

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 2730

<212> DNA

<213> Artificial Sequence

<220>

<223> 1

<220>

<221> CDS

<222> (1)..(2730)

<400> 1

gtg aaa gta aaa tca aca tgg ttg ttc cgt atg gtg atg atg aca gtc 48

Val Lys Val Lys Ser Thr Trp Leu Phe Arg Met Val Met Met Thr Val

1 5 10 15

att gcg gct gtt gtg atc gga cct atg cat att gca gga gcg gca gga 96

Ile Ala Ala Val Val Ile Gly Pro Met His Ile Ala Gly Ala Ala Gly

20 25 30

agc cgg aca gat cgg cct tgg atg aac acg tcc ctg tcg gct gag aaa 144

Ser Arg Thr Asp Arg Pro Trp Met Asn Thr Ser Leu Ser Ala Glu Lys

35 40 45

cgg aca gca ttg ctg tta caa gaa atg acg ctg gaa gaa aaa ata gat 192

Arg Thr Ala Leu Leu Leu Gln Glu Met Thr Leu Glu Glu Lys Ile Asp

50 55 60

ctg gtg act ggt aag gtc aac aat tat tat gga ttt tat aat aat tcg 240

Leu Val Thr Gly Lys Val Asn Asn Tyr Tyr Gly Phe Tyr Asn Asn Ser

65 70 75 80

atg gag cgg ttg ggt att cca gcg tta aag atg gca gat gga cct gcg 288

Met Glu Arg Leu Gly Ile Pro Ala Leu Lys Met Ala Asp Gly Pro Ala

85 90 95

ggt gtg cgg atc gcc aat ccg gat gtg cag gac aag caa tca act gcg 336

Gly Val Arg Ile Ala Asn Pro Asp Val Gln Asp Lys Gln Ser Thr Ala

100 105 110

ttg ccg gcc cct att gca ctg gcc gca acc tgg gat acc caa gct gcc 384

Leu Pro Ala Pro Ile Ala Leu Ala Ala Thr Trp Asp Thr Gln Ala Ala

115 120 125

aaa cag tat gga gat ttg ctt gga gac gag gct ttt aat aca act cat 432

Lys Gln Tyr Gly Asp Leu Leu Gly Asp Glu Ala Phe Asn Thr Thr His

130 135 140

aat gtg gtg ctt gga ccg ggg atg gat att gcc cgt att cca tgg gga 480

Asn Val Val Leu Gly Pro Gly Met Asp Ile Ala Arg Ile Pro Trp Gly

145 150 155 160

tcg agg aac ttt gaa tct atg ggc gag gac ccg cta ctg caa tcg caa 528

Ser Arg Asn Phe Glu Ser Met Gly Glu Asp Pro Leu Leu Gln Ser Gln

165 170 175

atg gcg acc gct tat gtc aaa ggt gta caa agc cac cct gtc ttg gcg 576

Met Ala Thr Ala Tyr Val Lys Gly Val Gln Ser His Pro Val Leu Ala

180 185 190

act gcg aaa cat tac ctt atg aat aat cag gag acg gag cgt ttc acg 624

Thr Ala Lys His Tyr Leu Met Asn Asn Gln Glu Thr Glu Arg Phe Thr

195 200 205

aca aat gtc aaa gtc agt gac cgt gcg ctg cat gaa att tac ata cgc 672

Thr Asn Val Lys Val Ser Asp Arg Ala Leu His Glu Ile Tyr Ile Arg

210 215 220

ccg ttt gag gag gct att gcc aag gca gat ttg ggc gga gct atg tgc 720

Pro Phe Glu Glu Ala Ile Ala Lys Ala Asp Leu Gly Gly Ala Met Cys

225 230 235 240

tcc ttt aac aag gtc aac ggc gaa tcg gca tgt gag aac aag acc atc 768

Ser Phe Asn Lys Val Asn Gly Glu Ser Ala Cys Glu Asn Lys Thr Ile

245 250 255

ctg aca gac ctt ttg aaa aag gaa atg caa ttc aag ggt ttc gtg atg 816

Leu Thr Asp Leu Leu Lys Lys Glu Met Gln Phe Lys Gly Phe Val Met

260 265 270

agt gat tat ggc gcg aat ctg agt aca gtc gaa tcg gca aat agc ggc 864

Ser Asp Tyr Gly Ala Asn Leu Ser Thr Val Glu Ser Ala Asn Ser Gly

275 280 285

ttg gac ctg gaa aca ccg gga acc cct tat ggt aaa tgg gga gat caa 912

Leu Asp Leu Glu Thr Pro Gly Thr Pro Tyr Gly Lys Trp Gly Asp Gln

290 295 300

ctg ctg gat gcg gtc aag act ggt aaa gta agt gaa caa acg att gat 960

Leu Leu Asp Ala Val Lys Thr Gly Lys Val Ser Glu Gln Thr Ile Asp

305 310 315 320

gat aag gct aag cgt att ctg gtg cag atg ttc agt aaa ggt ttg ttt 1008

Asp Lys Ala Lys Arg Ile Leu Val Gln Met Phe Ser Lys Gly Leu Phe

325 330 335

gat cac ccg gct caa aat aat caa att gat gcc cgt gac cat ggt aaa 1056

Asp His Pro Ala Gln Asn Asn Gln Ile Asp Ala Arg Asp His Gly Lys

340 345 350

aca gcc cgt caa ttg gct gag gaa agt atg gtg ctg ctt caa aat aaa 1104

Thr Ala Arg Gln Leu Ala Glu Glu Ser Met Val Leu Leu Gln Asn Lys

355 360 365

aac aac gta tta ccg ttg tct caa gat aaa ctc aaa tcc att gct gta 1152

Asn Asn Val Leu Pro Leu Ser Gln Asp Lys Leu Lys Ser Ile Ala Val

370 375 380

att ggt cca gat gca gat aac ggc acc gtg gca ggc gga ggc agt tcg 1200

Ile Gly Pro Asp Ala Asp Asn Gly Thr Val Ala Gly Gly Gly Ser Ser

385 390 395 400

ttg gtg aac ccg acg tac acg gtg agt ccg ctg gag ggc att cgt aat 1248

Leu Val Asn Pro Thr Tyr Thr Val Ser Pro Leu Glu Gly Ile Arg Asn

405 410 415

cgt gta ggc aaa gga gtt acc gtc cag tat gca ccg ggc acg gat cct 1296

Arg Val Gly Lys Gly Val Thr Val Gln Tyr Ala Pro Gly Thr Asp Pro

420 425 430

att tct gcg ggg gac att atg cca ggt cca tca gct gtt cca tct tcg 1344

Ile Ser Ala Gly Asp Ile Met Pro Gly Pro Ser Ala Val Pro Ser Ser

435 440 445

ttg ctg acc aca tcc gat cag aag gag aat atc agt gtt gga tat gcg 1392

Leu Leu Thr Thr Ser Asp Gln Lys Glu Asn Ile Ser Val Gly Tyr Ala

450 455 460

act tat ggc gat gct gag cag gga ctg cga ggc gaa tac tgg aag aat 1440

Thr Tyr Gly Asp Ala Glu Gln Gly Leu Arg Gly Glu Tyr Trp Lys Asn

465 470 475 480

aac aag atg gaa ggc aat ccg att ctt gtg cgc aat gat gat caa gtc 1488

Asn Lys Met Glu Gly Asn Pro Ile Leu Val Arg Asn Asp Asp Gln Val

485 490 495

aat atg aac ctt ggc ttt tat aat tat cag ggc ttc aat gcg aag tcc 1536

Asn Met Asn Leu Gly Phe Tyr Asn Tyr Gln Gly Phe Asn Ala Lys Ser

500 505 510

cct aaa gtt cct aat aca ccc acg acc ctg aac ggt ttg ata tct gca 1584

Pro Lys Val Pro Asn Thr Pro Thr Thr Leu Asn Gly Leu Ile Ser Ala

515 520 525

cgc tgg aca ggg gct att gca gct ccc aag gat ggt gac tat gca ttg 1632

Arg Trp Thr Gly Ala Ile Ala Ala Pro Lys Asp Gly Asp Tyr Ala Leu

530 535 540

tca tta acc agt ttg gga tca agc aag ctg tat ctt gat gat aag cta 1680

Ser Leu Thr Ser Leu Gly Ser Ser Lys Leu Tyr Leu Asp Asp Lys Leu

545 550 555 560

ttt gta gat aat cag ggt acg aag ctg gaa aca acg aag aaa aac atc 1728

Phe Val Asp Asn Gln Gly Thr Lys Leu Glu Thr Thr Lys Lys Asn Ile

565 570 575

tcg ttc aaa gcg ggg gaa aaa cat aag ata cgt att gaa tat cgt gcc 1776

Ser Phe Lys Ala Gly Glu Lys His Lys Ile Arg Ile Glu Tyr Arg Ala

580 585 590

gat tat cca aca aat ggt cgc gat tct ggc ggt atg gtt cgt ctg ggc 1824

Asp Tyr Pro Thr Asn Gly Arg Asp Ser Gly Gly Met Val Arg Leu Gly

595 600 605

tgg gag cct ccg gca gat acg aca gac aag ctg att gac aat gct gta 1872

Trp Glu Pro Pro Ala Asp Thr Thr Asp Lys Leu Ile Asp Asn Ala Val

610 615 620

aag ctg gcc aaa aaa tcg gat gtt gcg att gtg gtc acg cgt acg tat 1920

Lys Leu Ala Lys Lys Ser Asp Val Ala Ile Val Val Thr Arg Thr Tyr

625 630 635 640

gag agt gaa ggc tat gtg gag cgt tcc gat atg gag ctg cca aac aat 1968

Glu Ser Glu Gly Tyr Val Glu Arg Ser Asp Met Glu Leu Pro Asn Asn

645 650 655

cag gat cgg ctg atc cgt gcg gtt gcc gct gcc aat ccg aaa acc att 2016

Gln Asp Arg Leu Ile Arg Ala Val Ala Ala Ala Asn Pro Lys Thr Ile

660 665 670

gtg gta caa atg agc ggc aga gct gtg caa atg gac acc tgg cag gac 2064

Val Val Gln Met Ser Gly Arg Ala Val Gln Met Asp Thr Trp Gln Asp

675 680 685

aaa gtt cct gcg atc gta cag gca tgg ttt gct ggt caa gag caa ggg 2112

Lys Val Pro Ala Ile Val Gln Ala Trp Phe Ala Gly Gln Glu Gln Gly

690 695 700

aat gcc ata gcg cgc gtc ttg ttt ggg gat gta aat cct tct ggc aag 2160

Asn Ala Ile Ala Arg Val Leu Phe Gly Asp Val Asn Pro Ser Gly Lys

705 710 715 720

cta ccg gta acc ttc ccg gtt aac gag cag tct aca cct gta tcc tca 2208

Leu Pro Val Thr Phe Pro Val Asn Glu Gln Ser Thr Pro Val Ser Ser

725 730 735

ccg gag aaa ttt ccg ggt gtc aat gga gtg ggt gac tat tca gat ggt 2256

Pro Glu Lys Phe Pro Gly Val Asn Gly Val Gly Asp Tyr Ser Asp Gly

740 745 750

att ttt gta ggc tac cgt gga tat gaa aaa tcg ggt atc caa cct gcg 2304

Ile Phe Val Gly Tyr Arg Gly Tyr Glu Lys Ser Gly Ile Gln Pro Ala

755 760 765

ttc tcc ttt gga cac ggt tta tcc tac acg act ttc gga tac agt gat 2352

Phe Ser Phe Gly His Gly Leu Ser Tyr Thr Thr Phe Gly Tyr Ser Asp

770 775 780

ttg aag gta aaa cag cat gcg agt gga aag aaa tcc gat cgt aca agt 2400

Leu Lys Val Lys Gln His Ala Ser Gly Lys Lys Ser Asp Arg Thr Ser

785 790 795 800

tca gtc gag gtt tcg ctt aaa ttg aaa aac act ggg aaa aaa gct gga 2448

Ser Val Glu Val Ser Leu Lys Leu Lys Asn Thr Gly Lys Lys Ala Gly

805 810 815

gct gag gtt gta cag gta tac agc ggt aag ctc ccg acc aat gta gag 2496

Ala Glu Val Val Gln Val Tyr Ser Gly Lys Leu Pro Thr Asn Val Glu

820 825 830

acc cca tcc cgt caa ctg gca ggt tgg gcc aag gtg gaa tta aag ccg 2544

Thr Pro Ser Arg Gln Leu Ala Gly Trp Ala Lys Val Glu Leu Lys Pro

835 840 845

ggc caa gag aag aaa gtc cgc att gag ctt gac ccg aaa gct ctc tct 2592

Gly Gln Glu Lys Lys Val Arg Ile Glu Leu Asp Pro Lys Ala Leu Ser

850 855 860

tat tgg gat gaa aaa tcc aaa gca tgg gtt atg cca tct ggt gaa gtt 2640

Tyr Trp Asp Glu Lys Ser Lys Ala Trp Val Met Pro Ser Gly Glu Val

865 870 875 880

ccg att tat gta ggc agc tcc tct cag gat aca aga ctg aca gga agt 2688

Pro Ile Tyr Val Gly Ser Ser Ser Gln Asp Thr Arg Leu Thr Gly Ser

885 890 895

gtt acg att ccg gca acc tct aca gaa aag gca aaa aag taa 2730

Val Thr Ile Pro Ala Thr Ser Thr Glu Lys Ala Lys Lys

900 905

<210> 2

<211> 909

<212> PRT

<213> Artificial Sequence

<220>

<223> Synthetic Construct

<400> 2

Val Lys Val Lys Ser Thr Trp Leu Phe Arg Met Val Met Met Thr Val

1 5 10 15

Ile Ala Ala Val Val Ile Gly Pro Met His Ile Ala Gly Ala Ala Gly

20 25 30

Ser Arg Thr Asp Arg Pro Trp Met Asn Thr Ser Leu Ser Ala Glu Lys

35 40 45

Arg Thr Ala Leu Leu Leu Gln Glu Met Thr Leu Glu Glu Lys Ile Asp

50 55 60

Leu Val Thr Gly Lys Val Asn Asn Tyr Tyr Gly Phe Tyr Asn Asn Ser

65 70 75 80

Met Glu Arg Leu Gly Ile Pro Ala Leu Lys Met Ala Asp Gly Pro Ala

85 90 95

Gly Val Arg Ile Ala Asn Pro Asp Val Gln Asp Lys Gln Ser Thr Ala

100 105 110

Leu Pro Ala Pro Ile Ala Leu Ala Ala Thr Trp Asp Thr Gln Ala Ala

115 120 125

Lys Gln Tyr Gly Asp Leu Leu Gly Asp Glu Ala Phe Asn Thr Thr His

130 135 140

Asn Val Val Leu Gly Pro Gly Met Asp Ile Ala Arg Ile Pro Trp Gly

145 150 155 160

Ser Arg Asn Phe Glu Ser Met Gly Glu Asp Pro Leu Leu Gln Ser Gln

165 170 175

Met Ala Thr Ala Tyr Val Lys Gly Val Gln Ser His Pro Val Leu Ala

180 185 190

Thr Ala Lys His Tyr Leu Met Asn Asn Gln Glu Thr Glu Arg Phe Thr

195 200 205

Thr Asn Val Lys Val Ser Asp Arg Ala Leu His Glu Ile Tyr Ile Arg

210 215 220

Pro Phe Glu Glu Ala Ile Ala Lys Ala Asp Leu Gly Gly Ala Met Cys

225 230 235 240

Ser Phe Asn Lys Val Asn Gly Glu Ser Ala Cys Glu Asn Lys Thr Ile

245 250 255

Leu Thr Asp Leu Leu Lys Lys Glu Met Gln Phe Lys Gly Phe Val Met

260 265 270

Ser Asp Tyr Gly Ala Asn Leu Ser Thr Val Glu Ser Ala Asn Ser Gly

275 280 285

Leu Asp Leu Glu Thr Pro Gly Thr Pro Tyr Gly Lys Trp Gly Asp Gln

290 295 300

Leu Leu Asp Ala Val Lys Thr Gly Lys Val Ser Glu Gln Thr Ile Asp

305 310 315 320

Asp Lys Ala Lys Arg Ile Leu Val Gln Met Phe Ser Lys Gly Leu Phe

325 330 335

Asp His Pro Ala Gln Asn Asn Gln Ile Asp Ala Arg Asp His Gly Lys

340 345 350

Thr Ala Arg Gln Leu Ala Glu Glu Ser Met Val Leu Leu Gln Asn Lys

355 360 365

Asn Asn Val Leu Pro Leu Ser Gln Asp Lys Leu Lys Ser Ile Ala Val

370 375 380

Ile Gly Pro Asp Ala Asp Asn Gly Thr Val Ala Gly Gly Gly Ser Ser

385 390 395 400

Leu Val Asn Pro Thr Tyr Thr Val Ser Pro Leu Glu Gly Ile Arg Asn

405 410 415

Arg Val Gly Lys Gly Val Thr Val Gln Tyr Ala Pro Gly Thr Asp Pro

420 425 430

Ile Ser Ala Gly Asp Ile Met Pro Gly Pro Ser Ala Val Pro Ser Ser

435 440 445

Leu Leu Thr Thr Ser Asp Gln Lys Glu Asn Ile Ser Val Gly Tyr Ala

450 455 460

Thr Tyr Gly Asp Ala Glu Gln Gly Leu Arg Gly Glu Tyr Trp Lys Asn

465 470 475 480

Asn Lys Met Glu Gly Asn Pro Ile Leu Val Arg Asn Asp Asp Gln Val

485 490 495

Asn Met Asn Leu Gly Phe Tyr Asn Tyr Gln Gly Phe Asn Ala Lys Ser

500 505 510

Pro Lys Val Pro Asn Thr Pro Thr Thr Leu Asn Gly Leu Ile Ser Ala

515 520 525

Arg Trp Thr Gly Ala Ile Ala Ala Pro Lys Asp Gly Asp Tyr Ala Leu

530 535 540

Ser Leu Thr Ser Leu Gly Ser Ser Lys Leu Tyr Leu Asp Asp Lys Leu

545 550 555 560

Phe Val Asp Asn Gln Gly Thr Lys Leu Glu Thr Thr Lys Lys Asn Ile

565 570 575

Ser Phe Lys Ala Gly Glu Lys His Lys Ile Arg Ile Glu Tyr Arg Ala

580 585 590

Asp Tyr Pro Thr Asn Gly Arg Asp Ser Gly Gly Met Val Arg Leu Gly

595 600 605

Trp Glu Pro Pro Ala Asp Thr Thr Asp Lys Leu Ile Asp Asn Ala Val

610 615 620

Lys Leu Ala Lys Lys Ser Asp Val Ala Ile Val Val Thr Arg Thr Tyr

625 630 635 640

Glu Ser Glu Gly Tyr Val Glu Arg Ser Asp Met Glu Leu Pro Asn Asn

645 650 655

Gln Asp Arg Leu Ile Arg Ala Val Ala Ala Ala Asn Pro Lys Thr Ile

660 665 670

Val Val Gln Met Ser Gly Arg Ala Val Gln Met Asp Thr Trp Gln Asp

675 680 685

Lys Val Pro Ala Ile Val Gln Ala Trp Phe Ala Gly Gln Glu Gln Gly

690 695 700

Asn Ala Ile Ala Arg Val Leu Phe Gly Asp Val Asn Pro Ser Gly Lys

705 710 715 720

Leu Pro Val Thr Phe Pro Val Asn Glu Gln Ser Thr Pro Val Ser Ser

725 730 735

Pro Glu Lys Phe Pro Gly Val Asn Gly Val Gly Asp Tyr Ser Asp Gly

740 745 750

Ile Phe Val Gly Tyr Arg Gly Tyr Glu Lys Ser Gly Ile Gln Pro Ala

755 760 765

Phe Ser Phe Gly His Gly Leu Ser Tyr Thr Thr Phe Gly Tyr Ser Asp

770 775 780

Leu Lys Val Lys Gln His Ala Ser Gly Lys Lys Ser Asp Arg Thr Ser

785 790 795 800

Ser Val Glu Val Ser Leu Lys Leu Lys Asn Thr Gly Lys Lys Ala Gly

805 810 815

Ala Glu Val Val Gln Val Tyr Ser Gly Lys Leu Pro Thr Asn Val Glu

820 825 830

Thr Pro Ser Arg Gln Leu Ala Gly Trp Ala Lys Val Glu Leu Lys Pro

835 840 845

Gly Gln Glu Lys Lys Val Arg Ile Glu Leu Asp Pro Lys Ala Leu Ser

850 855 860

Tyr Trp Asp Glu Lys Ser Lys Ala Trp Val Met Pro Ser Gly Glu Val

865 870 875 880

Pro Ile Tyr Val Gly Ser Ser Ser Gln Asp Thr Arg Leu Thr Gly Ser

885 890 895

Val Thr Ile Pro Ala Thr Ser Thr Glu Lys Ala Lys Lys

900 905

Claims

1. a beta-glucosidase gene, it is characterised in that nucleotide sequence is as shown in SEQ ID NO:1.

2. a recombinant vector, it is characterised in that described recombinant vector contains the beta-glucosidase gene described in claim 1.

3. a host cell, it is characterised in that described host cell contains the recombinant vector described in claim 2.

Host cell the most according to claim 3, it is characterised in that described host cell is prokaryotic cell.

Host cell the most according to claim 4, it is characterised in that described prokaryotic cell is E. coli BL21 (DE3).