CN105936912A - Cyclodextrin glycosyl transferase and preparation method thereof - Google Patents
Cyclodextrin glycosyl transferase and preparation method thereof Download PDFInfo
- Publication number
- CN105936912A CN105936912A CN201610490579.3A CN201610490579A CN105936912A CN 105936912 A CN105936912 A CN 105936912A CN 201610490579 A CN201610490579 A CN 201610490579A CN 105936912 A CN105936912 A CN 105936912A
- Authority
- CN
- China
- Prior art keywords
- thermococcus
- cyclodextrin
- cgt
- seq
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
- C12N9/1074—Cyclomaltodextrin glucanotransferase (2.4.1.19)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/01—Hexosyltransferases (2.4.1)
- C12Y204/01019—Cyclomaltodextrin glucanotransferase (2.4.1.19)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
Abstract
The invention discloses a cyclodextrin glycosyl transferase and a preparation method thereof, and relates to the field of cyclodextrin glycosyl transferase. According to the preparation method, the codon of cyclodextrin glycosyl transferase (Thermococcus sp. 4557) is optimized, the nucleotide sequence of gene of cyclodextrin glycosyl transferase is synthesized artificially, and the gene is cloned to a carrier (pUC57-Amp). Cyclodextrin glycosyl transferase gene (cgt), which is obtained after primer amplification, and pET-28m plasmid form a recombinant prokaryotic expression vector, then the expression of recombinant protein is performed in colibacillus BL21(DE3); after purification, the protein has a high purity and activity, and thus the purified protein can be applied to actual application. Cyclodextrin glycosyl transferase is expressed through homologous recombination, the shortages such as complication, tedious operation, low output, and the like, in separation and purification can be overcome; and the protein can be widely used in the fields such as biology, food, medicine, agriculture, and the like.
Description
Technical field
The present invention relates to cyclodextrin glycosyltransferase, especially relate to Thermococcus sp.4557 cyclodextrin glucose base
Transferring enzyme and preparation method thereof.
Background technology
Cyclodextrin (Cyclodextrin) refers to the polymer being made up of looped glucosyl group, the quantity of glucosyl group at 6 and
Above.Three kinds of main cyclodextrin be α-, β-and gamma-cyclodextrin, they contain 6,7 and 8 respectively
Glucosyl group.Research proves to make have stronger hydrophobicity inside it due to the hollow barrel structure of cyclodextrin, and outside but presents relatively
Strong hydrophilic nmature, can be used for embedding various hydrophobic compound.Therefore cyclodextrin has in commercial production and scientific research
The biggest application.
Cyclodextrin grape-transferase enzyme (Cyclodextrin glucanotransferases, CGTase；EC 2.4.1.19) it is that a class can
By the enzyme that Starch Conversion is ring-type glucosan, belong to α-amylase, GH13 hydrolase family.Cyclodextrin glycosyltransferase
Can be catalyzed four kinds of reactions, respectively dismutation reaction (Disproportionation), hydrolysis (Hydrolysis), open loop is anti-
Should (Coupling) and cyclization (Cyclization).Substrate according to enzyme effect and the difference of condition, occur different
Catalytic action and produce different products.
The microorganism that can produce cyclodextrin glycosyltransferase in nature has a lot, including bacillus cereus, pseudomonas,
Micrococcus luteus, acid-producing Klebsiella bacterium etc..Up to the present only the strain of industrial production cyclodextrin glycosyltransferase it is usually used in
Including bacstearothermophilus, basophilic Bacillus stearothermophilus, bacillus macerans etc. a few.Major part cyclodextrin Fructus Vitis viniferae
The cyclodextrin kind that glycosyl transferase catalytic starch generates is more miscellaneous, and specificity is poor, and yield also ratio is relatively low.Therefore by building
Engineering bacteria, it is achieved the overexpression of cyclodextrin glycosyltransferase becomes the focus of research.
Escherichia expression system owing to there is genetic background understanding, simple to operate, large scale fermentation cultivates and cost is relatively low etc.
Advantage, is the most frequently used expression system.Cyclodextrin glycosyltransferase solubility expression in escherichia coli takes in recent years
Obtaining preferable result, genes of interest multi-source used is in bacillus.Someone by by the β of basophilic Bacillus stearothermophilus-
The gene of cyclodextrin glycosyltransferase and pET-22b (+) vector plasmid recombinates, and carries out abduction delivering in escherichia coli,
Obtained beta-schardinger dextrin-glucosyltransferase is 9 times more than of yield under its natural endowment.But cyclodextrin glucose base turns
The heterogenous expression moving enzyme also exists the deficiency of many too: expression system does not has universality, part cyclodextrin glucose group-transfer
Enzyme gene cannot realize solubility expression；Most enzymes expressed are beta-schardinger dextrin-glucosyltransferase, less α-and gamma-cyclodextrin
Glucosyltransferase.Therefore, find that to have the cyclodextrin glycosyltransferase of advantageous property significant.
Summary of the invention
First purpose of the present invention is to provide Thermococcus sp.4557 cyclodextrin glucosyl transferase gene；
Second object of the present invention is to provide Thermococcus sp.4557 cyclodextrin glycosyltransferase；
Third object of the present invention is to provide the preparation method of Thermococcus sp.4557 cyclodextrin glycosyltransferase；
Fourth object of the present invention is to provide lives the biology of Thermococcus sp.4557 cyclodextrin glycosyltransferase
Property.
Thermococcus sp.4557 cyclodextrin glucosyl transferase gene, encodes Thermococcus sp.4557 cyclodextrin
The nucleotide sequence of glucosyltransferase, is denoted as cgt.
The molecule type of described Thermococcus sp.4557 cyclodextrin glucosyl transferase gene cgt is DNA, and sequence is special
Levying: a length of 2040bp, type is nucleic acid, and chain is double-strand, and topological structure is linear, described Thermococcus sp.4557
The sequence of cyclodextrin glucosyl transferase gene cgt is as follows, is designated as SEQ ID No.1:
The nucleotide sequence of described Thermococcus sp.4557 cyclodextrin glycosyltransferase uses following methods to obtain:
Jin Weizhi bio tech ltd, Suzhou carries out the codon optimized transformation of cyclodextrin glucosyl transferase gene, and by gene
It is cloned into carrier pUC57-Amp；Using composition sequence SEQ ID No.3 and SEQ ID No.4 as primer, expand through PCR
Obtain cgt gene nucleotide series SEQ ID No.1；Relevant nucleotide sequence obtains the polypeptide of gene code by software prediction
SEQ ID No.2, then builds prokaryotic expression carrier and obtains recombinant expression protein.
Described composition sequence SEQ ID No.3:CGGGATCCGTACGCCGTTCCGGAACGC.
Described composition sequence SEQ ID No.4:CCGCTCGAGTAGGGTTCTCA CCGATCGGGC.
Thermococcus sp.4557 cyclodextrin glycosyltransferase, including the Thermococcus with hydrolysis amylase activity
sp.4557 CGT。
The molecule type of described CGT is protein, sequence signature: a length of 680aa, and type is aminoacid, described CGT
Sequence as follows, be designated as SEQ ID No.2:
Described Thermococcus sp.4557 cyclodextrin glycosyltransferase, its albumen has amino shown in SEQ ID No.2
The polypeptide of acid sequence；Or by SEQ ID No.2 aminoacid sequence through at least one amino acid residue replacement, lack or add and
Formed, and have and the polypeptide of the aminoacid sequence identity function shown in SEQ ID No.2.
The preparation method of described Thermococcus sp.4557 cyclodextrin glycosyltransferase, comprises the following steps:
1) the codon optimized transformation of Thermococcus sp.4557 cyclodextrin glycosyltransferase and synthetic；
2) PCR of Thermococcus sp.4557 cyclodextrin glycosyltransferase expands and sequence analysis；
3) the recombinant expressed and purification of Thermococcus sp.4557 cyclodextrin glycosyltransferase.
Optimizing Reconstruction of the present invention synthetic Thermococcus sp.4557 cyclodextrin glucosyl transferase gene, and by base
Because being cloned into carrier pUC57-Amp, by primer amplification, clone and identify cyclodextrin glucosyl transferase gene cgt.
By build recombinant prokaryotic expression vector, escherichia coli carry out expression of recombinant proteins, overcome former bacterium isolated and purified during
The deficiencies such as complexity is loaded down with trivial details, yield poorly.Purity of protein after Simultaneous purification is high, vigor is good, for this albumen can be widely used in biology,
The research field such as food, medicine lays the foundation.
Accompanying drawing explanation
Fig. 1 is the SDS-PAGE spectrum of cgt DNA recombinant expression.M: albumen Marker；1: recombinant vector cgt
-pET-28m is at the non-abduction delivering of bacterial strain BL21 (DE3)；2: recombinant vector cgt-pET-28m bacterial strain BL21's (DE3)
Supernatant after ultrasonication after abduction delivering；3: recombinant vector cgt-pET-28m is ultrasonic broken at the abduction delivering of bacterial strain BL21 (DE3)
Broken rear inclusion body.
Fig. 2 is the SDS-PAGE spectrum of CGT purification.M: albumen Marker；1: through nickel post medium purification gained
Destination protein CGT.
Fig. 3 is that temperature affects collection of illustrative plates to CGT.Abscissa represents different temperatures；Vertical coordinate represents the relative activity of CGT.
Fig. 4 is that temperature affects collection of illustrative plates to CGT stability.Abscissa express time；Vertical coordinate expresses the relative activity of CGT.
Fig. 5 is that pH affects collection of illustrative plates to CGT.Abscissa represents different pH；Vertical coordinate represents the relative activity of CGT.
Fig. 6 is that pH affects collection of illustrative plates to CGT stability.Abscissa represents different pH；Vertical coordinate represents the relative activity of CGT.
Detailed description of the invention
Below in conjunction with specific embodiment, the present invention is expanded on further.Should be understood that these embodiments be merely to illustrate the present invention and not
For limiting the scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, generally according to normal condition as divided
Sub-cloning experimentation room handbook (1, Pehanorm Brooker, Russell (writes), and Huang Peitang (translates), " Molecular Cloning: A Laboratory guide ", science
Publishing house, the third edition in 2002) described in experiment condition, or according to the condition proposed by reagent or instrument manufacturer facility business.
For achieving the above object, the present invention uses techniques below measure, and it comprises the concrete steps that:
1. synthetic Thermococcus sp.4557 cyclodextrin glucosyl transferase gene
The codon optimized transformation of cyclodextrin glucosyl transferase gene is carried out in Jin Weizhi bio tech ltd, Suzhou, ring
Dextrin glucosyl transferase gene transformation and optimization synthetic gene, be cloned into carrier pUC57-Amp by gene.Obtain after optimizing
The named cgt of cyclodextrin glucosyl transferase gene obtained.
The PCR amplification of 2.Thermococcus sp.4557 cyclodextrin glucosyl transferase gene and sequence analysis
Arrange as template with Thermococcus sp.4557 Optimizing Reconstruction postorder, expand cyclodextrin glucose base with primers F and R and turn
Move enzyme cgt gene.
F:CGGGATCCGTACGCCGTTCCGGAACGC(SEQ ID No.3)；
R:CCGCTCGAGTAGGGTTCTCA CCGATCGGGC(SEQ ID No.4)；
Dashed part GGATCC represents BamH I restriction enzyme site, and GCTAGC represents XhoI restriction enzyme site.
(the carrier pUC57-Amp containing genes of interest) Han 0.5 μ l template in the reaction system of 50 μ l, 1 μ l primers F (10
μM), 1 μ l primer R (10 μMs), 4 μ l dNTP (each 2.5mM), 10 μ l 5 × PrimerSTARTMBuffer, 0.5 μ l
PrimerSTARTMHS DNA Polymerase (2.5U/ μ l) (TaKARa company), uses H2Cumulative volume is mended to 50 μ l by O.
PCR reaction condition is: 72 DEG C of 5min of 98 DEG C of 1min, 30cycles (98 DEG C of 10s, 54 DEG C of 30s, 72 DEG C of 2min)；4 DEG C of guarantors
Deposit.It is connected with carrier T after PCR primer is purified, is transformed in competent escherichia coli cell Top10, after bacterium colony PCR
Choose and have the positive colony of DNA fragmentation to check order.
Expression, purification and the protein renaturation of 3.Thermococcus sp.4557 cyclodextrin glucosyl transferase gene
By the plasmid containing cgt gene BamH I and Xho I enzyme action, glue reclaims cgt genetic fragment, simultaneously by plasmid pET-28m
Also enzyme action is carried out with identical enzyme.By both connections overnight (12～16h).Connect product and be transformed into competent escherichia coli cell
In TOP10, extract plasmid, sequence verification.
The correct plasmid cgt-pET-28m of order-checking converted BL21 (DE3), and after 37 DEG C of growths 15 hours, bacterium colony PCR checking plasmid turns
The correctness changed.Select and convert correct bacterium colony, be inoculated in the LB culture medium that 500mL contains 100mg/L kanamycin,
37 DEG C are shaken training to A600When=0.6, add isopropylthio-β-D-galactoside (IPTG) to final concentration 0.4mM, 37 DEG C of inductions
4～5h；Bacterium solution being collected to the centrifuge tube of 200mL, 8000g is centrifuged 10min precipitum cell；By somatic cells weight
Newly it is suspended in 20mL Binding Buffer (50mM sodium phosphate buffer, 300mM sodium chloride, pH=7.4), ultrasonic
Ripple processes and becomes translucent to bacterium solution, then 14000rpm is centrifuged 20min, abandons supernatant；Inclusion body is precipitated with containing 8M carbamide
Binding Buffer mixes dissolving；Rear 4000g to be dissolved is centrifuged the GE Healthcare after 5min, gained supernatant and balance
Ni sepharose (GE company) room temperature combines overnight.Purge process illustrates to carry out according to purification kit.The weight that purification obtains
Histone CGT through 10% SDS-PAGE electrophoretic analysis, its molecular weight is about 74kDa, and purity reaches more than 90% (Fig. 1,2).
The most single eluent albumen is all proceeded in bag filter, is placed on the Binding Buffer containing 6M carbamide molten
Liquid is in 4 DEG C of dialysis.Dialysis solution is changed so that it is urea concentration declines (4M, 2M, 1.5M, 1.0M, 0M) successively every 3h.
Finally obtain is renaturation CGT albumen.If (having Precipitation during albumen dialysis, the slow-speed of revolution can being centrifuged off continuation after precipitation
Dialysis)
4. the zymologic property of restructuring Thermococcus sp.4557 CGT
4.1 blue value methods (2, Zhang Shuzheng. Enzymes Industry [M], Science Press, 1984:547) detection restructuring cyclodextrin Portugal
The enzyme of glucosyl transferase is lived
1) in 5mL sample cell, add the addition of C GT enzyme liquid, add 0.2M glycine-NaOH buffer (pH 9.0) 0.2
ML, adds 0.2% potato starch solution 0.2mL (now with the current), is placed in uniform temperature water-bath placement 10min；
2) add 0.5M acetic acid 0.5mL after taking out immediately and terminate reaction.
3) adding the colour developing of 3mL 0.005% iodine liquid, simultaneously with distilled water as blank, the reactant liquor not adding enzyme liquid is comparison,
Measuring light absorption value (OD) under 700nm wavelength, an enzyme unit definition alive is the enzyme amount making absorbance decline needed for 10%, and enzyme is lived
It is calculated as follows:
U/mL=(a-b)/a*1000* enzyme liquid extension rate
In formula, a is matched group OD value, and b is sample OD value.
4.2 recombinase zymology Quality Research
1) preliminary experiment
Take 5 μ l respectively, 10 μ l, 20 μ l, 30 μ l enzyme liquid react according to the detection system in step 4.1, find the suitableeest adding
Zymologic property after the enzyme amount entered is carried out is tested.Choosing 20 μ l under conditions of guarantee enzyme is the most excessive to test, this system is
Standard reaction system.
2) optimal reactive temperature
The standard reaction system of enzyme is respectively placed in 30～90 DEG C of insulation 10min, surveys enzyme and live.
Fig. 3 is that temperature affects collection of illustrative plates to CGT.Abscissa represents different temperatures；Vertical coordinate represents the relative activity of CGT.
3) temperature stability
Enzyme is first respectively placed in 30 DEG C, 40 DEG C, 50 DEG C, 60 DEG C, 70 DEG C, in 80 DEG C of water-baths, different time takes out enzyme liquid,
Remnant enzyme activity is detected, using untreated enzyme as comparison by the reaction system of standard.
Fig. 4 is that temperature affects collection of illustrative plates to CGT stability.Abscissa express time；Vertical coordinate expresses the relative activity of CGT.
4) optimal reaction pH
Use NaAc-HAc buffer (4～6), NaH respectively2PO4-Na2HPO4Buffer (6.0～7.5), Tris-HCl buffer
(7.5～9.0), Glycine NaOH buffer (9～11) examine at 60 DEG C as reaction system buffer and configuration substrate solution
Survey the activity of enzyme.
Fig. 5 is that pH affects collection of illustrative plates to CGT.Abscissa represents different pH；Vertical coordinate represents the relative activity of CGT.
5) pH stability
Enzyme is first respectively placed in NaAc-HAc buffer (4～6), NaH2PO4-Na2HPO4Buffer (6.0～7.5), Tris-HCl
In buffer (7.5～9.0), Glycine NaOH buffer (9～11) buffer, after room temperature 2h, standard reaction system is at 60 DEG C
Detection remnant enzyme activity.
Fig. 6 is that pH affects collection of illustrative plates to CGT stability.Abscissa represents different pH；Vertical coordinate represents the relative activity of CGT.
Claims (7)
1.Thermococcus sp.4557 cyclodextrin glucosyl transferase gene, it is characterised in that coding Thermococcus sp.
The nucleotide sequence of 4557 cyclodextrin glycosyltransferases, is denoted as cgt.
2. Thermococcus sp.4557 cyclodextrin glucosyl transferase gene as claimed in claim 1, it is characterised in that
The molecule type of Thermococcus sp.4557 cyclodextrin glucosyl transferase gene cgt is DNA, sequence signature: length
For 2040bp, type is nucleic acid, and chain is double-strand, and topological structure is linear, and described Thermococcus sp.4557 ring is stuck with paste
The sequence of essence glucosyl transferase gene cgt is as follows, is designated as SEQ ID No.1:
3. Thermococcus sp.4557 cyclodextrin glucosyl transferase gene as claimed in claim 1, it is characterised in that
Its nucleotide sequence uses following methods to obtain: carry out the codon optimized transformation of cyclodextrin glucosyl transferase gene, and will
Gene is cloned into carrier pUC57-Amp；Using composition sequence SEQ ID No.3 and composition sequence SEQ ID No.4 as primer,
Cgt gene nucleotide series SEQ ID No.1 is obtained through PCR amplification；Relevant nucleotide sequence obtains base by software prediction
Because of the polypeptide SEQ ID No.2 of coding, then build prokaryotic expression carrier and obtain recombinant expression protein.
4.Thermococcus sp.4557 cyclodextrin glycosyltransferase, it is characterised in that include that there is hydrolysis amylase activity
Thermococcus sp.4557 CGT。
5. Thermococcus sp.4557 cyclodextrin glycosyltransferase as claimed in claim 4, it is characterised in that described
The molecule type of CGT is protein, sequence signature: a length of 680aa, and type is aminoacid, and the sequence of described CGT is as follows
Shown in, it is designated as SEQ ID No.2:
6. Thermococcus sp.4557 cyclodextrin glycosyltransferase as claimed in claim 5, it is characterised in that its albumen
There is the polypeptide of aminoacid sequence shown in SEQ ID No.2；Or
SEQ ID No.2 aminoacid sequence is passed through the replacement of at least one amino acid residue, lacks or add and formed, and have
Polypeptide with the aminoacid sequence identity function shown in SEQ ID No.2.
7. the preparation method of Thermococcus sp.4557 cyclodextrin glycosyltransferase as claimed in claim 4, it is special
Levy and be to comprise the following steps:
1) the codon optimized transformation of Thermococcus sp.4557 cyclodextrin glycosyltransferase and synthetic；
2) PCR of Thermococcus sp.4557 cyclodextrin glycosyltransferase expands and sequence analysis；
3) the recombinant expressed and purification of Thermococcus sp.4557 cyclodextrin glycosyltransferase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610490579.3A CN105936912A (en) | 2016-06-28 | 2016-06-28 | Cyclodextrin glycosyl transferase and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610490579.3A CN105936912A (en) | 2016-06-28 | 2016-06-28 | Cyclodextrin glycosyl transferase and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105936912A true CN105936912A (en) | 2016-09-14 |
Family
ID=56872057
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610490579.3A Pending CN105936912A (en) | 2016-06-28 | 2016-06-28 | Cyclodextrin glycosyl transferase and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105936912A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107980802A (en) * | 2017-12-06 | 2018-05-04 | 中国农业科学院棉花研究所 | Cyclodextrin glycosyltransferase is used for application and the bacteriostatic agent for suppressing verticillium dahliae |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102250931A (en) * | 2011-06-23 | 2011-11-23 | 广西大学 | Gene for coding beta-cyclodextrin glucosyltransferase and application thereof |
| CN103789329A (en) * | 2014-03-09 | 2014-05-14 | 吉林农业大学 | Alpha-cyclodextrin glucosyltransferase gene and application thereof |
-
2016
- 2016-06-28 CN CN201610490579.3A patent/CN105936912A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102250931A (en) * | 2011-06-23 | 2011-11-23 | 广西大学 | Gene for coding beta-cyclodextrin glucosyltransferase and application thereof |
| CN103789329A (en) * | 2014-03-09 | 2014-05-14 | 吉林农业大学 | Alpha-cyclodextrin glucosyltransferase gene and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| NCBI: "alpha-amylase [Thermococcus sp. 4557]，NCBI Reference Sequence: WP_014013230.1", 《GENBANK》 * |
| 夏亚穆 等: "环糊精葡萄糖基转移酶的基因改造与高效表达", 《中国生物工程杂志》 * |
| 王兴娜: "深海嗜热古菌Thermococcus sp.4557的全基因组分析及其功能基因的初步研究", 《万方学位论文》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107980802A (en) * | 2017-12-06 | 2018-05-04 | 中国农业科学院棉花研究所 | Cyclodextrin glycosyltransferase is used for application and the bacteriostatic agent for suppressing verticillium dahliae |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Delmer | Cellulose biosynthesis: exciting times for a difficult field of study | |
| CN109486786B (en) | Cyclodextrin glucosyltransferase mutant | |
| CN100436591C (en) | Production method and preparation method of glucans | |
| KR20090087935A (en) | Method for producing lacto-n-biose i or galacto-n-biose | |
| CN112342179B (en) | Bacillus subtilis genetic engineering bacteria for producing tagatose and method for preparing tagatose | |
| CN109880813B (en) | Beta-glucosidase with galactooligosaccharide synthesis capacity and expression strain and application thereof | |
| CN113528480B (en) | Alpha-1, 2-fucosyltransferase mutant and construction method and application thereof | |
| CN111344399B (en) | UDP-glucosyltransferase mutant, application thereof and method for preparing rebaudioside D by using same | |
| CN105838704A (en) | Nanofiber biological membrane immobilized bi-enzyme system and trehalose catalytic synthesis method thereof | |
| CN108884120A (en) | For the novel method by using microorganism purifying 3,6- dehydration-L- galactolipin | |
| CN112301012B (en) | Cyclodextrin glucosyltransferase mutant and construction method thereof | |
| WO2024045796A1 (en) | Cyclodextrin glucosyltransferase with improved solvent tolerance and preparation thereof | |
| CN105936912A (en) | Cyclodextrin glycosyl transferase and preparation method thereof | |
| CN113817704B (en) | Cyclodextrin glucosyltransferase with improved organic solvent tolerance and preparation method thereof | |
| CN111534495B (en) | Method for improving soluble expression of recombinant N-acetylglucosamine transferase II | |
| CN116200318A (en) | Recombinant bacillus subtilis for exocrine expression of D-psicose 3-epimerase | |
| CN113817709B (en) | Carbohydrate binding domain CBM68 and uses thereof | |
| CN104611284A (en) | Strain for production of cyclodextrin glucosyltransferase and application of strain | |
| CN111808836B (en) | Heat-resistant mutant enzyme of pullulanase I and preparation method and application thereof | |
| CN112094831A (en) | Mutant of cyclodextrin glucosyltransferase, gene for coding mutant, recombinant vector, preparation method and application | |
| CN111534498A (en) | Cyclodextrin glucosyltransferase mutant with improved disproportionation specific activity and AA-2G yield | |
| CN112210544B (en) | Cyclodextrin glucosyltransferase mutant and application thereof | |
| CN105821015B (en) | A kind of rice UDP-acetylglucosamine pyrophosphorylase and its application | |
| CN106086107A (en) | The production method of trehalose | |
| KR20080072496A (en) | Nostoc sp-derived amylopullulanase and preparation method of maltooligosaccharide with the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160914 |