CN105943560B

CN105943560B - Construction method and application of HBV (hepatitis B virus) infected mouse model

Info

Publication number: CN105943560B
Application number: CN201610390186.5A
Authority: CN
Inventors: 赵平; 张龙严; 狄弘玮; 王世杰; 张卫
Original assignee: Second Military Medical University SMMU
Current assignee: Second Military Medical University SMMU
Priority date: 2016-06-03
Filing date: 2016-06-03
Publication date: 2020-05-05
Anticipated expiration: 2036-06-03
Also published as: CN105943560A

Abstract

The invention relates to the technical field of medicines, and provides a method for establishing a Hepatitis B Virus (HBV) infected mouse model. The invention adopts Polymerase Chain Reaction (PCR) to amplify HBV single copy linear genome, transfects the PCR product into Huh7, HepG2 and 293T cells, and detects hepatitis B surface antigen (HBsAg) and hepatitis B e antigen (HBeAg) in the supernatant of the cultured cells by enzyme-linked immunosorbent assay (ELISA); injecting the PCR product into a C57BL/6J mouse by a tail vein high-pressure hydrodynamics method to detect hepatitis B core antigen (HBcAg) in mouse liver tissues in an immunohistochemical mode, and detecting HBsAg and HBeAg in mouse serum by ELISA. The invention establishes a new HBV infected mouse model, the preparation method of the model is simple, and HBV genome similar to HBV cccDNA exists in liver tissue. Provides a new tool for researching HBV cccDNA degradation mechanism, drug clearance, HBV biological characteristics in serum samples of hepatitis B patients and the like.

Description

Construction method and application of HBV (hepatitis B virus) infected mouse model

The technical field is as follows:

the invention relates to the technical field of medicines, in particular to an HBV infected mouse model established by injecting HBV genome PCR products into a mouse and application of the model.

Background art:

although Hepatitis B Virus (HBV) is a pathogen seriously harming human health, about 3 hundred million people are infected with chronic HBV worldwide, HBV infection can cause acute and chronic hepatitis and is an important reason for cirrhosis and liver cancer of people in developing countries, although the hepatitis B vaccine can effectively prevent HBV infection, the current drugs can only inhibit virus replication for chronic HBV infection, but cannot act on HBV covalent closed circular DNA (cccDNA) existing in liver cell nuclei, which is a huge challenge for developing anti-HBV drugs (see 2015ayiannis G, karayaannis P.T. treatment and IFN α and NUCs for chronic HBV infection: expectation for tomorrow.J Viral hepatitis Hepat.2014; 21(11) 753-61; Nassal M.B.Viral HBV site and vaccine for liver cancer) vaccine of 12.19712.

The establishment of a small animal model capable of simulating the HBV infection state of human beings is very important for the research of HBV infection and pathogenic mechanism and the development of anti-HBV drugs. Presently, the major animal models include Duck hepatitis B model (DHBV), woodchuck hepatitis model (WHV), HBV transgenic mouse model, HBV plasmid hydrodynamic injection mouse model, etc. (see Allweiss L, Dandri M. Experimental in vitro and in vivo models for the study of humanhepatitis B virus infection. J hepatol.2016; 64(1Suppl): S17-31; Dandri M, Lutgemtmann M, Volz T, Petersen J. Small animal models for studying hepatitis B virus reproduction and genetics. Sepamin Liver Dis 2006; 26(2): 181-91). DHBV and WHV can cause chronic infection, but are different from human HBV in gene structure and pathogenicity; the HBV transgenic mouse model integrates HBV genome in chromosome, is immune tolerant to HBV, and cannot produce cccDNA; mice injected with HBV genomic plasmids under high pressure water power can produce HBV antigens and viral particles for a long time and undergo serological transformation, but HBV genomes in this model exist in a form different from cccDNA and have a limited duration.

The invention content is as follows:

the invention aims to establish an HBV infected mouse model with HBV genome double-chain circular DNA in liver tissue, and provides a new tool for researching HBV cccDNA degradation mechanism, drug clearance, HBV biological characteristics in serum samples of hepatitis B patients and the like.

The invention injects the linear single copy HBV genome DNA into the mouse by high pressure water dynamic tail vein, then detects HBcAg in the liver cell of the mouse, detects HBsAg and HBeAg in the serum, and represents a new HBV mouse infection model. The model is simple in establishing method, is particularly suitable for quickly establishing a mouse infection model aiming at clinical HBV serum samples, and HBV genes in the model can theoretically form a closed double-chain annular structure similar to cccDNA, so that the model has important application in the aspects of researching cccDNA degradation mechanism, removing medicines, HBV biological characteristics in serum samples of hepatitis B patients, screening medicines and the like.

The main technical scheme of the invention is as follows:

the invention uses HBV genome PCR product to inject mouse to build a HBV infection mouse model.

The invention provides a construction method of an HBV infected mouse model, which is successfully prepared by injecting a linear single-copy HBV genome into a mouse.

The linear single-copy HBV genome for injecting mice can be obtained by PCR amplification, and the preparation method is simple.

In the HBV infection mouse model constructed by the invention, HBV genome similar to HBV covalently closed circular DNA (cccDNA) exists in liver tissue.

The invention adopts Polymerase Chain Reaction (PCR) to amplify HBV single copy linear genome, transfects the PCR product into Huh7, HepG2 and 293T cells, and detects hepatitis B surface antigen (HBsAg) and hepatitis B e antigen (HBeAg) in the supernatant of the cultured cells by enzyme-linked immunosorbent assay (ELISA); injecting the PCR product into a C57BL/6J mouse by a tail vein high-pressure hydrodynamics method to detect hepatitis B core antigen (HBcAg) in mouse liver tissues in an immunohistochemical mode, and detecting HBsAg and HBeAg in mouse serum by ELISA.

Cell transfection and in vivo mouse experiments used plasmid pAAV-HBV1.2 as a positive control.

The results show that: HBV genome PCR products transfect Huh7, HepG2 and 293T cells, and can secrete and express HBsAg and HBeAg; after injection of the PCR product into mice, HBcAg was detected in liver tissues, HBsAg and HBeAg were detected in serum, the maximum duration of HBsAg and HBeAg was 59 and 38 days, respectively, and the HBsAg and HBeAg levels and duration in serum were generally similar to those of mice injected with plasmid pAAV-HBV 1.2. The invention establishes a new HBV infected mouse model, the preparation method of the model is simple, and double-chain circular HBV genome similar to HBV cccDNA exists in liver tissue.

The invention provides a new model for researching HBV cccDNA degradation mechanism, drug clearance, HBV biological characteristics in serum samples of hepatitis B patients, drug screening and the like.

Description of the drawings:

FIG. 1: the strategy for amplifying HBV whole genome (Primer P1, Primer P2 and P1, P2, Primer P1, Primer P2, DR1 is direct repeat 1 in HBV genome).

FIG. 2: cutting plasmid pMD18T-HBV1.0, and analyzing the PCR product of HBV genome by agarose gel electrophoresis; wherein 1:10000bp DNA Marker; 2 pMD18T-HBV1.0 restriction (KpnI/HindIII); HBV genome PCR product.

FIG. 3: ELISA was performed to detect HBsAg and HBeAg in the culture supernatant after different forms of HBV DNA were transfected into Huh7, HepG2, 293T cells (. about.P <0.05, PCR vs. pAAV-HBV 1.2).

FIG. 4: detecting HBsAg and HBeAg in mouse serum by ELISA; wherein A: dynamic changes in HBsAg levels in mouse serum; b: dynamic change in hbeag levels in mouse serum (./P <0.05, PCR compared to pAAV-HBV1.2 group).

FIG. 5: immunohistochemistry was used to detect the expression of HBcAg in mouse liver tissues.

The specific implementation mode is as follows:

the present invention will be further described with reference to the following examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the invention.

Example 1

Materials (I) and (II)

1. Cells and plasmids

Human hepatoma cells Huh7, HepG2 and Human Embryonic Kidney (HEK)293T cell lines were maintained by the second university of military medical microbiology research laboratory (also available directly from the cell institute of chinese academy of sciences); the pMD-18T cloning vector and plasmid pUC18 are Takara products.

2. Plasmids

Adeno-associated virus backbone plasmid pAAV-HBV1.2 containing 1.2 copies of HBV genome was given by professor Taiwan university Cheng Zhe (also prepared according to the literature methods: Huang LR, Wu HL, Chen PJ, Chen DS. immunological reagents mouse model for the licensing of human chronic hepatitis B infection. Proc Natl Acad Sci U S A.2006; 103(47): 17862-7.); the gene cloning vector pMD-18T is a product of Takara.

3. Primer and method for producing the same

The primer for amplifying the HBV complete genome is synthesized by Takara company, and the sequences of the upstream primer and the downstream primer are respectively as follows:

P1：5′-TTTTTCACCTCTGCCTAATCA-3′(SEQ ID NO:1)；

P2：5′-GTTGCATGGTGCTGGTGCGC-3′(SEQ ID NO:2)。

4. reagent

PrimeSTAR Max DNA polymerase premix (containing various components of the PCR reaction except for the template and primers) was purchased from Takara.

DMEM complete cell culture medium containing 10% fetal bovine serum, 100IU/ml penicillin, 100mg/ml streptomycin, adjusted to pH 7.4. Various components for preparation of the culture were purchased from Invitrogen.

The mammalian cell transfection reagent Lipofectamine 3000 was purchased from Invitrogen; the HBsAg and HBcAg ELISA kits were purchased from Shanghai Kowa bioengineering, Inc.

5. Laboratory animal

C57BL/6J mice were purchased from Spial-BiKa laboratory animals, Inc.

II, an experimental method:

HBV genome PCR amplification and plasmid construction

1. The full-length HBV genome is amplified by using the plasmid pAAV-HBV1.2 as a template and primers P1 and P2, and PCR amplification reaction components comprise: 1) plasmid pAAV-HBV 1.21. mu.l (0.1. mu.g); 2) primers P1 and P2 were added in an amount of 1. mu.l (10pmol) each; 3) PrimeSTAR MaxDNA polymerase premix 10. mu.l; 4) sterilized redistilled water 38. mu.l. Placing the mixture in a microcentrifuge tube, fully and uniformly mixing, and carrying out thermal cycle reaction on a PCR instrument: fully denaturalizing at 94 ℃ for 30 sec; then 30 cycles of 94 ℃ 10sec, 60 ℃ 10sec, 72 ℃ 3 min; finally, the temperature is reduced to 4 ℃. Primers P1, P2 are located at the beginning of the highly conserved preC gene of the HBV genome, also just at the 5 'and 3' ends of the negative strand of the HBV genome (FIG. 1).

2. The PCR product was subjected to agarose gel electrophoresis, and the amplified HBV genome was recovered from the gel, and the recovered HBV genome was ligated with the pMD-18T cloning vector to obtain plasmid pMD18T-HBV1.0 containing a single copy of HBV genome, which was then identified by restriction enzyme KpnI/HindIII (FIG. 2), followed by DNA sequencing. All methods were referenced to molecular cloning, a third edition of the laboratory Manual (scientific Press, 2002, first edition).

3. The plasmid pMD18T-HBV1.0 was used as a template for PCR amplification of HBV genome, as described above, and the PCR product was subjected to agarose gel electrophoresis and recovered for subsequent cell transfection and mouse tail vein injection.

(II) cell culture, transfection and HBsAg and HBcAg detection in cell supernatant

1. Huh7, HepG2 and HEK293T were cultured in DMEM complete medium and placed in a 5% CO2 incubator at 37 ℃. The three cells in logarithmic growth phase were subcultured into 50000 cells/well in a 24-well plate in 500. mu.l medium at 37 ℃ in 5% CO₂Incubate overnight.

2. Plasmids pAAV-HBV1.2, pMD18T-HBV1.0, pUC18 (for negative control) and HBV genome PCR products were transfected into 24-well plates and overnight-cultured Huh7, HepG2 and HEK293T cells, respectively, using Lipofectamine 3000 reagent, and the procedure was performed in accordance with the instructions for the use of the reagent, with the amounts of plasmid and PCR products being 0.5. mu.g. Placing the cell culture plate in an incubator, sucking out cell culture supernatant after 6h, adding 500 mu l of complete DMEM medium into each well, placing the cell culture plate in the incubator, collecting the cell culture supernatant after 48h, and detecting HBsAg and HBcAg in the culture supernatant by using a commercial ELISA kit. The detection method refers to the kit use instruction.

The HBV genome is circular, the polymerase gene is overlapped with S, C, X gene, and there is partial overlap between C gene and X gene. The pAAV-HBV1.2 plasmid contains complete filiform HBV genome and can express all HBV proteins; in pMD18T-HBV1.0, HBV genome is cut off after C gene start codon, so HBsAg is only expressed in cell, and HBeAg and HBcAg cannot be expressed; HBV genome PCR product ends in the initial part of C gene

(GCGCACCAGCACCATGCAAC↓TTTTTCACCTCTGCCTAATCATCTCT(SEQ ID NO:3)，ATGInitiation codon of C gene, site of breakpoint, i.e., terminal position of PCR product of HBV genome), if the PCR product is not connected to a circular structure, it cannot be obtainedHBeAg and HBcAg are expressed.

As shown in FIG. 3, HBsAg could be detected in the cell supernatants transfected by pAAV-HBV1.2, pMD18T-HBV1.0 and HBV genome PCR products, and HBeAg could be detected in the cell supernatants transfected by plasmid pAAV-HBV1.2 and HBV genome PCR products, indicating that the linear HBV genome is linked and circularized in the cell. In agreement with the expectation, HBeAg was not detected in the supernatant of pMD18T-HBV1.0 transfected cells.

(III) mouse injection and detection of HBsAg and HBcAg in mouse serum

Plasmid pAAV-HBV1.2 and HBV genome PCR products are dissolved in Phosphate Buffer Solution (PBS), male C57BL/6J mice with the age of 4 weeks and the age of about 16g are injected into tail vein by a high-pressure water-powered method respectively, the volume is 2ml, the plasmid and the PCR products are injected by 4 mu g in 5-7 seconds respectively, and 2ml of PBS is injected as a negative control. Blood was collected from the mouse orbit every 7 days starting on day 3 after tail vein injection, and HBsAg and HBcAg in mouse serum were detected using a commercial ELISA kit. Each group had 6 mice. The results are shown in FIG. 4: similar to mice injected with the pAAV-HBV1.2 plasmid, HBsAg and HBeAg were also produced in the serum of mice injected directly with HBV genomic PCR product. The duration of HBsAg in serum of two groups of mice is 59 days at most, and the HBsAg level of the serum of two groups of mice has no significant difference at six time points (10 th, 17 th, 24 th, 45 th, 52 th and 59 th days) in nine time points of HBsAg positivity; compared with HBsAg, HBeAg in serum is reduced rapidly and continuously, and the duration of the HBeAg in the pAAV-HBV1.2 and HBV genome PCR product injection groups is respectively 45 days and 38 days at the longest. Except day 10, there was no significant difference in HBeAg levels in the sera of the two groups of mice at other time points.

(IV) immunohistochemical detection of HBcAg in liver tissue of mouse

Liver tissues were taken on days 1, 4 and 7 after intravenous injection of HBV DNA from the tail of mice and tested for HBcAg expression in hepatocytes by immunohistochemistry, which was performed by Google organisms. As a result, as shown in FIG. 5, the expression of HBcAg was detected in the hepatocytes of mice injected with pAAV-HBV1.2 and HBV genomic PCR products after 1, 4, and 7 days from the injection.

The above experimental results show that HBV genome PCR products can be connected to form a ring structure in cells cultured in vitro or in mouse liver tissues to express HBeAg.

The model is simple in establishing method, is particularly suitable for quickly establishing a mouse infection model aiming at clinical HBV serum samples, and HBV genes in the model can form a closed double-chain annular structure similar to cccDNA, so that a new model is provided without researching HBV cccDNA degradation mechanism, drug clearance, HBV biological characteristics in serum samples of hepatitis B patients and the like.

While the preferred embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that the invention is not limited thereto, and that various changes and modifications may be made without departing from the spirit of the invention, and the scope of the appended claims is to be accorded the full scope of the invention.

Claims

1. A method for constructing HBV-infected mouse model is characterized in that a linear single-copy HBV genome is injected into a mouse; the linear single-copy HBV genome is obtained by PCR amplification; primers for amplification of HBV genome by PCR are as follows:

P1：5′-TTTTTCACCTCTGCCTAATCA-3′(SEQ ID NO:1)；

P2：5′-GTTGCATGGTGCTGGTGCGC-3′(SEQ ID NO:2)；

transfecting Huh7, HepG2 and 293T cells with the PCR product, and detecting hepatitis B surface antigen and hepatitis B e antigen in culture cell supernatant by ELISA;

injecting the PCR product into the tail vein of a mouse by a high-pressure water power method;

the constructed HBV infection mouse model has HBV genome similar to HBV covalently closed circular DNA in liver tissue.

2. The use of the HBV infected mouse model constructed by the construction method of claim 1 in the study of HBV cccDNA degradation mechanism, drug clearance, HBV biological characteristics in serum samples of hepatitis B patients and drug screening.