CN105944113A - CpG nucleic acid medicine conveying system with pH response and preparation method thereof - Google Patents
CpG nucleic acid medicine conveying system with pH response and preparation method thereof Download PDFInfo
- Publication number
- CN105944113A CN105944113A CN201610450081.4A CN201610450081A CN105944113A CN 105944113 A CN105944113 A CN 105944113A CN 201610450081 A CN201610450081 A CN 201610450081A CN 105944113 A CN105944113 A CN 105944113A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- cpg nucleic
- acid drug
- cpg
- carrier
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7084—Compounds having two nucleosides or nucleotides, e.g. nicotinamide-adenine dinucleotide, flavine-adenine dinucleotide
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicinal Preparation (AREA)
Abstract
The invention provides a CpG nucleic acid medicine conveying system. The CpG nucleic acid medicine conveying system comprises a carrier and a CpG nucleic acid medicine, and is characterized in that the carrier is an aldehyde group silane coupling agent modified mesoporous silica nano grain; the CpG nucleic acid medicine is 5' terminal amino modified CpG oligonucleotide; the carrier and the CpG nucleic acid medicine are in covalent linkage through an imine linkage; and the imine linkage has pH sensitivity. The invention further provides a preparation method of the CpG nucleic acid medicine conveying system. According to the CpG nucleic acid medicine conveying system provided by the invention, the carrier and the CpG nucleic acid medicine are in covalent linkage through the pH sensitive imine linkage and can reach a lysosome after being absorbed by immune cells; and the free CpG nucleic acid medicine is released under a weak acidic condition of the lysosome, so that the immune cells are induced to secrete a series of cell factors. The CpG nucleic acid medicine conveying system can realize controllable release of the CpG nucleic acid medicine and has high secretion induction efficiency.
Description
Technical field
The present invention relates to a kind of delivery system, particularly relate to a kind of CpG nucleic acid drug delivery system with pH response
System and preparation method thereof.
Background technology
CpG ODN (hereinafter referred to as CpG ODN) is a kind of widow containing CpG (cytosine-phosphate-bird pyrimidine) motif
Nucleotide, it is possible to identified by intracellular Toll-like receptor-9 (hereinafter referred to as TLR-9), and induce immunocyte secretion to include white
Cytokine-6 (hereinafter referred to as IL-6) is in interior a series of cytokines, thus induces and strengthen immunoreation, the most permissible
It is used as to prepare immunological adjuvant, the preventing and treating of the diseases such as some infectious disease, anaphylactic disease and tumor has important answering
Use prospect.
Owing to the chemical nature of CpG ODN is a kind of Deoxydization nucleotide, easily it is deoxidized nucleotidase and decomposes, steady in serum
Qualitative poor, and cellular uptake rate is low, and therefore its application is restricted.In order to improve the stability of CpG ODN, usually adopt
Loaded with drug conveying carrier, formed CpG delivery system.Research shows, uses nano material to prepare as carrier
CpG delivery system, can not only improve CpG ODN stability in serum, additionally it is possible to improve immunocyte to CpG medicine
The uptake ratio of thing induction system, when the particle diameter of nano material is in the range of 20nm～100nm, delivery system is easier to quilt
Immunocyte absorbs.
Mesopore silicon oxide is a kind of nano-porous materials, has good biocompatibility, stability is high, specific surface area is big, interior
The advantage that aperture, portion is big.In the building-up process of mesopore silicon oxide, synthesis condition is adjusted changing obtain mesoporous
The form of silicon oxide and internal pore size so that it is adapt with medicine to be carried；Additionally, the rich surface of mesopore silicon oxide
Hydroxyl, it is possible to carry out multiple chemical modification according to demand and connect upper different functional group, thus realizing further medicine
The control of thing release performance, therefore mesopore silicon oxide is a kind of preferably drug conveying carrier.
Research shows, the CpG ODN being stored on carrier is more weak to the inducing action of IL-6, and the TLR-9 of intracellular is more easy to know
Not You Li CpG ODN so that immunocyte is induced to secrete the cytokine such as IL-6.Therefore, preferable CpG medicine conveying
System needs not only to enough keep stable in extracellular, be easier to be absorbed by immunocyte, in addition it is also necessary to can be in intracellular release
Go on a tour from CpG ODN, i.e. also need to realize the controlled intracellular release of CpG ODN.
Summary of the invention
For solving the problems referred to above, present invention employs following technical scheme:
A kind of CpG nucleic acid drug induction system with pH response, including carrier and CpG nucleic acid drug, it is characterised in that:
Wherein, carrier is the mesoporous monox nanometer granule that aldehyde radical silane coupler is modified, and CpG nucleic acid drug is that 5 ' ends are repaiied
The CpG ODN of decorations amino,
Carrier and CpG nucleic acid drug are covalently bound by imine linkage, and this imine linkage has pH sensitivity.
Further, the CpG nucleic acid drug induction system with pH response that the present invention provides, it is also possible to there is following skill
Art feature:
Wherein, the particle diameter of carrier is 50nm～150nm, and the mesoporous pore size in carrier is 7nm～15nm.
Further, wherein, CpG nucleic acid drug contains 24～72 bases.
Further, wherein, aldehyde radical silane coupler is triethoxy-silicane hutanal silane.
The present invention also provides for a kind of method of CpG nucleic acid drug induction system prepared and have pH response, it is characterised in that
Comprise the steps:
Step one, is dissolved completely in surfactant and cosolvent in the water of uniform temperature, stirs 30 minutes～2 little
Time, obtain aqueous solution, by silicon source and organic solvent mix homogeneously, add in this aqueous solution, be slowly stirred 6 hours～24 hours,
Producing white colloidal granule, be dried with after washing with alcohol 3～5 times by this white colloidal granule, dried product is molten in acidity
Liquid refluxes, removes organic solvent, obtain mesoporous monox nanometer granule；
Step 2, by the mesoporous monox nanometer granule that obtains in aldehyde radical silane coupler and step one with 0.5mL:1g～
The ratio of 1.5mL:1g joins in dry toluene, under conditions of isolation air, 80 DEG C～110 DEG C, and condensing reflux 12 hours
～36 hours, it is centrifuged, washs, is vacuum dried, obtain carrier；
Step 3, obtains suspension by the support dispersion obtained in step 2 in buffer, is 1 μ g/ μ L～3 by concentration
The ratio of CpG nucleic acid drug 1:2～1:50 in mass ratio of μ g/ μ L, joins in this suspension, shaken at room temperature in an oscillator
4 hours～8 hours, centrifugation, with buffer solution, obtain CpG nucleic acid drug delivery vehicles system.
Further, the method with the CpG nucleic acid drug induction system that pH responds that the present invention provides, it is also possible to have
Following technical characteristic:
Wherein, in step one, surfactant: cosolvent: water: silicon source: the mol ratio of organic solvent is 0.8～1.2:
0.35～0.53:986～1480:2.6～3.9:55～83.
Further, wherein, in step one, uniform temperature is 60 DEG C～80 DEG C.
Further, wherein, surfactant be tetradecyltrimethylammonium ammonium halide, cetyl trimethyl ammonium halide,
Any one or a few mixture in octadecyl triethyl group ammonium halide；
Cosolvent is the mixture of any one or the two in triethanolamine, glycerol；
Silicon source is the mixture of any one or the two in methyl silicate, tetraethyl orthosilicate；
Organic solvent is the mixture of any one or the two in hexamethylene, normal hexane；
Acid solution is concentrated hydrochloric acid-ethanol solution, and concentrated hydrochloric acid is 4:100～8:100 with the volume ratio of ethanol；
Buffer is the phosphate buffer of pH 8.1.
Further, wherein, in step one, in acid solution, the number of times of backflow is 3～5 times, and each time is 24
Hour～48 hours.
Invention effect and effect
According to the CpG nucleic acid drug induction system with pH response of the present invention, owing to carrier passes through with CpG nucleic acid drug
Imine linkage is covalently bound, and imine linkage has pH sensitivity, can keep stable in neutral conditions, and break in acid condition
Split, discharge CpG medicine；Additionally, carrier is mesoporous monox nanometer granule, easily absorbed by immunocyte.Therefore, the present invention carries
After the CpG nucleic acid drug induction system with pH response of confession enters human body, it is possible to protect in the neutral environment of serum and body fluid
Keep steady fixed, intracellular lysosome can be arrived after being swallowed by immune cells, and at lysosomal weak acid environment
Under discharge free CpG medicine, it is achieved that the controllable release of CpG nucleic acid drug；The free CpG medicine discharged can be with cell
Interior TLR-9 receptor combines, and promotes the immunocyte secretion a series of cytokines including IL-6, thus induces and increase
Strong immunoreation, induced efficiency is high.
The preparation method of the CpG nucleic acid drug induction system with pH response according to the present invention, owing to using the present invention
The method synthesis provided has obtained mesoporous monox nanometer granule, and the particle diameter of the mesoporous monox nanometer granule that this prepares exists
In the range of 20nm～100nm, delivery system is easier to be absorbed by immunocyte, and this particle surface is rich in hydroxyl, logical
Cross aldehyde radical silane coupler to modify and obtain aldehyde radical, on CpG nucleic acid drug 5 ' that this aldehyde radical can be modified with 5 ' Amino End Group
Amino reacts, and is connected by imine linkage, obtains the carrier-CpG nucleic acid drug induction system connected by imine linkage, this medicine
Induction system is the CpG nucleic acid drug induction system with pH response.
Accompanying drawing explanation
Fig. 1 is scanning electron microscope (SEM) figure of the mesoporous monox nanometer granule of embodiment one preparation；
Fig. 2 is transmission electron microscope (STEM) figure of the mesoporous monox nanometer granule of embodiment one preparation；
Fig. 3 is that embodiment one prepares the nitrogen suction before and after aldehyde radical silane coupler is modified of the mesoporous monox nanometer granule
Attached-desorption isotherm and pore size distribution curve；
Fig. 4 is mesoporous monox nanometer granule, carrier granular and the CpG nucleic acid drug induction system of embodiment one preparation
Fourier's infrared signature curve；
Fig. 5 is the cytotoxicity block diagram of carrier granular in embodiment two；
Fig. 6 is the cellular uptake situation of the CpG nucleic acid drug induction system that FITC modifies in embodiment three；
Fig. 7 is in embodiment four, CpG nucleic acid drug induction system after cellular uptake, the result of secretion inducing IL-6.
Detailed description of the invention
The detailed description of the invention of the present invention is described below in conjunction with embodiment and accompanying drawing, in each of the embodiments described below, does not notes
Bright actual conditions is all in accordance with normal condition or the material supplier suggestion of related experiment.
[embodiment one]
The preparation experiment of the CpG nucleic acid drug induction system with pH response that the present embodiment one provides for the present invention.
In the present embodiment, the CpG nucleic acid drug used is that the CpG that the 5 ' Amino End Group containing 72 base pairs are modified is few
Deoxydization nucleotide, its sequence is:
5’-NH2-(CH2)6-TCAGAGAGTTAGAGAGTTAGAGAGTCAGAGAGTTAGAGAGTTAGAGAGTCAGAGA
GTTAGAGAGTTAGAGAG-3’。
In the present embodiment, the aldehyde radical silane coupler of employing is triethoxy-silicane hutanal silane, and silicon source is just
Silester, surfactant is cetyl trimethylammonium bromide, and cosolvent is triethanolamine, and buffer is the phosphorus of pH 8.1
Phthalate buffer.
The preparation process of the CpG nucleic acid drug induction system with pH response of present invention offer is as described below:
Step one: 1g cetyl trimethylammonium bromide and 0.18g triethanolamine are added 60mL deionized water, by temperature
It is maintained at about 60 DEG C, stirs at least 1 hour；
After system clarification, 20mL cyclohexane solution (wherein containing tetraethyl orthosilicate 1mL) is added above-mentioned clarification system
In, temperature is maintained at 60 DEG C, after stirring 18 hours, produces white precipitate；
Centrifugal collect above-mentioned white precipitate, with this white precipitate of washing with alcohol, add concentrated hydrochloric acid-ethanol solution (concentrated hydrochloric acid:
The volume ratio of ethanol is 8:100), reflux 12 hours, be repeated 3 times, white precipitate that centrifugal collection obtains by washing with alcohol, very
Empty dry (temperature is 60 DEG C), obtains mesoporous monox nanometer granule；
Step 2: take the mesoporous monox nanometer granule that 125mg step one prepares, ultrasonic disperse in dry toluene,
Obtain suspension；
0.1mL triethoxysilyl hutanal silane is added above-mentioned suspension, in condensation reflux unit, 90
DEG C, isolation air under conditions of reflux 20 hours；
After above-mentioned reaction terminates, wash away unreacted triethoxysilyl hutanal silane with dry toluene, will
To solid be vacuum dried, obtain aldehyde radical silane coupler modify mesoporous monox nanometer granule, this aldehyde radical coupling agent
The mesoporous monox nanometer granule modified is carrier granular (hereinafter referred to as carrier granular)；
Step 3: CpG nucleic acid drug is dissolved in buffer, is configured to the solution of 1 μ g/ μ L, be saved in-20 DEG C standby, make
Used time first thaws to room temperature, and this CpG medicine is the CpG ODN of 5 ' terminal modified amino；
The carrier granular obtained in step 2 is scattered in buffer, is configured to the suspension of 1 μ g/ μ L, by this suspension
Mixing for 1:1 with mass ratio with above-mentioned CpG nucleic acid drug solution, prepare the suspension of the two, the most in an oscillator, room temperature is shaken
Swing 4 hours, centrifugation, after buffer solution, leach solid, i.e. obtain the CpG nucleic acid drug induction system with pH response.
Fig. 1 is scanning electron microscope (SEM) figure of the mesoporous monox nanometer granule of embodiment one preparation.
Fig. 2 is transmission electron microscope (STEM) figure of the mesoporous monox nanometer granule of embodiment one preparation.
Mesoporous monox nanometer granule embodiment one prepared is observed under scanning electron microscope and transmission electron microscope, result
As shown in Figures 1 and 2, this mesoporous monox nanometer granule is spheroidal particle, and particle diameter is about 80nm, even particle size distribution, point
Dissipating property good, mesopore orbit therein is dendroid distribution.
Fig. 3 is that embodiment one prepares the nitrogen suction before and after aldehyde radical silane coupler is modified of the mesoporous monox nanometer granule
Attached-desorption isotherm and pore size distribution curve.
The mesoporous monox nanometer granule prepared by the present embodiment and carrier granular carry out nitrogen adsorption-detachment assays, knot
Fruit is as it is shown on figure 3, in figure, DMSN is mesoporous monox nanometer granule, and DMSN-CHO is carrier granular.According to this isothermal curve,
The BET specific surface area being calculated mesoporous monox nanometer granule and carrier granular is respectively 768m2/ g and 540m2/g；Use
BJH method, the average mesopore aperture being calculated mesoporous monox nanometer granule and carrier granular is respectively 9nm and 7.7nm.
Fig. 4 is mesoporous monox nanometer granule, carrier granular and the CpG nucleic acid drug induction system of embodiment one preparation
Fourier's infrared signature curve.
Mesoporous monox nanometer granule, carrier granular and the CpG nucleic acid drug induction system prepared by the present embodiment are carried out
Fourier's infrared signature curve test experiments, as shown in Figure 4, in figure, DMSN is mesoporous monox nanometer granule to result, DMSN-
CHO is carrier granular, and DMSN-CHO-CpG is CpG nucleic acid drug induction system.It is seen that and mesoporous monox nanometer
Granule is compared, and carrier granular is at 1709cm-1There is obvious aldehyde radical absworption peak in place, illustrates that this carrier particle surface is distributed aldehyde
Base；And compared with carrier granular, CpG nucleic acid drug induction system absworption peak in this place disappears, and occur in that obvious imines
Absworption peak (the 1636cm of key-1Place), illustrate that CpG nucleic acid drug is combined by imine linkage aldehyde radical on carrier granular, thus quilt
Fix on the carrier particles.
Embodiment effect and effect
The method provided according to the present embodiment, it is possible to preparing mesoporous monox nanometer granule, the particle diameter of this granule is
About 80nm, mesopore orbit is dendroid distribution, and specific surface area is 768m2/ g, mesoporous pore size is 9nm；Carry according to the present embodiment
This mesoporous monox nanometer granule can be modified by the method for confession, obtains carrier granular, the specific surface area of this carrier granular
For 540m2/ g, mesoporous pore size is 7.7nm, and surface distributed has aldehyde radical；Can also be by CpG core according to the method that the present embodiment provides
Acid medicine is fixed on carrier granular by imine linkage, obtains CpG nucleic acid drug induction system, and it is sensitive that this imine linkage has pH
Property, stable under neutral environment, easy fracture under weak acid environment, discharge CpG nucleic acid drug, therefore carry according to the present embodiment
The CpG nucleic acid drug induction system that the method for confession prepares has pH response.
[embodiment two]
The carrier granular that Example one prepares carries out cytotoxic assay, and assay method uses the Cell of standard
Counting Kit-8 method.In the present embodiment, macrophage strain RAW264.7 cell is bought in Japan Riken, and by supply
The method that business provides is cultivated.
Specific experiment process is as follows:
The carrier granular that embodiment one prepares is scattered in MEM culture medium and is configured to the suspension that concentration is 1mg/mL
Liquid, when RAW264.7 cell is sowed in 96 orifice plates after (cell density is 5000/hole), by the suspension of above-mentioned carrier granular
Being added in 96 orifice plates, final concentration is respectively 0,25,50,75,100 and 200 μ g/mL, and liquor capacity is 100 μ L.
By the carrier granular suspension of five kinds of variable concentrations and do not add the blank group of carrier granular respectively with carefully
Born of the same parents co-culture 24 hours, then add the CCK-8 solution of 10 μ L in every hole, and cell uses microplate reader after continuing to cultivate 1 hour
(MTP-880) absorbance at 450nm wavelength is measured.Through the RAW264.7 cell of carrier granular process and without carrier granular
The ratio of the living cells quantity in the RAW264.7 cell processed is cytotoxicity.
Fig. 5 is the cytotoxicity block diagram of carrier granular in embodiment two.
Experimental result is as it is shown in figure 5, compared with blank group, the carrier granular that embodiment one prepares reaches in concentration
Cytotoxicity is not the most shown to 200 μ g/mL.
Embodiment effect and effect
The assay method provided according to the present embodiment, compared with blank group, carrier granular reaches 200 μ g/ in concentration
ML does not still have cytotoxicity, illustrates that the carrier granular that the method provided according to embodiment one prepares has good biology
The compatibility, meets in delivery system the requirement of biocompatibility to carrier.
[embodiment three]
The present embodiment uses fluorescent marker method, the CpG nucleic acid drug preparing the method provided according to embodiment one
Induction system carries out cellular uptake experiment.
The present embodiment uses fluorescent marker FITC to modify the CpG nucleic acid drug in embodiment one, obtains FITC
The CpG nucleic acid drug modified.Then the CpG nucleic acid drug modified by this FITC is as CpG nucleic acid drug, according to embodiment one institute
The preparation method provided, prepares the CpG nucleic acid drug induction system that FITC modifies.
By 1.5 × 104Individual RAW264.7 cell is seeded in the culture vessel with glass bottom of a 35mm, after cultivating 24 hours, and will
The CpG nucleic acid drug induction system that FITC modifies adds culture dish, final concentration of 100 μ g/mL.Continue to cultivate cell, after 4 hours
Formalin with buffer solution 2 times and with 4% (mass percent) fixes cell 10 minutes；Use buffer solution twice again
After, process cell at room temperature 10 minutes with 0.2% (mass percent) tween 20 solution, carry out carefully with LAMP1 antibody subsequently
Born of the same parents dye and process 1 hour, buffer solution 2 times, then with Alexa Fluor 555goat anti-rabbit IgG dyeing 1
Hour, buffer solution 2 times.Finally, cell Lycra SP5 confocal fluorescent microscope observation of cell absorbs CpG nucleic acid drug
Induction system situation.
Fig. 6 is the cellular uptake situation of the CpG nucleic acid drug induction system that FITC modifies in embodiment three.
As shown in Figure 6, the CpG nucleic acid drug induction system that FITC modifies can be good at being phagocytized by cells result, and
It is distributed in the lysosome of cell (bright colored portion in figure).
Embodiment effect and effect
Owing to FITC is fluorescent dye, the picked-up effect on cell does not produce impact, the survey provided according to the present embodiment
Determine result, it was demonstrated that the CpG nucleic acid drug induction system that embodiment one prepares can be good at being phagocytized by cells, and is distributed
In the lysosome of cell.
[embodiment four]
The present embodiment uses the CpG nucleic acid drug induction system that the method provided according to embodiment one prepares, and measures
Under Cytolysosome solutions of weak acidity stimulates, the secretion situation of this induction system induction IL-6.
Raw264.7 cell is seeded in 96 orifice plates, and density is 1 × 105Individual/hole, after cultivating 24 hours, by prepare
CpG nucleic acid drug induction system joins in cell culture well, final concentration of 1 μ g/mL.After continuing to cultivate 6 hours, collect thin
Born of the same parents, extract RNA therein, and the method provided by supplier carries out DNase I digestion process to RNA, obtains total serum IgE.Use
primeScriptTMRT test kit (purchased from Takara company of Japan) carries out reverse transcription to the total serum IgE obtained, and obtains cDNA.IL-
The secretion level of 6 RT-PCR method measures.
Fig. 7 is in embodiment four, CpG nucleic acid drug induction system after cellular uptake, the result of secretion inducing IL-6.
As it is shown in fig. 7, the secretion of IL-6 is produced by carrier granular (being expressed as " DMSN-CHO " in figure) itself hardly
Impact；Compared with free CpG oligodeoxynucleotide (being expressed as " free CpG " in figure), the method provided according to embodiment one
The CpG nucleic acid drug induction system (being expressed as " DMSN-CHO-CpG " in figure) prepared has the highest IL-6 induction point
Secrete ability.
The effect of embodiment and effect
The assay method provided according to the present embodiment, result shows, the method provided according to embodiment one prepares
CpG nucleic acid drug has the highest IL-6 secretion inducing ability, and this inducibility is far above free CpG nucleic acid drug,
And this inducing action is not that carrier granular itself produces.
In sum, the method provided according to embodiment one can obtain the CpG nucleic acid drug delivery system with pH response
System, wherein CpG nucleic acid drug and carrier are covalently bound by imine linkage, and this imine linkage has pH sensitivity, at CpG nucleic acid drug
After induction system is absorbed by immunocyte and is arrived lysosome, it is possible to discharge free under lysosomal solutions of weak acidity
CpG nucleic acid drug, induction immunocyte secretes the cytokines such as IL-6；The inducing action of this CpG nucleic acid drug induction system is remote
Higher than free CpG nucleic acid drug.
Additionally, carrier granular itself has good biocompatibility, its particle diameter is at about 80nm, therefore, it is possible to promote to exempt from
The picked-up to CpG nucleic acid drug induction system of the epidemic disease cell, and CpG nucleic acid drug induction system is distributed in after enabling cellular uptake
In lysosome；Mesoporous pore size in carrier granular is at about 7.7nm, and the mesoporous distribution in dendroid, makes CpG nucleic acid drug energy
Enough being fixed in mesoporous duct, it is to avoid in course of conveying, CpG nucleic acid drug is degraded in serum.
Above-described embodiment is merely to illustrate the detailed description of the invention of the present invention, not for the protection model limiting the present invention
Enclose, any equivalent transformation made according to technical scheme, all sum up within protection scope of the present invention.Such as,
CpG nucleic acid drug of the present invention can also is that the CpG ODN of 5 ' terminal modified other sequences having amino, a length of
24～72 base pairs；The particle diameter of carrier granular can be any particle diameter in the range of 50nm～150nm, carrier granular mesoporous
Aperture can be any aperture in the range of 7nm～15nm.
Claims (9)
1. there is a CpG nucleic acid drug induction system for pH response, including carrier and CpG nucleic acid drug, it is characterised in that:
Wherein, described carrier is the mesoporous monox nanometer granule that aldehyde radical silane coupler is modified, and described CpG nucleic acid drug is 5 '
The CpG ODN of terminal modified amino,
Described carrier and described CpG nucleic acid drug are covalently bound by imine linkage, and this imine linkage has pH sensitivity.
The CpG nucleic acid drug induction system with pH response the most according to claim 1, it is characterised in that:
Wherein, the particle diameter of described carrier is 50nm～150nm, and the mesoporous pore size in described carrier is 7nm～15nm.
The CpG nucleic acid drug induction system with pH response the most according to claim 1, it is characterised in that:
Wherein, described CpG nucleic acid drug contains 24～72 bases.
The CpG nucleic acid drug induction system with pH response the most according to claim 1, it is characterised in that:
Wherein, described aldehyde radical silane coupler is triethoxy-silicane hutanal silane.
5. the method preparing the CpG nucleic acid drug induction system as claimed in claim 1 with pH response, its feature exists
In, comprise the steps:
Step one, is dissolved completely in surfactant and cosolvent in the water of uniform temperature, stirs 30 minutes～2 hours,
To aqueous solution, by silicon source and organic solvent mix homogeneously, add in this aqueous solution, be slowly stirred 6 hours～24 hours, produce white
Color colloidal solid, is dried this white colloidal granule with after washing with alcohol 3～5 times, and dried product returns in an acidic solution
Stream, removes organic solvent, obtains mesoporous monox nanometer granule；
Step 2, by the described mesoporous monox nanometer granule that obtains in described aldehyde radical silane coupler and step one with 0.5mL:
The ratio of 1g～1.5mL:1g joins in dry toluene, under conditions of isolation air, 80 DEG C～110 DEG C, and condensing reflux 12
Hour～36 hours, be centrifuged, wash, be vacuum dried, obtain described carrier；
Step 3, obtains suspension by the described support dispersion obtained in step 2 in buffer, is 1 μ g/ μ L～3 by concentration
The ratio of described CpG nucleic acid drug 1:2～1:50 in mass ratio of μ g/ μ L, joins in this suspension, room temperature in an oscillator
Vibrate 4 hours～8 hours, centrifugation, with buffer solution, obtain described CpG nucleic acid drug delivery vehicles system.
Method the most according to claim 5, it is characterised in that:
Wherein, in step one, surfactant: cosolvent: water: silicon source: the mol ratio of organic solvent is 0.8～1.2:0.35
～0.53:986～1480:2.6～3.9:55～83.
Method the most according to claim 5, it is characterised in that:
Wherein, in step one, described uniform temperature is 60 DEG C～80 DEG C.
Method the most according to claim 5, it is characterised in that:
Wherein, described surfactant is tetradecyltrimethylammonium ammonium halide, cetyl trimethyl ammonium halide, octadecyl three
Any one or a few mixture in ethyl ammonium halide；
Described cosolvent is the mixture of any one or the two in triethanolamine, glycerol；
Described silicon source is the mixture of any one or the two in methyl silicate, tetraethyl orthosilicate；
Described organic solvent is the mixture of any one or the two in hexamethylene, normal hexane；
Described acid solution is concentrated hydrochloric acid-ethanol solution, and concentrated hydrochloric acid is 4:100～8:100 with the volume ratio of ethanol；
Described buffer is the phosphate buffer of pH 8.1.
Method the most according to claim 5, it is characterised in that:
Wherein, in step one, in described acid solution, the number of times of backflow is 3～5 times, and each time is 24 hours～48 little
Time.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610450081.4A CN105944113A (en) | 2016-06-21 | 2016-06-21 | CpG nucleic acid medicine conveying system with pH response and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610450081.4A CN105944113A (en) | 2016-06-21 | 2016-06-21 | CpG nucleic acid medicine conveying system with pH response and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105944113A true CN105944113A (en) | 2016-09-21 |
Family
ID=56906226
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610450081.4A Pending CN105944113A (en) | 2016-06-21 | 2016-06-21 | CpG nucleic acid medicine conveying system with pH response and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105944113A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106587078A (en) * | 2016-12-19 | 2017-04-26 | 湖北工业大学 | Preparation method of meso-porous silica nanoparticles |
| CN108743951A (en) * | 2018-06-06 | 2018-11-06 | 江苏师范大学 | A kind of pH responds the preparation method of degradable hollow mesoporous organosilicon nano-particle |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2009013142A (en) * | 2007-07-09 | 2009-01-22 | Kyoto Univ | Mesoporous silica for sustained release |
| CN103655452A (en) * | 2013-11-18 | 2014-03-26 | 上海理工大学 | Gene medicine delivery system and preparation method |
| CN104127886A (en) * | 2014-07-16 | 2014-11-05 | 上海理工大学 | CpG nucleic acid drug conveying system and making method thereof |
| US20150182468A1 (en) * | 2012-07-25 | 2015-07-02 | Agency For Science, Technology And Research | Stimuli-responsive interpolymer complex coated hollow silica vesicles |
| CN104758945A (en) * | 2015-02-26 | 2015-07-08 | 宁波大学 | PH responsive thrombolytic drug targeting nanogel, synthesis method and application thereof |
-
2016
- 2016-06-21 CN CN201610450081.4A patent/CN105944113A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2009013142A (en) * | 2007-07-09 | 2009-01-22 | Kyoto Univ | Mesoporous silica for sustained release |
| US20150182468A1 (en) * | 2012-07-25 | 2015-07-02 | Agency For Science, Technology And Research | Stimuli-responsive interpolymer complex coated hollow silica vesicles |
| CN103655452A (en) * | 2013-11-18 | 2014-03-26 | 上海理工大学 | Gene medicine delivery system and preparation method |
| CN104127886A (en) * | 2014-07-16 | 2014-11-05 | 上海理工大学 | CpG nucleic acid drug conveying system and making method thereof |
| CN104758945A (en) * | 2015-02-26 | 2015-07-08 | 宁波大学 | PH responsive thrombolytic drug targeting nanogel, synthesis method and application thereof |
Non-Patent Citations (8)
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106587078A (en) * | 2016-12-19 | 2017-04-26 | 湖北工业大学 | Preparation method of meso-porous silica nanoparticles |
| CN108743951A (en) * | 2018-06-06 | 2018-11-06 | 江苏师范大学 | A kind of pH responds the preparation method of degradable hollow mesoporous organosilicon nano-particle |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chen et al. | Reversible pore‐structure evolution in hollow silica nanocapsules: large pores for siRNA delivery and nanoparticle collecting | |
| Huang et al. | Magnetic virus-like nanoparticles in N. benthamiana plants: a new paradigm for environmental and agronomic biotechnological research | |
| CN102888404B (en) | Sirna conjugate and preparation method thereof | |
| CN109589418A (en) | A kind of mesoporous silicon oxide medicine-carried nano particles and its preparation method and application of the schiff bases copolymer cladding with pH responsiveness | |
| Tao et al. | Mesoporous silica nanoparticles for enhancing the delivery efficiency of immunostimulatory DNA drugs | |
| CN109044993A (en) | It is a kind of to target polyethyleneglycol modified mesoporous silicon dioxide nano particle and preparation method thereof with aptamer | |
| CN100545084C (en) | The preparation method of ordered porous hydroxyapatite material | |
| CN104800169B (en) | The method that a kind of use chitosan and beta cyclodextrin prepare hydrophobic type medicine magnetic targeting sustained and controlled release carrier | |
| CN106698447B (en) | Hollow mesoporous silica nanoparticle, nano-carrier and preparation method thereof | |
| CN107648614A (en) | Inside and outside bilayer stimuli responsive nanometer transport vehicle and preparation method and application step by step | |
| CN105923636A (en) | Preparation method of monodisperse hollow mesoporous silica nanoparticle | |
| CN110507818B (en) | DNA (deoxyribonucleic acid) nano flower-shaped composite structure as well as preparation method and application thereof | |
| CN112245407A (en) | Preparation of targeting nano vaccine based on metal-polyphenol network structure and product thereof | |
| CN108434122B (en) | Polyelectrolyte hybrid hollow silica nanoparticle and preparation method and application thereof | |
| CN106745007B (en) | A kind of multi-stage porous mesoporous organosilicon ball and preparation method thereof | |
| CN105944113A (en) | CpG nucleic acid medicine conveying system with pH response and preparation method thereof | |
| CN103387829A (en) | Phosphorescence silica nanometer probe with core shell composition and preparation method thereof | |
| CN104857521A (en) | Preparation method of bio-based macromolecular vesicles with glucose response | |
| Shaban et al. | Biomedical applications of dendritic fibrous nanosilica (DFNS): recent progress and challenges | |
| CN103655452A (en) | Gene medicine delivery system and preparation method | |
| CN102861541A (en) | Preparation method of surface-modified fluorescent magnetic polymer composite microspheres | |
| CN106311102A (en) | Preparation method of photothermal response type composite gel hollow microsphere | |
| CN103497347A (en) | Preparation method of dual functional chitosan microspheres | |
| Lin et al. | Asymmetric silica nanoparticles with tailored spiky coverage derived from silica–polymer cooperative assembly for enhanced hemocompatibility and gene delivery | |
| CN105381466B (en) | A kind of optomagnetic temperature-sensitive nano combination drug carrier and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20160921 |