CN105950619A - shRNA molecule capable of inhibiting expression of human AEBP1 gene - Google Patents

shRNA molecule capable of inhibiting expression of human AEBP1 gene Download PDF

Info

Publication number
CN105950619A
CN105950619A CN201610246220.1A CN201610246220A CN105950619A CN 105950619 A CN105950619 A CN 105950619A CN 201610246220 A CN201610246220 A CN 201610246220A CN 105950619 A CN105950619 A CN 105950619A
Authority
CN
China
Prior art keywords
aebp1
shrna
gene
shrna molecule
human
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610246220.1A
Other languages
Chinese (zh)
Inventor
刘媛
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN201610246220.1A priority Critical patent/CN105950619A/en
Publication of CN105950619A publication Critical patent/CN105950619A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a shRNA molecule capable of inhibiting expression of the human AEBP1 gene. According to the human AEBP1 gene (with a serial number of NM_001129.4) in Genbank, four shRNA molecules are designed and are synthesized targeted at the sequence of shRNA; two synthesized complementary single-stranded shRNA molecules are subjected to annealing to form a double-stranded shRNA molecule; and the double-stranded shRNA molecule is linked to a lentivirus vector to construct four lentivirus interference RNA plasmids. The shRNA plasmids are used for transfection of a Huh7 cell line containing AEBP1, and relative quantitative analysis is carried out on the AEBP1 gene through real-time quantitative PCR so as to evaluate inhibition effect on the expression of the AEBP1 gene. Results of relative quantitative analysis show that AEBP1-shRNA1 can inhibit transcription of 82.3% of AEBP1 and AEBP1-shRNA2 can inhibit transcription of 75.7% of AEBP1.

Description

A kind of shRNA molecule suppressing people's AEBP1 gene expression
Technical field
The present invention relates to adipose cell can be strengthened Binding Protein 1 (Adipocyte Enhancer-binding Protein 1, AEBP1) gene and produce the evaluation methodology on hepatocyte of the design of shRNA molecule, synthesis and the inhibitory action of the effect that significantly inhibits.
Background technology
It is a kind of transcription inhibitory factor that adipose cell strengthens Binding Protein 1 (Adipocyte enhancer-binding protein 1, AEBP1), molecular weight 82kDa, high expressed in fatty tissue, the lipogenesis in lipocyte before participating in.Additionally in AEBP1 liver, lung, spleen, brain and primary macrophage, expression is the highest.
There are some researches prove that AEBP1 participates in the cholesterol of mouse macrophage, foam wanshing and macrophage, hepatocyte inflammatory reaction.The release of inflammatory factor in AEBP1 high expressed promotion Mice Body.Its concrete mechanism is that AEBP1 is by activation NF-κ B path, the release of promotion inflammatory factor IL-6, TNF-α, MCP-1 and iNOS etc..This process depends on the protein-protein interaction of AEBP1 Yu I κ B α, after AEBP1 with I κ B α is combined, promote the Ser32/Ser36 phosphorylation of I κ B α, cause the phosphorylation-degradation of I κ B α, so that NF-κ B phosphorylation proceed to nucleus, start transcribing of target gene (such as inflammatory factor).
Additionally test and also find that the macrophage of AEBP1 mediation LPS induction is more easily generated obesity to the differentiation of foam cell, the mice of AEBP1 process LAN.Further study show that, the process LAN of AEBP1 can suppress macrophage PPAR γ 1 (peroxisome proliferator-activated Receptor γ 1) and LXR α (liver X receptor α), and the target gene ABCA1 (ATP-binding of the two cassette A1)、ABCG1(ATP-binding Cassette G1), ApoE (apolipoprotein E) and the expression of CD36, these albumen are the important participants that cholesterol shifts to high density lipoprotein.In Mice Body, knock out the expression of AEBP1, contribute to reducing body weight.LPS stimulating expression of macrophage, AEBP1 up-regulated in inducing cell.The expression of suppression AEBP1 can resist septic shock that LPS causes and the atherosclerosis that gram positive bacterial infection causes.
It can be seen that AEBP1 participates in the disease pathology reaction that inflammation is relevant with lipid metabolism, the expression of interference AEBP1 contributes to prevention and treatment of diseases.But the most do not suppress at present the shRNA molecule that people AEBP1 expresses.
Summary of the invention
The present invention provides a kind of shRNA molecule suppressing people's AEBP1 gene expression, and people's AEBP1 gene expression is significantly inhibited effect, and the treatment for AEBP1 overexpression related disease provides application foundation.
The present invention adopts the following technical scheme that realization:
A kind of shRNA molecule suppressing people's AEBP1 gene expression, described AEBP1 gene Serial No. NM_001129.4 in GenBank.Described shRNA molecule includes shRNA1 and shRNA2 two kinds；Wherein,
The positive-sense strand template sequence of shRNA1 molecule is:
5 '-GATCCGCTATGAGGAAATGACCTTTCTTCAAGAGAGAAAGGTCATTTCCTCATAGC TTTTTTG-3 ',
Antisense strand template sequence is:
5’-AATTCAAAAAAGCTATGAGGAAATGACCTTTCTCTCTTGAAGAAAGGTCATTTCCTCATAGCG-3’；
The positive-sense strand template sequence of shRNA2 molecule is:
5 '-GATCCGGTGGTGATTACTGGCGAATCTTCAAGAGAGATTCGCCAGTAATCACCACC TTTTTTG-3 ',
Antisense strand template sequence is:
AATTCAAAAAAGGTGGTGATTACTGGCGAATCTCTCTTGAAGATTCGCCAGTAATCACCACCG。
The AEBP1 gene order that the present invention is directed to people synthesizes one group of shRNA molecule, filter out two shRNA1 and shRNA2, detect through qRT-PCR method, can effectively reduce the expression of AEBP1 gene, thus significantly reduce the expression of AEBP1 protein level, and verified on human hepatoma cell strain Huh7.Being drawn by quantitative analysis, AEBP1-shRNA1 can effectively suppress transcribing of the AEBP1 of 82.3%, and AEBP1-shRNA2 can suppress transcribing of the AEBP1 of 75.7%.
The present invention has following application value: some infectious disease such as gram positive bacterial infection, virus infection (hepatitis B virus, hepatitis C virus) etc. raise by causing intracellular AEBP1 to express, cause lasting inflammatory reaction and disorders of lipid metabolism, promote the advancing of disease processes such as viral hepatitis, septic shock and atherosclerosis.The expression of suppression AEBP1 can weaken above-mentioned advancing of disease process.The shRNA molecule that the present invention filters out can significantly reduce the expression of AEBP1.
Accompanying drawing explanation
Accompanying drawing 1 is the shRNA transfection using the real-time quantitative PCR method detection present invention in the embodiment of the present invention result figure to the inhibition that AEBP1 expresses.
Detailed description of the invention
Below in conjunction with specific embodiment, technical scheme is clearly and completely described.
The shRNA molecule synthetic method suppressing people's AEBP1 gene in the present invention is as follows:
According to people's AEBP1 gene in Genbank, gene order number: NM_001129.4；Design 4 shRNA molecule, carry out synthesis for shRNA sequence and obtain two complementary strand shRNA molecule, i.e. shRNA1 and shRNA2, after these two shRNA molecule annealed formation double-strands, be connected on slow virus carrier, build 4 slow virus RNA interfering plasmids.
In order to test the shRNA molecule of the synthesis inhibition to people's AEBP1 gene expression, adopt with the following method by the shRNA plasmid transfection Huh7 cell line containing AEBP1: the Huh7 cell expressing AEBP1 is inoculated 24 orifice plates, 1.5 × 105The density in individual/hole, the DMEM culture fluid containing 10% hyclone with 500ul cultivates cell, after 24h, cell reaches the degree of converging of about 75%, take 100ul opti-MEM, 2ul liposome lipofectamin2000 is premixed with 0.8ug plasmid, after room temperature stands 20min, it is added in the Huh7 cell conditioned medium cultivated.It is replaced by after 6h containing 10% The DMEM complete culture solution of hyclone, after being further cultured for 48h, by Trizol method extracted total RNA.
The total serum IgE of above-mentioned transfectional cell, carries out relative quantitative assay by real-time quantitative PCR to AEBP1 gene, evaluates the inhibition to AEBP1 gene expression；Quantitative analysis method is as follows: one-step method Real time PCR detection kit is purchased from TAKARA company, carries out Real Time PCR reaction system is: 2 × One Step RT-PCR Buffer III 12.5ul, Takara Ex Taq HS 0.5ul, PrimerScript RT enzyme Mix II 0.5ul, upstream and downstream primer (10uM) each 0.5ul, TaqMan Probe 1ul, total RNA 2ul, RNase free dH2O 7.5ul.PCR reaction condition is: 42 DEG C of 5min, hold of hold, 95 DEG C of 5s of 95 DEG C of 10s, cycle, 60 DEG C of 20s, 40 circulations.Being drawn by relative quantitative assay: AEBP1-shRNA1 can effectively suppress transcribing of the AEBP1 of 82.3%, AEBP1-shRNA2 can suppress transcribing of the AEBP1 of 75.7%, as shown in Figure 1.
The Opti-MEM culture fluid selected in above-described embodiment, DMEM culture fluid, purchased from Gibco company of the U.S., liposome lipofectamin2000 is purchased from American I nvitrogen company, and hyclone is purchased from Hangzhou Sijiqing Biological Engineering Material Co., Ltd.；RNA extraction agent Trizol, quantitative PCR kit are purchased from TAKARA company；ShRNA is synthesized by Shanghai JiMa pharmacy Technology Co., Ltd.
Above example is only the preferred embodiments of the present invention rather than whole embodiments.Based on the embodiment in the present invention, all other embodiments that those of ordinary skill in the art are obtained under not making creative work premise, broadly fall into the scope of protection of the invention.Simultaneously, the explanation of above example is only intended to help to understand method and the core concept thereof of the present invention, for one of ordinary skill in the art, thought according to the present invention, the most all will change, in sum, this specification content should not be construed as limitation of the present invention.

Claims (1)

1. suppress a shRNA molecule for people's AEBP1 gene expression, described AEBP1 gene Serial No. NM_001129.4 in GenBank, it is characterised in that described shRNA molecule includes shRNA1 and shRNA2 two kinds；Wherein,
The positive-sense strand template sequence of shRNA1 molecule is
5 '-GATCCGCTATGAGGAAATGACCTTTCTTCAAGAGAGAAAGGTCATTTCCTCATAGC TTTTTTG-3 ',
Antisense strand template sequence is
5’-AATTCAAAAAAGCTATGAGGAAATGACCTTTCTCTCTTGAAGAAAGGTCATTTCCTCATAGCG-3’；
The positive-sense strand template sequence of shRNA2 molecule is
5 '-GATCCGGTGGTGATTACTGGCGAATCTTCAAGAGAGATTCGCCAGTAATCACCACC TTTTTTG-3 ',
Antisense strand template sequence is
AATTCAAAAAAGGTGGTGATTACTGGCGAATCTCTCTTGAAGATTCGCCAGTAATCACCACCG。
CN201610246220.1A 2016-04-20 2016-04-20 shRNA molecule capable of inhibiting expression of human AEBP1 gene Pending CN105950619A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610246220.1A CN105950619A (en) 2016-04-20 2016-04-20 shRNA molecule capable of inhibiting expression of human AEBP1 gene

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610246220.1A CN105950619A (en) 2016-04-20 2016-04-20 shRNA molecule capable of inhibiting expression of human AEBP1 gene

Publications (1)

Publication Number Publication Date
CN105950619A true CN105950619A (en) 2016-09-21

Family

ID=56917727

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610246220.1A Pending CN105950619A (en) 2016-04-20 2016-04-20 shRNA molecule capable of inhibiting expression of human AEBP1 gene

Country Status (1)

Country Link
CN (1) CN105950619A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108686209A (en) * 2017-04-07 2018-10-23 邢杰 A kind of plasmid construction and application method for antiatherosclerosis

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002024741A2 (en) * 2000-09-21 2002-03-28 Ryan James W Isolated genomic polynucleotide fragments from chromosome 7
CN105238790A (en) * 2015-11-26 2016-01-13 河南省农业科学院畜牧兽医研究所 Promoters for regulating pig AEBP1 and construction method, and transfection carriers and construction method and application

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002024741A2 (en) * 2000-09-21 2002-03-28 Ryan James W Isolated genomic polynucleotide fragments from chromosome 7
CN105238790A (en) * 2015-11-26 2016-01-13 河南省农业科学院畜牧兽医研究所 Promoters for regulating pig AEBP1 and construction method, and transfection carriers and construction method and application

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
HYO‐SUNG RO ET AL.: "Adipocyte Enhancer‐Binding Protein 1 Modulates Adiposity and Energy Homeostasis", 《OBESITY》 *
MAJDALAWIEH, AMIN ET AL.: "PPARγ1 and LXRα face a new regulator of", 《NUCLEAR RECEPTOR SIGNALING》 *
ZHANG, L ET AL.: "The Role of AEBP1 in Sex-Specific Diet-Induced Obesity", 《MOLECULAR MEDICINE》 *
孙坚 等: "AEBP1在结直肠癌中的表达及其意义", 《现代生物医学进展》 *
武会娟 等: "《临床科研常用分子生物学技术》", 31 July 2015 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108686209A (en) * 2017-04-07 2018-10-23 邢杰 A kind of plasmid construction and application method for antiatherosclerosis

Similar Documents

Publication Publication Date Title
Liu et al. Long non-coding RNA-ATB promotes EMT during silica-induced pulmonary fibrosis by competitively binding miR-200c
Agarwal et al. miR-135a targets IRS2 and regulates insulin signaling and glucose uptake in the diabetic gastrocnemius skeletal muscle
Zong et al. Down-regulation of microRNA-184 is associated with corneal neovascularization
Liu et al. AEG-1 3′-untranslated region functions as a ceRNA in inducing epithelial–mesenchymal transition of human non-small cell lung cancer by regulating miR-30a activity
Chen et al. MiR-16a regulates milk fat metabolism by targeting large tumor suppressor kinase 1 (LATS1) in bovine mammary epithelial cells
CN108368487A (en) The excretion body of nucleic acid is packed
Fu et al. MicroRNA-126-3p attenuates intracerebral hemorrhage-induced blood-brain barrier disruption by regulating VCAM-1 expression
Russo et al. Antiviral effects of human microRNAs and conservation of their target sites
López-Sánchez et al. Non-alcoholic fatty liver disease and microRNAs expression, how it affects the development and progression of the disease
Bai et al. Role of microRNA-21 in the formation of insulin-producing cells from pancreatic progenitor cells
EP2868746A1 (en) Micrornas modulating the effect of glucocorticoid signaling
Bai et al. MicroRNAs can effectively induce formation of insulin‐producing cells from mesenchymal stem cells
Huang et al. MicroRNA miR-204 and miR-1236 inhibit hepatitis B virus replication via two different mechanisms
Wang et al. Lipid metabolism disorder induced by up-regulation of miR-125b and miR-144 following β-diketone antibiotic exposure to F0-zebrafish (Danio rerio)
Han et al. Retracted: Protective effects of microRNA‐431 against cerebral ischemia‐reperfusion injury in rats by targeting the Rho/Rho‐kinase signaling pathway
CN113476618B (en) Application of miR-199a-3p in preparation of medicine for treating nasopharyngeal carcinoma
Wu et al. MicroRNA-214 Affects Fibroblast Differentiation of Adipose-Derived Mesenchymal Stem Cells by Targeting Mitofusin-2 during Pelvic Floor Dysfunction in SD Rats with Birth Trauma.
JP2019531092A (en) Modulation of microRNA against myotonic dystrophy type 1 and microRNA antagonists therefor
Wang et al. Secreted miR-27a induced by cyclic stretch modulates the proliferation of endothelial cells in hypertension via GRK6
Zhang et al. MicroRNA-149* suppresses hepatic inflammatory response through antagonizing STAT3 signaling pathway
Sun et al. IL-1β-stimulated β-catenin up-regulation promotes angiogenesis in human lung-derived mesenchymal stromal cells through a NF-κB-dependent microRNA-433 induction
Zhu et al. Upregulation of miR-155 regulates group 2 innate lymphoid cells by targeting c-maf in allergic rhinitis
Fu et al. CircMAPK1 promotes the proliferation and migration of vascular smooth muscle cells through miR-22-3p/methyl-CpG binding protein 2 axis
Xu et al. Overexpression of microRNA-9 inhibits 3T3-L1 cell adipogenesis by targeting PNPLA3 via activation of AMPK
Li et al. Characterization of microRNA profile in IgE-mediated mouse BMMCs degranulation

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20160921

RJ01 Rejection of invention patent application after publication