CN105950782A - Primers, kit and method for distinguishing helicoverpa armigera nucleopolyhedrovirus from autographa californica nucleopolyhedrovirus - Google Patents
Primers, kit and method for distinguishing helicoverpa armigera nucleopolyhedrovirus from autographa californica nucleopolyhedrovirus Download PDFInfo
- Publication number
- CN105950782A CN105950782A CN201610341944.4A CN201610341944A CN105950782A CN 105950782 A CN105950782 A CN 105950782A CN 201610341944 A CN201610341944 A CN 201610341944A CN 105950782 A CN105950782 A CN 105950782A
- Authority
- CN
- China
- Prior art keywords
- primers
- seq
- polyhedrosis virus
- nuclear polyhedrosis
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides multiple primers capable of quickly distinguishing helicoverpa armigera nucleopolyhedrovirus from autographa californica nucleopolyhedrovirus. The multiple primers are designed according to at least one of sequences shown in SEQ ID NO: 11-12 and at least one of sequences shown in SEQ ID NO: 13-15 respectively. The invention further provides a method and a kit for distinguishing the helicoverpa armigera nucleopolyhedrovirus from the autographa californica nucleopolyhedrovirus, and the multiple primers are applied to the method and the kit. Compared with the prior art, the primers, the method and the kit have the advantages that high specificity and accuracy are achieved, and the primers have great significance in improvement in product quality monitoring efficiency in production of biopesticide for the helicoverpa armigera nucleopolyhedrovirus and the autographa californica nucleopolyhedrovirus.
Description
Technical field
The invention belongs to field of biological detection, relate to differentiate heliothis armigera nuclear polyhedrosis virus and lucerne
Multi-primers, test kit and the method for Mu three-spotted plusia nuclear polyhedrosis virus, more particularly, to
Multiplex PCR is used to differentiate heliothis armigera nuclear polyhedrosis virus and Autographa californica nuclear polyhedral body
Multi-primers, test kit and the method for virus.
Background technology
Bollworm (Helicoverpa armigera (H ü bner)) belongs to Lepidoptera Noctuidae, is China
A kind of major economic crops insect, it is seriously caused harm Cotton Gossypii, Semen Maydis, Rhizoma Solani tuber osi, Fructus Lycopersici esculenti and Semen Tritici aestivi etc.
60 diversified economy crops, and long-term chemical pesticide control had resulted in the Drug resistance that it is serious.Therefore,
Use biological pesticide preventing and treating bollworm imperative.The baculovirus that can infect bollworm mainly has cotton boll
Worm nuclear polyhedrosis virus (Helicoverpa armigera nucleopolyhedrovirus, HaNPV),
With autographa california nuclear polyhedrosis virus (Autographa californica
Nucleopolyhedrovirus, AcNPV), both are subordinate to Rhabdoviridae Nucleopolyhedrovirus,
Being the natural pathogen of bollworm, have stronger specialization, insect is difficult to it is produced resistance；Thereafter
Effect effect is obvious, and when environmental condition is suitable for, in ill polypide, the virus of amplification is discharged into cotton bollworm population
In can cause the popular of virosis.Although both of which can infect bollworm, but its prevention effect has
Bigger difference.HaNPV, i.e. heliothis armigera nuclear polyhedrosis virus, to China's cotton boll in long-term evolution
Worm has higher population and infects advantage.HaNPV is made biological pesticide for preventing and treating bollworm,
Effect highly significant.At present, the former medicine of HaNPV and preparation are permitted achieved with agriculture chemical registration, and at home
The most it is widely applied outward.
But, during the viral organism pesticide producing with bollworm as host, bollworm caryogram is polygonal
Precursor virus and autographa california nuclear polyhedrosis virus easily produce cross-contamination, therefore, the most quickly
Differentiate that nuclear polyhedrosis virus is significant for product quality monitoring exactly.
At present, the conventional discrimination method of heliothis armigera nuclear polyhedrosis virus, main use bioassay or
Restriction fragment fragment length polymorphism is identified.Bioassary method generally uses virus to be measured to feed cotton bollworm larvae, as
Add up the mortality rate of bollworm after fruit inoculation and reach more than 80%, and same method test comparison group Radix Betae
Noctuid or Prodenia litura, then mortality rate is less than 20%, determines that Test Virus is many for bollworm caryogram with this
Angle precursor virus.But, the method for bioassay typically requires ten days and just can complete, exist excessive cycle,
The complicated shortcoming with poor accuracy of operating procedure.And Restriction fragment fragment length polymorphism identification method, difference can be differentiated
Host source or the separation strain of host NPV different regions of the same race, but still suffer from cycle length, operating procedure
Complicated and that qualification accuracy is the highest problem.And need substantial amounts of detection in biological pesticide industrialization produces
Work, therefore, above two method can not meet conventional sense.Need foundation at present badly a kind of easy
Fast, highly sensitive, reproducible detection method.
Summary of the invention
Therefore, it is an object of the invention to for the deficiencies in the prior art, it is provided that one can quickly differentiate
Heliothis armigera nuclear polyhedrosis virus and the test kit of autographa california nuclear polyhedrosis virus and method, this
The test kit of invention and method use Multiplex PCR, and it has simple and efficient, highly sensitive, repetition
Property good, low cost, flux advantages of higher.And test kit and method that the present invention provides can be once same
Time detect the multiple virus of same host, this also discriminating for heliothis armigera nuclear polyhedrosis virus provide newly
Detection means.
For above-mentioned purpose, technical scheme is as follows:
On the one hand, the present invention provides a kind of for differentiating heliothis armigera nuclear polyhedrosis virus and Autographa
The multi-primers of californica nuclear polyhedrosis virus, wherein, described multi-primers at least includes following primer pair:
According in the sequence shown in SEQ ID NO:11-12 at least one design primer to and according to
The primer pair of at least one design in the sequence shown in SEQ ID NO:13-15.
Preferably, described multi-primers at least includes according to SEQ ID NO:11 and SEQ ID NO:14
The primer pair of shown sequential design.
Wherein, described SEQ ID NO:11 is shown as the protein coding of heliothis armigera nuclear polyhedrosis virus
District's (CDS sequence), its NCBI ID is AF271059.2_cds_AAG53834.1_90, this CDS sequence
Row size is 1134bp, altogether 378 aminoacid of coding.
Wherein, described SEQ ID NO:12 is shown as the CDS sequence of heliothis armigera nuclear polyhedrosis virus,
Its NCBI ID is AF271059.2_cds_AAG53876.1_133, and this CDS sequence size is 2034bp,
678 aminoacid of coding altogether.
Wherein, described SEQ ID NO:13 is shown as the coding of autographa california nuclear polyhedrosis virus
Protein gene Ac-helicase, its NCBI ID is KM667940.1_cds_AIU56967.1_94, this base
Because size is 3666bp, 1222 aminoacid of coding altogether.
Wherein, described SEQ ID NO:14 is shown as the coding of autographa california nuclear polyhedrosis virus
Protein gene Ac-IE-1, its NCBI ID is KM667940.1_cds_AIU56990.1_142, this gene
Size is 1749bp, altogether 583 aminoacid of coding.
Wherein, described SEQ ID NO:15 is shown as the coding of autographa california nuclear polyhedrosis virus
Protein gene Ac-gp64, its NCBI ID is KM667940.1_cds_AIU56980.1_123, this gene
Size is 2073bp, altogether 691 aminoacid of coding.
Preferably, described multi-primers includes according to the sequential design as shown in SEQ ID NO:11-15
Five pairs of specific primers.
Preferably, described multi-primers include as SEQ ID NO:1 and 2, SEQ ID NO:3 and 4,
SEQ ID NO:5 and 6, SEQ ID NO:7 and 8 and drawing shown in SEQ ID NO:9 and 10
At least the two of thing centering are right.
Preferably, described multi-primers includes five pairs of primers as shown in SEQ ID NO:1-10.
Another further aspect, the present invention provides a kind of for differentiating heliothis armigera nuclear polyhedrosis virus and Herba Medicaginis silver
The method of Autographa spp nuclear polyhedrosis virus, described method is multiple PCR method, and it uses the present invention's
Multi-primers.
Specifically, the method for the present invention comprises the following steps:
1) DNA of testing sample is extracted, as DNA profiling；
2) multi-primers and the polymerase chain reaction reagent of the present invention are used, enterprising in PCR amplification instrument
Row multiplex PCR；
3) product obtaining amplification carries out electrophoresis discriminating.
Preferably, method of the present invention can be one-step method multiple PCR method.
In a preferred embodiment, the reaction condition of this PCR is as follows:
After 95 DEG C of denaturations 10min, expand 30 circulations (cycling condition: 95 DEG C 30 seconds, 56 DEG C
30 seconds, 72 DEG C 1 minute), finally extend 5 minutes.
The PCR primer obtaining amplification carries out the agarose gel electrophoresis of concentration 1%.
Preferably, in step 2) in, described polymerase chain reaction reagent include PCR buffer,
The multi-primers compositions of dNTP, Taq enzyme and the application.
On the other hand, the present invention provides a kind of for differentiating heliothis armigera nuclear polyhedrosis virus and Herba Medicaginis silver
The test kit of Autographa spp nuclear polyhedrosis virus, described test kit includes: be used for extracting testing sample
The reagent of DNA；And the reagent for multiplex PCR.
Preferably, described multiplex PCR reagent includes multi-primers and the polymerase chain reaction of the present invention
Conventional reagent.
Another further aspect, the present invention provides a kind of for differentiating heliothis armigera nuclear polyhedrosis virus and Herba Medicaginis silver
The test kit of Autographa spp nuclear polyhedrosis virus is differentiating heliothis armigera nuclear polyhedrosis virus and Autographa
Application in californica nuclear polyhedrosis virus.
The present invention compared with prior art, has the advantage that
1) the PCR discrimination method that the present invention provides has specificity and the accuracy of height.
2) conventional viral discrimination method such as bioassary method needs 10 day time, and enzyme action is identified needs 3-5
It time, and the PCR method of the application only needs a few hours.
3) present invention use one-step method multi-PCR detection method, by PCR buffer, Taq enzyme,
DNTP, Primer composition blend together Ha&Ac one-step PCR Mix in advance, multiple enzyme proportioning are mixed,
Make reactant liquor preparation the most simple and convenient, shorten the operating time, avoid operational pollution simultaneously.
4) method of the present invention is easy and simple to handle, sensitivity good, convenient and swift.
5) present invention be used for differentiate that heliothis armigera nuclear polyhedrosis virus and Autographa californica nuclear are polygonal
Precursor virus multiple PCR detection kit, at heliothis armigera nuclear polyhedrosis virus and autographa california core
The monitoring efficiency improving product quality in the production of type polyhedrosis virus biological pesticide is significant.
Accompanying drawing explanation
Hereinafter, describe embodiment of the present invention in detail in conjunction with accompanying drawing, wherein:
Accompanying drawing explanation
Fig. 1 is the agarose gel electrophoresis result using the multi-primers of the present invention to carry out PCR, from this
In result, we may determine that and learn, testing sample had both contained earworm nuclear polyhedrosis virus (HaNPV,
695bp, 972bp), contain again autographa california nuclear polyhedrosis virus (AcNPV, 312bp,
1126bp, 1222bp).
Fig. 2 is to use traditional restriction endonuclease reaction to differentiate heliothis armigera nuclear polyhedrosis virus and Herba Medicaginis silver
The result of Autographa spp nuclear polyhedrosis virus.
Detailed description of the invention
Heliothis armigera nuclear polyhedrosis virus used in the present invention and Autographa californica nuclear polyhedron disease
Poison sample is from Institute of Zoology, Academia Sinica.
Prepared by embodiment 1DNA template
1) learn from else's experience respectively the heliothis armigera nuclear polyhedrosis virus of purification and Autographa californica nuclear polyhedral body
Virus sample 1g, and the DNA profiling of two-strain is prepared respectively according to following steps
2) in described sample, it is separately added into alkali solution liquid (0.15M NaCl, 0.1M Na2CO3, 0.5M
EDTA, pH8.0) 750 microlitres, at 37 DEG C, 1 hour；
3) HCl adding 0.1N adjusts pH to 8.0, adds SDS to final concentration of 0.5%, adds egg
White enzyme K (20mg/ml) to final concentration 0.25mg/ml, 37 DEG C of 2h, 65 DEG C of 2h；
4) add equal amounts of chloroform iso pentane alcohol mixture (chloroform: isoamyl alcohol=24:1) and extract 1 time, 12000
Rpm/min, centrifugal 5min；
5) gentle aspiration upper strata aqueous phase, is placed in new centrifuge tube, adds equal amounts of chloroform, 12000rpm
/ min, centrifugal 5min；
6) take upper strata aqueous phase and proceed in new pipe, after adding 2 times of volume dehydrated alcohol mixings, 10000
Rpm/min is centrifuged 10min；
7) abandoning supernatant, precipitates and uses 70% washing with alcohol, and 10000rpm/min is centrifuged 10min；
8) again remove supernatant, allow the DNA of precipitation be dried at room temperature for；
9) add 100 microliters of water dissolving DNAs, thus obtain sample DNA.
Embodiment 2 design of primers synthesizes
In the application, respectively with two albumen coded sequence (NCBI of heliothis armigera nuclear polyhedrosis virus
ID:AF271059.2_cds_AAG53834.1_90 and NCBI ID:
AF271059.2_cds_AAG53876.1_133), in autographa california nuclear polyhedrosis virus genome
Ac-helicase gene (NCBI ID:KM667940.1_cds_AIU56967.1_94), Ac-IE-1
Gene (NCBI ID:KM667940.1_cds_AIU56990.1_142) and Ac-gp64 gene (NCBI
ID:KM667940.1_cds_AIU56980.1_123) design specific primer carries out PCR amplification,
To realize detection to two kinds of baculoviruss with bollworm as host simultaneously.
Primer to (by Tian Yihuiyuan bio tech ltd, Beijing synthesize), PAGE level purification, in detail
Sequence is shown in Table 1.
Table 1PCR primer sequence
| Sequence names | Primer | Sequence (5'to3') | Base number |
| SEQ ID NO:1 | The forward primer of SEQ ID NO:11 | TGCGTCGAAACCATAAAGAACAA | 23 |
| SEQ ID NO:2 | The reverse primer of SEQ ID NO:11 | GGTGCCGCGTCCAAATAGTGA | 21 |
| SEQ ID NO:3 | The forward primer of SEQ ID NO:12 | AGCGCCAAATACAATCGTCTCAGT | 24 |
| SEQ ID NO:4 | The reverse primer of SEQ ID NO:12 | CCAACCGCTAAACCATCCAACA | 22 |
| SEQ ID NO:5 | The forward primer of SEQ ID NO:13 | CGGCGAGCAGCGAAAATG | 18 |
| SEQ ID NO:6 | The reverse primer of SEQ ID NO:13 | GATCCCGATACCGTTGACCGACAC | 24 |
| SEQ ID NO:7 | The forward primer of SEQ ID NO:14 | TGCGGCAGCTTCAAACTT | 18 |
| SEQ ID NO:8 | The reverse primer of SEQ ID NO:14 | CATGCTGCCGTCCTCCTTC | 19 |
| SEQ ID NO:9 | The forward primer of SEQ ID NO:15 | AGAATGTGCCAGAATCAGAAGC | 22 |
| SEQ ID NO:10 | The reverse primer of SEQ ID NO:15 | CCTAATGGTAAAATGACGGGAG | 22 |
Embodiment 3 heliothis armigera nuclear polyhedrosis virus and the mirror of autographa california nuclear polyhedrosis virus
Not
3.1 one-step method PCR premix systems (Ha&Ac one-step PCR Mix)
PCR premix system is 50 μ l, contains:
*: Beijing Quanshijin Biotechnology Co., Ltd
3.2PCR response procedures:
After 95 DEG C of denaturations 10min, expand 30 circulations (cycling condition: 95 DEG C of 30s, 56 DEG C of 30s,
72 DEG C of 1min), finally extend 5min.
The electrophoresis detection of 3.3PCR product:
PCR primer carries out on the agarose gel of 1.0% electrophoresis, and 100V, 40min, at ultraviolet light
Lower detection.
3.4 viruses differentiate
Owing to heliothis armigera nuclear polyhedrosis virus DNA can amplify two bands through PCR, clip size is
695bp and 972bp (table 2).
And autographa california nuclear polyhedrosis virus DNA can amplify three bands through PCR, clip size
It is respectively 303bp, 1126bp and 1222bp (table 2).And it is visible when using agarose gel electrophoresis
Both are clearly distinguished from (as shown in Figure 1).
Therefore, in practical operation:
1) if the electrophoresis pattern of testing sample occurs in that five kinds of amplified bands varied in size, it was demonstrated that
Sample includes heliothis armigera nuclear polyhedrosis virus and autographa california nuclear polyhedrosis virus simultaneously；
2) if the electrophoresis pattern of testing sample occurs in that 312bp, 1126bp, 1222bp tri-kinds expansion
Increase band, it was demonstrated that testing sample is autographa california nuclear polyhedrosis virus；
3) if the electrophoresis pattern of testing sample occurs in that bis-kinds of amplified bands of 695bp, 972bp, card
Bright testing sample is heliothis armigera nuclear polyhedrosis virus.
Table 2 is for identifying bollworm virus and the sequence of autographa california virus
HaNPV G4* 1, Heliocoverpa armigera nucleopolyhedrovirus G4, NCBI serial number AF271059.2
AcNPV E2* 2, Autographa californica nucleopolyhedrovirus strain E2, NCBI serial number KM667940.1
Comparative example 1 uses restriction endonuclease reaction to differentiate heliothis armigera nuclear polyhedrosis virus and Autographa
Californica nuclear polyhedrosis virus
Use method known to those skilled in the art, use Restriction Enzyme EcoRV enzyme action, differentiate cotton boll
Worm nuclear polyhedrosis virus and autographa california nuclear polyhedrosis virus, the result obtained as in figure 2 it is shown,
It can thus be appreciated that use traditional restriction endonuclease reaction to differentiate virus, reactions steps is loaded down with trivial details, and band is many, gives
Appraisal makes troubles.
Comprehensive analysis:
Above results proved that this Multiplex PCR differentiates specificity and the accuracy of detection method.Often
Rule viral discrimination method such as bioassary method need 10 day time, enzyme action qualification need 3-5 days time
Between, and Multiplex PCR only needs a few hours, and it has good specificity and sensitivity.
The one-step method multi-PCR detection method that the present invention uses, by PCR buffer, Taq enzyme, dNTP,
Primer composition blendes together Ha&Ac one-step PCR Mix in advance, multiple enzyme proportioning is mixed, makes reactant liquor
Prepare the most simple and convenient, shorten the operating time, avoid operational pollution simultaneously.
Therefore this method establishes for heliothis armigera nuclear polyhedrosis virus and Autographa californica nuclear many
The method for quick of angle precursor virus.The method is easy and simple to handle, sensitivity good, convenient and swift, be suitable for use
Differentiate that heliothis armigera nuclear polyhedrosis virus and autographa california nuclear polyhedrosis virus are multiple in exploitation
PCR detection kit, heliothis armigera nuclear polyhedrosis virus and autographa california nuclear polyhedrosis virus
The monitoring efficiency improving product quality in the production of biological pesticide is significant.
Claims (9)
1. one kind is used for differentiating heliothis armigera nuclear polyhedrosis virus and Autographa californica nuclear polyhedron disease
The multi-primers of poison, wherein, described multi-primers at least includes following primer pair:
According in the sequence shown in SEQ ID NO:11-12 at least one design primer to and according to
The primer pair of at least one design in the sequence shown in SEQ ID NO:13-15.
Multi-primers the most according to claim 1, wherein, described multi-primers at least includes respectively
Primer pair according to the sequential design shown in SEQ ID NO:11 and SEQ ID NO:14.
Multi-primers the most according to claim 1 and 2, wherein, described multi-primers includes root
The five pairs of specific primers pair separately designed according to the sequence as shown in SEQ ID NO:11-15.
4. according to the multi-primers according to any one of claim 1-3, wherein, described multi-primers
Including such as SEQ ID NO:1 and 2, SEQ ID NO:3 and 4, SEQ ID NO:5 and 6, SEQ
At least two of primer centering shown in ID NO:7 and 8 and SEQ ID NO:9 and 10 are right.
5. according to the multi-primers according to any one of claim 1-3, wherein, described multi-primers
As shown in SEQ ID NO:1-10.
6. one kind is used for differentiating heliothis armigera nuclear polyhedrosis virus and Autographa californica nuclear polyhedron disease
The multiple PCR method of poison, wherein uses the multi-primers as according to any one of claim 1-5；
Preferably, said method comprising the steps of:
1) DNA of testing sample is extracted, as DNA profiling；
2) multi-primers as according to any one of claim 1-5 and polymerase chain reaction examination are used
Agent, carries out multiplex PCR in PCR amplification instrument；
3) product obtaining amplification carries out electrophoresis discriminating；
Preferably, described multiple PCR method can be one-step method multiple PCR method.
Method the most according to claim 6, the reaction condition of wherein said multiplex PCR is as follows:
After 95 DEG C of denaturations 10min, expand 30 circulations, cycling condition be 95 DEG C 30 seconds, 56 DEG C
30 seconds, 72 DEG C 1 minute, finally extend 5 minutes；
Preferably, the product obtained amplification carries out the agarose gel electrophoresis that concentration is 1%.
8. one kind is used for differentiating heliothis armigera nuclear polyhedrosis virus and Autographa californica nuclear polyhedron disease
The test kit of poison, described test kit includes:
For extracting the reagent of testing sample DNA；
And the reagent for multiplex PCR, wherein, described multiplex PCR reagent includes such as claim
Multi-primers according to any one of 1-5.
9. multi-primers as according to any one of claim 1-5, as claimed in claims 6 or 7
Method or test kit as claimed in claim 8 differentiating heliothis armigera nuclear polyhedrosis virus and Herba Medicaginis
Application in three-spotted plusia nuclear polyhedrosis virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610341944.4A CN105950782B (en) | 2016-05-20 | 2016-05-20 | For identifying the primer, kit and method of heliothis armigera nuclear polyhedrosis virus and autographa california nuclear polyhedrosis virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610341944.4A CN105950782B (en) | 2016-05-20 | 2016-05-20 | For identifying the primer, kit and method of heliothis armigera nuclear polyhedrosis virus and autographa california nuclear polyhedrosis virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105950782A true CN105950782A (en) | 2016-09-21 |
| CN105950782B CN105950782B (en) | 2019-09-27 |
Family
ID=56909354
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610341944.4A Active CN105950782B (en) | 2016-05-20 | 2016-05-20 | For identifying the primer, kit and method of heliothis armigera nuclear polyhedrosis virus and autographa california nuclear polyhedrosis virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105950782B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018225086A1 (en) * | 2017-06-06 | 2018-12-13 | Indian Institute Of Science | Method and device for rapid detection of hearnpv |
| CN110484657A (en) * | 2019-09-06 | 2019-11-22 | 广东省农业科学院植物保护研究所 | Detect nest-type PRC primer, kit and its method of the prodenia litura adult with nuclear polyhedrosis virus |
| CN114075614A (en) * | 2020-08-12 | 2022-02-22 | 四川大学华西医院 | Method for detecting DNA content of baculovirus |
-
2016
- 2016-05-20 CN CN201610341944.4A patent/CN105950782B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| JENCY JOSE, ET AL.: "Molecular Characterization of Nucleopolyhedrovirus of Three Lepidopteran Pests Using Late Expression Factor-8 Gene", 《INDIAN J. VIROL.》 * |
| 何丽华 等: "AcNPV 对棉铃虫的感染试验", 《浙江农业科学》 * |
| 覃玥 等: "家蚕核型多角体病毒可视化快速核酸检测方法", 《基因组学与应用生物学》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018225086A1 (en) * | 2017-06-06 | 2018-12-13 | Indian Institute Of Science | Method and device for rapid detection of hearnpv |
| CN110484657A (en) * | 2019-09-06 | 2019-11-22 | 广东省农业科学院植物保护研究所 | Detect nest-type PRC primer, kit and its method of the prodenia litura adult with nuclear polyhedrosis virus |
| WO2021043230A1 (en) * | 2019-09-06 | 2021-03-11 | 广东省农业科学院植物保护研究所 | Nested-pcr primer, kit and method for detecting nucleopolyhedrovirus carried by spodoptera litura adults |
| CN114075614A (en) * | 2020-08-12 | 2022-02-22 | 四川大学华西医院 | Method for detecting DNA content of baculovirus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105950782B (en) | 2019-09-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112094948B (en) | Application of target gene combination in African swine fever virus detection and kit | |
| CN105695628B (en) | A kind of HRM detection primer and method identifying swine foot-and-mouth disease virus and pig Sai Neijia paddy virus | |
| CN102277455B (en) | Primer, probe and assay kit used for detecting porcine circovirus, porcine pseudorabies virus and porcine parvovirus | |
| CN110699489B (en) | Real-time fluorescence PCR detection primer probe set, kit and method for African swine fever virus CD2V gene | |
| CN105950782A (en) | Primers, kit and method for distinguishing helicoverpa armigera nucleopolyhedrovirus from autographa californica nucleopolyhedrovirus | |
| CN107056898A (en) | 3 type of carp herpesviral, 1301 plants of ORF136 DNA recombinant expressions albumen, antibody and its application | |
| CN105349707A (en) | RT-LAMP (reverse transcriptase loop-mediated isothermal amplification) kit for porcine epidemic diarrhea viruses and applications thereof | |
| CN105200162B (en) | A kind of JXA1-R plants of quick differentiation HP-PRRS live vaccines and the HRM detection methods and its primer of street strain | |
| CN102703609B (en) | Onsite quick detection kit of channel catfish virus and detection method thereof | |
| CN106350609B (en) | A kind of reagent, detection method and application for vesicular stomatitis virus detection | |
| CN110184387B (en) | RT-LAMP detection primer for detecting ANSVV, application thereof, detection reagent and detection method | |
| Khan et al. | Rapid detection of infectious bursal disease by loop-mediated isothermal amplification for field analysis | |
| CN106086211A (en) | LAMP primer group, test kit and the detection method of detection Flos Nelumbinis corruption pathogenic bacteria | |
| CN114350848A (en) | Dual fluorescent probe primer combination and kit for identifying African swine fever type I strain and type II strain and application of dual fluorescent probe primer combination and kit | |
| CN105803114A (en) | Porcine bocavirus detection and parting enrichment multiple PCR rapid diagnostic kit | |
| CN115960902B (en) | Primer and crRNA for detecting various mycoplasma based on CRISPR-Cas system and application thereof | |
| CN101875980A (en) | Kit and method for detecting Macrobrachium rosenbergii Nodavirus | |
| CN102002539A (en) | Porcine parvovirus assay kit and application thereof | |
| CN101294224B (en) | Primer and probe sequence for testing pig parvoviral nucleotide fragment | |
| CN104975077A (en) | Pig-sourced eperythrozoon fluorogenic quantitative PCR detection kit and application thereof | |
| CN106521030A (en) | Dual fluorescent quantitation RT-PCR detection method for classical swine fever virus (CSFV) and bovine viral diarrhea virus (BVDV) | |
| CN107326103A (en) | A kind of triple RT PCR specificity amplification primers groups and the RT PCR detection methods of triple identifications | |
| CN104762414A (en) | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) kit for fluorescent visual fast detection of Japanese encephalitis B virus | |
| CN113249503A (en) | LAMP primer group and method for detecting mannheimia haemolytica | |
| CN112853004A (en) | LAMP detection degenerate primer group, kit and method for white spot syndrome virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |